Citation
In vitro and in vivo drug efficacy of the multi kinase inhibitor ON-01910.NA in high-risk human papillomavirus-positive head and neck squamous cell carcinoma

Material Information

Title:
In vitro and in vivo drug efficacy of the multi kinase inhibitor ON-01910.NA in high-risk human papillomavirus-positive head and neck squamous cell carcinoma
Creator:
Anderson, Ryan Taylor ( author )
Place of Publication:
Denver, CO
Publisher:
University of Colorado Denver
Publication Date:
Language:
English
Physical Description:
1 electronic file. : ;

Subjects

Subjects / Keywords:
Head -- Cancer ( lcsh )
Neck -- Cancer ( lcsh )
Biochemical markers ( lcsh )
Squamous cell carcinoma ( lcsh )
Genre:
bibliography ( marcgt )
theses ( marcgt )
non-fiction ( marcgt )

Notes

Review:
Head and neck squamous cell carcinoma (HNSCC) is a common malignancy with a ~50% mortality rate. Genetic predisposition, tobacco exposure, alcohol consumption and high-risk HPV infection are the major risk factors. Genetic analysis and DNA profiling studies suggest HPV-negative and HPV-positive tumors fall into two different molecular subclasses of HNSCC (Leemans, Braakhuis, & Brakenhoff, 2011a). Furthermore, whole exome sequencing of HNSCC tumor tissue obtained from large patient cohorts in two independent studies revealed a diverse mutational etiology regardless of the site of primary growth. A high frequency of activating mutations of TP53 and PIK3CA as well as loss-of-function mutations of NOTCH1 were common to both investigations (Agrawal et al., 2011b; Stransky et al., 2011). Relevant models are needed to investigate the differential treatment responses associated with the full spectrum of HNSCC subtypes. In this study we evaluated the efficacy of the phosphoinositide 3-kinase (PI3K) inhibitor ON-01910.Na against HNSCCs with differential HPV status both in vitro and in vivo. ON-01910.Na had potent antiproliferative effects on 11 of a panel of 18 HPV-negative HNSCC cell lines. Inhibition of S6 ribosomal protein phosphorylation and differential expression of PI3K, Myc, Fos, INPP4B, Hes1 and Hey1 were associated with a treatment-sensitive phenotype. We employed the transformed squamous epithelial cell line HaCaT expressing the HPV16 oncoproteins E6 and E7 as an in vitro surrogate to an HPV-positive HNSCC cell line. Initial characterization of these cells indicated that E6 and E7 expression increased proliferation, invasion, and PI3K/Akt pathway activation. Treatment of the transformed HaCaTs with ON-01910.Na did not inhibit activation of the PI3K/Akt pathway. We have developed a direct patient tumor xenograft mouse model as a pre-clinical platform to better mimic tumor environment. Primary tumors from 8 HNSCC patients, 4 positive for HPV16 infection, were implanted into mouse recipients to investigate the genetic and molecular basis, as well as epidemiologic trends, of treatment response in vivo. Drug efficacy was modest, and there was no observed correlation between HPV status, S6 phosphorylation, or differential gene expression and treatment outcome. However, a direct association between ON-01910.Na treatment sensitivity and NOTCH1 expression was identified.
Thesis:
Thesis (M.S.)--University of Colorado Denver. Biology
Bibliography:
Includes bibliographical references.
General Note:
Department of Integrative Biology
Statement of Responsibility:
by Ryan Taylor Anderson.

Record Information

Source Institution:
|University of Colorado Denver
Holding Location:
|Auraria Library
Rights Management:
All applicable rights reserved by the source institution and holding location.
Resource Identifier:
890723917 ( OCLC )
ocn890723917

Downloads

This item has the following downloads:


Full Text
IN VITRO AND IN VIVO DRUG EFFICACY OF THE MULTI KINASE INHIBITOR
ON-01910.NA IN HIGH-RISK HUMAN PAPILLOMAVIRUS-POSITIVE HEAD AND
NECK SQUAMOUS CELL CARCINOMA
by
Ryan Taylor Anderson
B.A., University of Colorado, 2006
A thesis submitted to the
Faculty of the Graduate School of the
University of Colorado in partial fulfillment
of the requirements for the degree of
Master of Biology
2012


2012
RYAN TAYLOR ANDERSON
ALL RIGHTS RESERVED


This thesis for the Master of Biology degree by
Ryan Taylor Anderson
has been approved for the
Department of Integrative Biology
by
Dr. Bradley J. Stith, Chair
Dr. Antonio Jimeno
Dr. Amanda Charlesworth
November 28, 2012
11


Ryan Taylor Anderson (M.S., Biology)
In vitro and in vivo drug efficacy of the multi kinase inhibitor ON-01910.Na in high-risk
human papillomavirus-positive head and neck squamous cell carcinomas
Thesis directed by Professor Bradley J. Stith.
ABSTRACT
Head and neck squamous cell carcinoma (HNSCC) is a common malignancy with a
-50% mortality rate. Genetic predisposition, tobacco exposure, alcohol consumption and
high-risk HPV infection are the major risk factors. Genetic analysis and DNA profiling
studies suggest HPV-negative and HPV-positive tumors fall into two different molecular
subclasses of HNSCC (Leemans, Braakhuis, & Brakenhoff, 2011a). Furthermore, whole
exome sequencing of HNSCC tumor tissue obtained from large patient cohorts in two
independent studies revealed a diverse mutational etiology regardless of the site of primary
growth. A high frequency of activating mutations of TP 5 3 and PIK3CA as well as loss-of-
function mutations of NOTCH1 were common to both investigations (Agrawal et al., 201 lb;
Stransky et al., 2011). Relevant models are needed to investigate the differential treatment
responses associated with the full spectrum of HNSCC subtypes. In this study we evaluated
the efficacy of the phosphoinositide 3-kinase (PI3K) inhibitor ON-01910.Na against
HNSCCs with differential HPV status both in vitro and in vivo. ON-01910.Na had potent
antiproliferative effects on 11 of a panel of 18 HPV-negative HNSCC cell lines. Inhibition of
S6 ribosomal protein phosphorylation and differential expression of PI3K, Myc, Fos,
INPP4B, TTesl and Heyl were associated with a treatment-sensitive phenotype. We
employed the transformed squamous epithelial cell line HaCaT expressing the HPV 16
oncoproteins E6 and E7 as an in vitro surrogate to an HPV-positive HNSCC cell line. Initial
characterization of these cells indicated that E6 and E7 expression increased proliferation,


invasion, and PI3K/Akt pathway activation. Treatment of the transformed HaCaTs with ON-
01910.Na did not inhibit activation of the PI3K/Akt pathway. We have developed a direct
patient tumor xenograft mouse model as a pre-clinical platform to better mimic tumor
environment. Primary tumors from 8 HNSCC patients, 4 positive for HPV16 infection, were
implanted into mouse recipients to investigate the genetic and molecular basis, as well as
epidemiologic trends, of treatment response in vivo. Drug efficacy was modest, and there was
no observed correlation between HPV status, S6 phosphorylation, or differential gene
expression and treatment outcome. However, a direct association between ON-01910.Na
treatment sensitivity and NOTCH1 expression was identified.
The form and content of this abstract are approved. I recommend its publication.
Approved: Bradley J. Stith


DEDICATION
I dedicate this work to my loving parents whose support has been
instrumental in my success throughout this experience. I would also like to dedicate this
to Karla, for her support, patience and understanding while completing this thesis.
v


ACKNOWLEDGMENTS
I would like to thank my research advisor, Dr. Antonio Jimeno, for his gracious
mentorship. I also wish to thank my committee chair, Dr. Bradley J. Stith, and committee
member, Dr. Amanda Charlesworth, for their guidance throughout this program. In
addition, a special thanks to Dr. Steven Keysar, Dr. John Jason Morton, Dr. Phuong Le,
Todd Pitts, Dr. Lisa Johansen, Brian Vogler, Justin Eagles-Soukup, and all other
members of the Jimeno Lab past and present.
vi


TABLE OF CONTENTS
CHAPTER
I. INTRODUCTION.............................................................1
HNSCC.................................................................1
Risk Factors..........................................................1
HPV in SCCs...........................................................2
Treatment Modalities..................................................3
PI3K..................................................................5
NOTCH1 Interplay with PI3K Signaling..................................6
Effect of ON-01910.Na Treatment in HNSCC..............................7
II. MATERIALS AM) METHODS....................................................9
Cell Culture..........................................................9
Clonogenic Assay......................................................9
SRB Proliferation Assay...............................................9
Generation of HPV16 E6- and E7-expressing HaCaT cells................10
Confirmation of viral DNA integration into host genome by PCR.......11
Cellular proliferation and invasion assays...........................11
Tumor Xenograft Experiments..........................................12
Western Blotting.....................................................13
qRT-PCR gene expression analysis.....................................14
Human papillomavirus detection.......................................14
FISH analysis........................................................15
DNA Isolation........................................................16
DNA Sequencing.......................................................16
vii


III. RESULTS
20
In vitro evaluation of ON-01910.Na activity in HNSCC immortalized cell lines 20
ON-01910.Na induced growth inhibition in HNSCC cell lines.........20
Gene expression profiling in HNSCC cell lines based on ON-01910.Na
treatment sensitivity.............................................22
Evaluating the human keratinocyte cell line HaCaT stably transfected with genes
encoding for the HPVI6 oncoproteins E6 and E7 as an HPV+ model.25
Confirmation of HP VI6 viral DNA integration......................26
Characterizing the transformed HaCaT phenotype....................28
Assessing outcome-specific biomarkers of ON-01910.Na treatment using a direct
patient tumor xenograft platform.....................................31
Anti-cancer effects of ON-01910.Na in xenografted tumor lines....31
PIK3CA gene amplification.........................................33
Mutation profiling................................................34
NOTCH1 expression in ON-01910.Na treated tissue correlates with drug
response..........................................................36
IV. DISCUSSION..............................................................39
ON-01910.Na outcome specific biomarkers and treatment efficacy in HNSCC
cell lines........................................................39
ON-01910.Na efficacy was not a result of PI3K pathway inhibition in the dual
transfected HaCaT cell line.......................................40
Identification of biomarkers in ON-01910.Na-sensitive HNSCC xenografts 41
Proposed mechanism of action by ON-01910.Na in HNSCC..............42
.44
viii
REFERENCES


LIST OF TABLES
Table
II. 1 Primers for cloning E6 and E7 into the retroviral vectors pLXSN and pLHCX.......11
II. 2 PCR amplification and sequencing primers........................................17
III. 1 Exome sequencing of PI3Kca, NOTCH 1, and PI3K..................................35
IX


LIST OF FIGURES
Figure
1.1 PI3K/Akt Signaling Pathway.................................................5
1.2 Interplay between PI3K/Akt, MEK/ERK, and NOTCH1 Signaling Pathways.......7
III. 1 In vitro ON-01910.Na efficacy.........................................21
IE.2 ON-01910.Na (l.OuM) treatment induced changes in cell line gene expression.... 24
III. 3 Confirmation of viral gene integration in the host cell genome........26
IE.4 Phenotypic classification of the HAE6/MycE7 dual transfect..............28
III.3 ON-01910.Na (l.OuM) treatment of HaCaT transfects......................30
111.6 Patient xenograft ON-01910.Na treatment efficacy........................32
111.7 PI3Kca amplification detected by FISH...................................34
III 8 Summary of genetic profiles and molecular markers of ON-01910.Na treated tumor
lines.........................................................................37
IV. 1 Proposed mechanism of action by ON-01910.Na in HNSCC xenografts.......43
x


LIST OF ABBREVIATIONS
CUHN University of Colorado head and neck
EGFR epidermal growth factor receptor
FISH fluorescence in situ hybridization
HPV human papilloma virus
HNSCC head and neck squamous cell carcinoma
PI3K phosphoinositide 3-kinase
PIK3CA phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha
PLK1 polo-like kinase 1
qRTPCR quantitative reverse transcriptase polymerase chain reaction
SRB sulforhodamine B
xi


CHAPTER I
INTRODUCTION
HNSCC
Collectively, squamous cell carcinomas (SCC) are the most abundant ectodermal
cancers worldwide. SCCs arise in the squamous epithelia located in the cervix, skin, lung,
esophagus and oral cavity (Goon et al., 2009). HNSCC is the sixth-most prevalent cancer
worldwide by incidence. These cancers present in the oral cavity, oropharynx, larynx, or
hypopharynx. Patient prognosis is determined largely by the tumor stage at presentation.
Stage is determined by tumor progression and the presence of metastasis after clinical
examination, imaging, lymph node cytology and post-surgery histopathology. One-third
of patients present with early-stage disease at diagnosis while a majority of new cases
present with advanced cancer and lymph node metastasis (Haddad & Shin, 2008).
Current estimates suggest that more than 600,000 cases will arise globally in 2012 with a
5 year patient survival rate of 40-50% (Wilken, Veena, Wang, & Srivatsan, 2011).
Despite the recent advancements in cancer treatment, little progress has been made in
overall survival of HNSCC patients.
Risk Factors
Tobacco use and alcohol consumption have historically been the most important
risk factors. Current epidemiologic understanding is that these factors are synergistic in
effect. Incidence of HNSCC in the western world has been on a slow decline over the
past decade which can be attributed to a decrease in the prevalence of tobacco use.
1


However, a subgroup associated with infection of high-risk HPV infection, notably in the
oropharynx, is becoming more prevalent (Leemans, Braakhuis, & Brakenhoff, 2011b).
HPV in SCCs
Extensive studies have shown that certain high-risk subtypes of HPV cause
malignancies of the cervix. Two high-risk subtypes, HPV16 and 18 are responsible for
about 70% of all cervical cancers (Moody & Laimins, 2010; Snow & Laudadio, 2010).
More recently, a strong association has emerged between high-risk HPV infection and the
development of HNSCC, especially in younger male patients. Meta-analysis data
suggests that HPV is detectable in 26-35% of HNSCC patients (Kreimer, Clifford, Boyle,
& Franceschi, 2005; Termine et al., 2008). Registry data collected by the Surveillance,
Epidemiology, and End Results (SEER) Program for HPV-positive oropharyngeal
squamous cell carcinomas documented an increase from 16% in 1984 to 72% in 2004
(Chaturvedi et al., 2011).
HPV viral oncoproteins E6 and E7 are the primary transforming factors following
infection. E6 and E7 work in concert to overcome cell cycle checkpoints and progress
cells through S-phase. The E6 oncoprotein has evolved to prevent growth inhibition and
apoptosis by interfering with p53 function through two identified mechanisms. E6
recruits cellular E3 ubiquitin ligase E6-associated protein leading to ubiquitination and
degradation of p53 (Scheffner, Huibregtse, Vierstra, & Howley, 1993). E6 can also bind
p53 directly, preventing p53 DNA binding activity (Lechner & Laimins, 1994). The E7
oncoprotein promotes cellular proliferation by binding to the retinoblastoma (RB) family
of proteins. RB proteins interact with E2F, repressing transcription at E2F-dependent
promoters (Dyson, 1998). The E2F family of transcription factors regulate genes
2


involved in cell cycle progression, differentiation, mitosis and apoptosis (DeGregori &
Johnson, 2006). Thus, E7 promotes premature entry into S-phase by disrupting RB-E2F
complexes and targeting RB for ubiquitin-dependent degradation, leading to constitutive
E2F-dependent gene expression (Zerfass et al., 1995). Interestingly, E7 expression has
been shown to upregulate Akt activity promoting PI3K pathway activation in human
keratinocytes which is likely a contributing factor in the progression to cancer (Menges,
Baglia, Lapoint, & McCance, 2006; Pirn, Massimi, Dilworth, & Banks, 2005).
High-risk HPV infection is necessary, but not sufficient for the progression to
malignancy. The habitual insult in differentiating cells by HPV infection leads to genetic
instability over time, promoting malignant transformation (Duensing & Munger, 2004).
Observations from genetic analysis and DNA profiling studies suggest that HPV-negative
and HPV-positive tumors fall into two distinct molecular subclasses of HNSCCs,
suggesting that each may require a different approach to treatment (Leemans et al.,
2011a).
Treatment Modalities
Patients with early-stage tumors and a more favorable prognosis are treated with
either surgery or radiotherapy. Surgery combined with post-operative radiotherapy has
become the bastion of treatment for patients with advanced disease. A large proportion of
patient deaths are due to locoregional recurrences, second primary tumors and distant
metastasis (Myers, 2010). The complexity of the molecular carcinogenesis and biological
heterogeneity present in HNSCC emphasize the need for novel therapeutic strategies.
Extensive investigation is currently devoted to targeted molecular therapies either alone
3


or in combination with cytotoxic treatments such as traditional chemotherapeutic agents
and radiotherapy (Bernier, Bentzen, & Vermorken, 2009).
Targeted molecular therapeutics are a promising and relevant approach to cancer
therapy. An ideal a molecular target should be required by proliferating cells,
overexpressed in the tumor tissue with minimal expression in normal tissue to limit drug
toxicity, have a proven role in oncogenesis, have robust pharmacodynamic biomarkers to
monitor target inhibition, and be associated with biomarkers predictive of therapeutic
outcome (Degenhardt & Lampkin, 2010).
Epidermal growth factor receptor (EGFR) overexpression is a characteristic in the
majority of HNSCCs. The EGFR-specific antibody Cetuximab is a potent inducer of cell-
mediated antibody-dependent cytotoxicity in HNSCC. Several clinical studies evaluating
Cetuximab/platinum-based chemotherapy have observed significantly improved overall
survival in patients with recurrent or metastatic HNSCC compared to either therapy alone
(Bourhis, Lefebvre, & Vermorken, 2010; Burtness, Manola, Axelrod, Argiris, &
Forastiere, 2008; Vermorken et al., 2008).
A plethora of targeted agents have followed suit, and are currently being tested as
augmentation therapy to mainstay therapeutic strategies. As knowledge of the molecular
pathways involved in pathogenesis, tumorigenesis and acquired resistance to therapy of
HNSCC continues to progress, new treatment protocols including relevant targeted
therapies will no doubt gain a stronghold. There are currently a variety of targeted
therapies which inhibit pathways critical to HNSCC maintenance and development
undergoing active clinical trial. The PI3K/Akt signaling pathway is currently a focus of
intense research as a targetable pathway (Howard, Lu, & Chung, 2012).
4


Figure 1.1 PI3K/Akt Signaling Pathway.
PI3K
Alterations to the PI3K/Akt signaling pathway are common across a broad
spectrum of cancer types. A simplified version of the PI3K/Akt signaling cascade is
detailed in Figure! 1. PI3K transduces stimuli received from receptor tyrosine kinases
(RTKs) into signaling cascades involved in the regulation of several normal cellular
processes including neovascularization, proliferation, cell motility, adhesion, survival and
apoptosis (Datta, Brunet, & Greenberg, 1999; Nicholson & Anderson, 2002). Several
studies have shown this pathway to be constitutively active in malignant cells, and a
direct association between enhanced PI3K/Akt pathway activation and tumor formation
within HNSCC has been identified (Estilo et al., 2003; Or, Hui, Tam, Huang, & Lo,
2005; Woenckhaus et al., 2002). Multiple components within the PI3K signaling cascade


have been well characterized as oncogenic. Dysregulation and/or genetic aberrations of
the phosphoinositide-3-kinase catalytic a gene (PI3Kca\ Akt, PDK1, mTOR, and PTEN
have been associated with HNSCC development (Bunney & Katan, 2010). Targeted
agents to members within this pathway are currently being evaluated in several cancer
types.
NOTCH1 Interplay with PI3K Signaling
Notch signaling during development regulates cell-fate determination, growth and
survival in a context-dependent manner (Penton, Leonard, & Spinner, 2012). In two
studies published last year, loss-of-function mutations in NOTCH1 were identified in 10-
15% of HNSCC patients, second only to TP53 (Agrawal et al., 2011b; Stransky et al.,
2011) . The high inactivating mutation rate suggests that NOTCH1 functions as a tumor
suppressor in normal squamous epithelia. Recently, we identified a correlation between
altered PI3K/Akt pathway activation and inactivating NOTCH1 mutations (Keysar et al.,
2012) . Cross-talk within intracellular signaling networks has become a focus in
characterizing the pharmacological response by to treatment in cancer cells (Eder, Vande
Woude, Boemer, & LoRusso, 2009). Interplay between the signaling cascades addressed
in this study is shown in Figure 1.2. The genes written in red are biomarkers used to
identify pathway activation.
6


Figure 1.2 Interplay between PI3K/Akt, MEK/ERK, and NOTCH1 Signaling
Pathways.
Effect of ON-01910.Na Treatment in HNSCC
Our lab is currently involved in the preclinical evaluation of ON-01910.Na as a
potential therapeutic treatment of HNSCC. ON-01910.Na is a multikinase non-ATP-
binding small molecule targeted agent that exhibits inhibitory activity of the PI3K
pathway, and disrupts PLK1-mediated G2-M phase transition. The mechanism of
PI3K/Akt pathway inhibition has not yet been elucidated. ON-01910.Na prevents PLK1
phosphorylation through Raf during the G2-M phase transition thus promoting mitotic
catastrophe. ON-01910.Na is the only dual inhibitor of the PI3K and PLK1 pathways
currently being investigated as a cancer therapeutic (Chapman et al., 2012).
The biological behavior of HPV+ HNSCCs is distinct from cancers associated
with alcohol and tobacco use (Myers, 2010). HPV status is an important prognostic
consideration in directing treatment strategies. The link between Akt activation and HPV
infection suggests that PI3K inhibition may be an appropriate therapeutic approach to
treating HPV-positive HNSCC. In this study our aim is to evaluate the efficacy of PI3K
7


inhibition by ON-01910.Na in HNSCC both in vitro and in vivo. Furthermore, we will
investigate the differential response to treatment in correlation to HPV status, genetic
aberrations, and molecular trends in an effort to identify biological markers of an ON-
01910.Na-sensitive phenotype.
8


CHAPTER II
MATERIALS AND METHODS
Cell Culture
Cells were cultured in DMEM (Invitrogen) supplemented with 10% fetal bovine
serum (Atlanta Biologicals) and 1% penicillin-streptomycin (Cellgro) at 37C in a
humidified incubator with a 5% C02 atmosphere.
Clonogenic Assay
Cells were seeded into 6-well plates (Greiner) at 500 cells/well in triplicate. 24
hours after the plates were seeded the media was removed and replaced with fresh media
or DMEM in the presence of On-01910.Na in 0.01, 0.1 and 1.0 uM concentrations for an
additional 96 hours. After 96 hours, cells were fixed with 1% formalin and stained using
0.5% Cresyl Violet (Invitrogen). Colonies were counted then normalized to the untreated
control which was considered to be 100%.
SRB Proliferation Assay
Cells were seeded into 96-well plates (Greiner) at 3000 cells/well in sextuplicate.
24 hours after the plates were seeded the media was removed and replaced with fresh
media or DMEM in the presence of On-01910.Na in 0.01, 0.1 and 1.0 uM concentrations
for an additional 96 hours. After 96 hours, cells were fixed in 10% trichloroacetic acid,
washed with DI water, stained with sulforhodamine B (Gbiosciences), washed with 1%
acetic acid, then dissolved in lOmM unbuffered Tris Base. Plates were put on a plate
shaker for 12 minutes at 400 rpm. Measurements at 750nm were taken using the Synergy
9


2 (Biotek) plate reader and samples were analyzed using Gen5 software (Biotek). Data
was normalized to the untreated control which was considered to be 100%.
Generation of HPV16 E6- and E7-expressing HaCaT cells
The immortalized keratinocytic cell line HaCaT and its transfected derivatives
were given to our lab by Barb Frederick (University of Colorado School of Medicine,
Division of Radiation Oncology). The parental line and transfects were maintained in
DMEM/F12 supplemented with 10% FBS. The viral oncogenes E6 and E7 were PCR-
amplified from the HPV16-positive cervical cell line CaSki using primers listed in Table
1. The 5 end of the E6 primer included an HA tag, and a myc epitope tag was added to
the E7 primer. PCR products were gel purified and cut with EcoBUBamUl (E6) or
Hindlll/Clal (E7). E6 was cloned into pLXSN (cut with EcoBJJBamHT) and E7 was
cloned into pLHCX (cut with HindllVClaT). Correct insertion was confirmed by
sequencing. Plasmids were transfected into the retroviral packaging cell line
AmphoPak293 (Clontech) using Superfect (Qiagen) according to manufacturers
instructions. Stable pLXSN-containing transfects were selected with G418 (400 pg/ml)
and pLHCX-containing transfects were selected with hygromycin (100 pg/ml).
Transfected AmphoPak293 supernates were used to transduce HaCaT cells according to
manufacturers directions, and selection for stable integration was performed as described
in Barb Fredericks personal communication.
10


Table II. 1 Primers for cloning E6 and E7 into the retroviral vectors pLXSN and
pLHCX.
Primer Sequence (5'to 3')
HAE6 (5' primer) Geeaattcatetacccataceaceteccaeactacectatecaccaaaaeaeaact1
E6 (3' primer) ggggatccttacagctgggtttctct
MycE7 (5' primer) ggaagcttatggaacaaaaacttatttctgaagaagatctgatgcatggagatacacct
E7 (3' primer) ggatcgatttatggtttctgagaaca
pLXSN 5' sequencing primer cccttgaacctcctcgttcgacc
pLXSN 3' sequencing primer gagcctggggactttccacaccc
pLHCX 5'sequencing primer agctctgtttagtgaaccgtcagatc
pLHCX 3'sequencing primer acctacaggtggggtctttcattccc
'Single underline= restriction site; double underline = epitope tag
Confirmation of viral DNA integration into host genome by PCR
DNA was extracted from lxlO6 cells using the Quick-gDNA MiniPrep (Zymo
Research) according to manufacturers instructions. CaSki was again used as a positive
control. The E6 and E7 products were amplified from 0.7ug of DNA using the GeneAmp
High Fidelity PCR System (Applied Biosystems) according to the manufacturers
protocol with an annealing temperature of 55C for 30 cycles. The primers used are
described in Table 1. PCR product was electrophoretically resolved on a 1% agarose gel
containing 0.005% ethidium bromide. Bands were observed using the ChemiDoc XRS
Imaging System and Quantity One software (BioRad).
Cellular proliferation and invasion assays
To examine proliferation, 4xl05 cells were plated in T75 flasks and allowed to
grow for 96 hours. Confluency of the lines ranged from 70-80% at the time which the
photographs were taken. All pictures were taken at a magnification of 40X. At this time
11


cell counts were made using the Countess Cell Counter (Invitrogen). All counts were
normalized to the parental line, and the data points were taken from triplicate samples.
For the invasion assay, 5xl04 cells were spun down and washed with PBS. This
was repeated three times. Each aliquot of cells was then resuspended in serum free media
and seeded in BioCoat Matrigel Invasion Chamber (BD Biosciences) according to the
manufacturers protocol. The Invasion Chambers were then transferred into the
companion plate using sterile forceps. The wells of the companion plate contained
DMEM with 10% FBS to be used as the chemoattractant. After 24 hours of incubation at
37C and 5% CO2 the PET membrane was fixed in 1% formalin, washed three times with
PBS, and stained by 0.1% crystal violet. The PET membranes were excised using a
scalpel, and fixed to a slide. All cells within frame were counted at 20X magnification.
The assay was run in triplicate, and each transfect was normalized to the parental cell
count.
Tumor Xenograft Experiments
Experiments involving athymic nude mice (Harlan Spraque Dawley) were
approved by the Office of Laboratory Animal Resources at the University of Colorado
Denver Anschutz Medical Campus. Athymic nude mice were used between the ages of 6
and 12 weeks. All mice were housed in the same environmental conditions where the
temperature, humidity, and light/dark cycles were controlled.
Ideally, 20 tumors are used for each treatment study; 10 per treatment group. A
minimum of 7 tumors are needed per treatment group for the data to be statistically
relevant. Tumor growth is then followed in 10 tumors throughout the 28 day treatment
study.
12


All patient tumor lines were taken from the head and neck tumor tissue bank kept
by our laboratory. These are direct patient xenografts taken from patients consented prior
to their surgery. Patient tumor lines were expanded once one tumor reached a volume of
1500 mm Tumor volume was approximated by digital caliper measurements using the
formula 0.5236 (length*width*width). Tumor tissue was sectioned into 3 mm
subsections in a sterile petri dish. A tumor subsection was then surgically implanted
subcutaneously into each hind flank after being washed in DMEM and coated with
matrigel. The tumor take rate of patient tumor lines ranged from 75-95%.
Once tumor volumes reached an average of 200 mm mice were randomly divided into
cages of 5 mice/treatment group. On-01910.Na was given via intraperitoneal injection
(6mg/kg) daily for 28 days. Treated mice were monitored daily, and tumor sizes were
measured twice weekly. Tumor sizes were then normalized to the first measurement,
which was considered to be 1.0, and averaged for each treatment group. Standard error
for each treatment group was calculated by the following equation: std dev/sqrt(# mice).
All mice were euthanized at the end of treatment.
Western Blotting
Tumors were harvested for protein extractions and immediately frozen in liquid
nitrogen on the final day of treatment 6 hours after drug administration. 50mg tissue
subsections were thawed in a 4X volume of RIP A Buffer (Cell Signaling Technologies).
Tissue was homogenized using individual single use plastic pestles. Samples were
centrifuged at 16000rpm at 4C. Protein concentration measurements were taken using
the ELx800 Absorbance Microplate Reader and Gen5 software (BioTek) according to the
manufacturers instructions. 40ng of protein was loaded per well into NuPage Novex 4-
13


12% Bis-Tris Midi Gel (Invitrogen), transferred using the iBlot Gel Transfer Stack
System (Invitrogen) then processed according to the manufacturers instructions. All
primary antibodies were purchased from Cell Signaling Technologies (4060 Phospho-Akt
(Ser473) (D9E) XP(R) Rabbit mAh, 4821 Akt (pan) (40D4) Mouse mAh (Biotinylated),
and 4228 Phospho-PI3 Kinase p85 (Tyr458)/p55 (Tyrl99) Antibody) and used in
dilutions recommended by the manufacturer. Secondary anti-rabbit IgG was purchased
from Immuno Research, and used in a 1:50,000 dilution.
qRT-PCR gene expression analysis
RNA isolated from tumor tissue was reverse-transcribed to cDNA in 20uL reactions
using the Verso cDNA Synthesis Kit (Fisher Scientific). Reverse transcription reactions
followed the protocol recommendations and were performed using the Verti 96-Well
Thermal Cycler (Applied Biosystems). TaqMan primer probes (Applied Biosystems) and
reactions were set up using the recommended volumes and concentrations. PCR
amplification and probe detection were accomplished utilizing the StepOnePlus Real-
Time PCR System (Applied Biosystems). All data are representative of experiments
performed at least two times in triplicate. Data are represented graphically as the mean
the standard error of the mean (SEM) after normalized to the endogenous control.
Human papillomavirus detection
In situ hybridization of HPV low and high-risk types was conducted using the
Ventana INFORM HPV II (low-risk HPV types 6 and 11) and HPV III (high-risk HPV
types 16, 18, 31, 33, 35, 39, 45, 51, 52, 56, 58 and 66) automated assays (Ventana
Medical systems, AZ) on 4 pm-thick paraffin embedded tissue sections. The Benchmark
14


system uses the Ventana ISH-Protease 3 enzyme to remove proteins surrounding the
target DNA. A biotinylated antiflourescin antibody is used to detect the hybridized probe,
followed by streptaviridin to bind biotin and then a chromagen reaction with nitoblue
tetrazolium and 5-Bromo-4-chloro-3-indolyl-phosphate for detection.
FISH analysis
Each sample was incubated at 56 degrees Celsius for 4 h, soaked in CitriSolv 3
times for 5 min each, dehydrated and allowed to air dry. The tissue area to be hybridized
was marked with a diamond pen. The slides were incubated in pretreatment solution at
80oC for ~12min, in protease solution IV at 37oC for ~20 min, washed in milli-Q water
at room temperature, dehydrated and air dried. The 3-color probe mixture was applied to
the selected hybridization areas, covered with coverslips and sealed with rubber cement.
DNA codenaturation was performed at 76oC for 5 min in a thermocycler and
hybridization was allowed to occur at 37oC for 40-48 hours. Post-hybridization washes
were performed through incubations in 2xSSC/0.3% NP-40 at 74oC for 2 min and 2xSSC
for 2 min each, followed by dehydration. Finally, 14 ul of DAPEanti-fade (0.3 ug/ml in
Vectashield mounting medium) was applied to the slide and the area covered with a
22x50 mm coverslip. Analysis was performed on epifluorescence microscopes using
single interference filters sets for green (FITC), red (Texas red), blue (DAPI), gold, dual
(red/green), and triple (blue, red, green) band pass filters. For each interference filter,
monochromatic images were acquired and merged using CytoVision (Leica
Microsystems Inc).
15


DNA Isolation
Fresh-frozen resected tumor tissue or cells were obtained from consented patients
treated for SCC at the University of Colorado Denver Anschutz Medical Campus, under
an IACUC approved protocol. Genomic DNA was isolated using the DNeasy Blood and
Tissue Kit (Qiagen, Germantown, MD).
DNA Sequencing
Extracted gDNA was PCR amplified using the GeneAmp High Fidelity PCR
System (Applied Biosystems P/N 4328214, Carlsbad, CA) containing 6% DMSO. All
primers were synthesized by Integrated DNA Technologies (Coralville, IA). Reactions
were carried out in 96-well ABI Veriti thermocycler (Applied Biosystems) using a
touchdown PCR protocol as described by (Sjoblom et al., 2006). DNA sample quality
and concentrations were assessed by gel electrophoresis. PCR amplification and Sanger
sequencing were performed using primer sets referenced in (Agrawal et al., 2011a).
Primers were renamed by the authors to better reflect the exon sequenced based on
current GenBank identification, and are referenced in table 1.
PCR product was directly sequenced using the BigDye Terminator Cycle
Sequencing Ready Reaction kit version 1.1 (Applied Biosystems P/N 4337451) by
modification of the standard protocol. In the case of difficult templates, this Ready Mix it
was combined with an aliqout of the dGTP BigDye Terminator Cycle Sequencing Ready
Reaction kit (Applied Biosystems P/N 4307175). The standard sequencing thermo-
cycling parameters were as follows: denaturation for 5 min at 94C, followed by 30
cycles of denaturation at 96C for 10 sec, annealing at 50C for 5 sec, and
16


extension/termination at 60C for 4 min, followed by incubation at 10C until the
samples were processed.
Residual dye-labeled dideoxynucleotides (dye-terminators) were removed from
the cycle-sequencing reaction products using the paramagnetic bead technology
(CleanSEQ, P/N 000136) from Agencourt Bioscience Corporation (Beverly MA 01915)
or (PureSeq, P/N P-3001-50) from Aline Biosciences, and a modification of the
manufacturers recommended protocol. The products were sequenced on a fluorescent
capillary automated sequencer an Applied Biosystems / Hitachi 3730 Genetic Analyzer
with a 50 cm long, 48-capillary array containing POP7 polymer.
Analyses of DNA sequences were done with Sequencing Analysis version 5.2 and
Sequence Scanner version 1.0 (both from Applied Biosystems). Alignments of DNA
sequences were done with Sequencher 4.8 (Gene Codes Corporation) and/or SeqScape
(from Applied Biosystems). PCR product sequence comparison to GenBank reference
sequence and mutation identification were accomplished using Mutation Surveyor
version 4.0.4 (SoftGenetics, State College, PA).
Table II.2 PCR amplification and sequencing primers.
Gene Coding Exon
Symbol Number
Forward PCR Primer Sequence
Reverse PCR Primer Sequence
TP53 1
TP53 2
TP53 3
TP53 4
TP53 5
TP53 6
TP53 7
TP53 8
TP53 9
AGGGTTGGAAGTGTCTCATGC
CAGTCAGATCCTAGCGTCGAG
GAGGAATCCCAAAGTTCCAAAC
GGGCCAGACCTAAGAGCAATC
CTGCTCAGATAGCGATGGTG
AGAAATCGGT AAGAGGTGGGC
TT GGGC AGT GCT AGGAAAGAG
GGAGCACTAAGCGAGGTAAGC
AGCTGCCTTTGACCATGAAG
AGCCCAACCCTT GTCCTT AC
AAATCATCCATTGCTTGGGAC
ACGTTCTGGT AAGGACAAGGG
AAGCTCCTGAGGTGTAGACGC
AGGCCCTT AGCCTCTGT AAGC
CATCCTGGCTAACGGTGAAAC
GTT GGGAGT AGAT GGAGCCT G
TTGTCTTTGAGGCATCACTGC
ATTGCACCATTGCACTCCC
17


Table II.2 (cont)
TP53 10
NOTCH1 1
NOTCH1 2
NOTCH1 3
NOTCH1 4
NOTCH1 5
NOTCH1 6
NOTCH1 7
NOTCH1 8
NOTCH1 9
NOTCH1 10
NOTCH1 11
NOTCH1 12
NOTCH1 13
NOTCH1 14
NOTCH1 15
NOTCH1 16
NOTCH1 17
NOTCH1 18
NOTCH1 19
NOTCH1 20
NOTCH1 21
NOTCH1 22
NOTCH1 23
NOTCH1 24
NOTCH1 25
NOTCH1 25
NOTCH1 25
NOTCH1 26
NOTCH1 26
NOTCH1 27
NOTCH1 28
NOTCH1 29
NOTCH1 30
NOTCH1 31
NOTCH1 32
NOTCH1 33
NOTCH1 34
CCATCTTGATTTGAATTCCCG
GCCTCACTAGTGCCTCGG
AATGGCCTAGTGTTCTGTCCC
AAGTACCTCAAGTTGCCTGGG
CAGGT GGCCT GAAGGGAG
CTTCTCGGCCAACCCTAGTC
ATTGCCACCCTGCGTCTTAG
ACCCAGGAT AACCTGAAAGGG
GGTGGTGTGCAGTGAGGTG
GGTTCGTTTCTGTCCCAAGTC
CCACTGTAGCCATAGCAACCC
CAGGTCTGGTCATGGGTGTC
CTGCCAGTTATAGCCCTGGTC
GGCTCAACAGACAGGGAAATC
CTCTGCGAGTCTGAGTGGATG
ATGCATGGTGTCTCCCTCC
AGACTCATCT AGCCTGCCTGG
CCAACTCCAGTTCCTGTGACC
AGACACCTTTGTCACAGGGC
GTGACGTGGTGTGAGAGCC
CGGCAGTTTCCACTTCTGTAG
AGCGAC AAGGT AACCTGCT G
TCTCTCTCCAGGTCTGACAGG
GGT AAGAGCAGGGCAGTGAG
GTCAATGACTTCCACTGCGAG
CCTT AGAACT GC AT GCTGGC
TGTGAGAATGACGCTCGTACC
GCTTTGTGGTTGTGGGTTTG
AGGTCCTCTCGGAACCTCC
CTGAGGGAGGACCTGAACTTG
GT AGCAACTGGCACAAACAGC
GAT AGAGTCGGCTGGTGCAG
TCGAACTACATAGAGGGAGTGAGC
AAGAAGTTCCGGGTGAGTCG
GTAAGCCTGGCCACTGCC
ATCTCAGGAGGGTCTCGTCTG
CCGT AGATGACCTGGGTGAG
AAGGCTCCTCTGGTCGGC
ATTGCAAGCAAGGGTTCAAAG
CAAAGTTTCCAAAGGGCG
CAGCAACCCAT GAT ACT GAGC
CTGTGCCCATGACAGGTTC
ATCCCGCCTTCCCAACTC
GAGGCCAGGCTCTTGTGTC
TCAGGTTATCCTGGGTGCAG
CCAGAATCGACTTCTCATCGG
GAAGCAACCCACAGATGTTCC
GACACAATCCACGGCCAG
CTTGTCAGTTTCACTGCCCTG
GTTGATCTCGCAGTTGGGTC
GACAACGCCTACCTCTGCTTC
ATCTCAAGCTCTGTGCAGGTG
GTCCCGATCCTGTGTCTCC
CCACCACTTTACCCTCCAGTC
ACTCTGATGGCGGAAAGACC
CACACCTGACCCAACCCTC
CAGGCT GCCAGCT ACT GC
GTGACCGTTCCCACCTCC
GGGTGGTAGACAGGTGAGGC
CATGGGCCTATCAGGTTCAG
CTGGTTCCTGGATGCCTCT
CTCTCCCGAGTGTCCGTG
AAAGACATCAGGGTGAGGAGG
CATCCTGGACTACAGCTTCGG
TTGAGGGAGCAGTCACCG
GGATGTGGGCTCACAGGTC
ACGACC AGT ACT GC AAGGACC
GGGAAGATCATCTGCTGGC
CTGCTGTCAGACCTGGCTTC
GCAGACTCCCGGTGAGGA
AGGGCTTCAAAGTGTCTGAGG
CCCACGTCTACTCTGAATGGG
ACCAAGT GCT GGGTGGT G
GAGACCAGCTGGAGGCAAC
AAGGAAGGCAGGAGCACT AAC
CATCCTCGCTGGTCCCAC
18


Table II.2 (cont)
NOTCHl 34
NOTCH1 34
NOTCHl 34
NOTCHl 34
NOTCHl 34
P1K3CA 2
P1K3CA 2
P1K3CA 3
P1K3CA 4
P1K3CA 5
P1K3CA 5
P1K3CA 6
P1K3CA 7
P1K3CA 8
P1K3CA 9
P1K3CA 10
P1K3CA 11
P1K3CA 12
P1K3CA 13
P1K3CA 15
P1K3CA 16
P1K3CA 17
P1K3CA 18
P1K3CA 19
P1K3CA 20
P1K3CA 21
CTGAGTGGAGAGCCGAGC
AGTTTGAATGGTCAATGCGAG
AAGGCACGGAGGAAGAAGTC
CTGCTGGACGAGTACAACCTG
ACTTCTTCCTCCGTGCCTTG
TTTAGGTTTCTGCTTTGGGACAAC
T GTT ACTCAAGAAGC AGAAAGGGAAG
TCCAAATCTACAGAGTTCCCTGTTTG
TTGTTGAAATTTCTCCCTTGAAA
TTT GCCTCCAGTT AAGGGT AGA A
T A AT GCTT GGGAGGATGCCC
CAAAAATTCCGTGGTTTTATATTTG
GT AGGAGTC ATTT AT AT ACTTT GAT G
GGAAAGAAT GGGCTT AAACCTT GA
AATCTTTGGCCAGTACCTCATGG
TTTCTGTAAATCATCTGTGAATCC
TTTGAACAGCATGCAAGAAT
TGGCTCATTCACAACTATCTTTCCC
TCTTTAGATCGGCCATGCAGAA
TGAGTGTTGCTGCTCTGTGTTG
TTGAGGTGAAAGTTGTAAATCTTTG
CCAAATTTGCATCTGTGGCATT
GGAAAGGCAGTAAAGGTCAT GC
TTAAATGGAAACTTGCACCCTG
TCATGGTGAAAGACGATGGACA
TCATTTGCTCCAAACTGACCAA
GCGCCGTTT ACTT GAAGG
TGTCCACAGGCGAGGAGTAG
T AGCTCATCATCTGGGACAGG
TCGCATTGACCATTCAAACTG
TCTCTGGGTGGGTTTCAGAAG
TTTCTTCACGGTTGCCTACTGG
AACAAATCT AAGTCATCCCACAAATG
T AAGCAGTCCCTGCCTTCAAGA
CAGATACTCATCCTCAATGTGATT
AGCTGTGGAAATGCGTCTGG
CATTCGGAGATTTGGATGTTCTC
CCCAGGCT GGTCT AAAAAAAT AT AC
CAATCAGCGGTATAATCAGGAG
CCACACTGCTGAACCAGTCAAA
TTGCAATATTGGTCCTAGAGTTCAT
CATGCTGAGATCAGCCAAATTCA
TTTCATTT ATTT ATGTGGACTTTCTGA
AAACAAATCAGGGTCAGTTTCTGC
GAACCACGGGAGTTTGACATTG
TTT GAGGGT AGGAGAATGAGAGAGAG
GCT AAATTCATGCATCAT AAGCTC
TGAT AATTACTGCAT ACATTTCTTT
CATCAAAT ATTTCAAAGGTTGAGCA
AAACAAATGGCACACGTTCTCG
TGATTGTTTCTAATAGAGCAGCCAGA
CT AT GC AATCGGTCTTT GCCT G
19


CHAPTER III
RESULTS
In vitro evaluation of ON-01910.Na activity in HNSCC immortalized cell lines
Application of cultured human cancer cells in research is greatly restricted by the
proliferative potential of the cells. Most human cells are limited to a finite number of
divisions prior to becoming senescent in culture. Several techniques exist to immortalize
cell lines derived from human tumors (Yeager & Reddel, 1999). Immortalized human
cancer cell lines are a valuable biological model to readily evaluate drug efficacy and
investigate treatment response of molecular pathways. Here we investigate ON-01910.Na
activity in a panel of 18 immortalized HNSCC cell lines. The HNSCC cell lines which
constitute our panel had been screened for high-risk HPV infection, and all tested
negative. Unfortunately we did not have an HPV-positive immortalized HNSCC cell line
available to us at the time of this study.
ON-01910.Na induced growth inhibition in HNSCC cell lines
Our panel of immortalized HNSCC cell lines was treated with ON-01910.Na in
O.luM, l.OuM and lO.OuM concentrations (Figure III.1A). Drug efficacy was assessed
by SRB assay 96 hours after drug addition. Average viability and standard error were
calculated from sextuplicate (N=6) cultures treated in parallel. Treatment data at each
concentration for every cell line was then normalized to the vehicle control, and cell lines
were arranged graphically based on their sensitivity profile. ON-01910.Na showed potent
antiproliferative activity at concentrations equal to or greater than l.OuM in eleven cell
20


lines. Moderate growth inhibition was observed in 5 HNSCC lines. MSK921 and
UMSCC19 were both resistant to treatment with ON-01910.Na at lOuM.
A
ON-01910.Na O.luM ON-01910.Na l.OuM ON-01910.Na lO.OuM
B
Figure III.l In vitro ON-01910.Na efficacy.
Treated cultures (N=6) were normalized to the untreated control data for each cell line
which was set at 1.0. A. Cellular viability of 18 HNSCC cell lines as measured by SRB
assay at O.luM, l.OuM, and lO.OuM concentrations. ON-01910.Na is a potent
antiproliferative agent at l.OuM and lO.OuM. B. Viability of 2 sensitive (584 and HN11)
and the 2 most resistant (MSK921 and UMSCC19) cell lines verified by clonogenic assay
at O.luM and l.OuM. Treatment at lO.OuM prevented colony formation in all cell lines.
Two sensitive (584 and HN11) and 2 resistant (MSK921 and UMSCC19) cell
lines were chosen to investigate response-specific changes in gene expression. Treatment
sensitivity for these cell lines was verified by clonogenic assay (Figure III. IB). SRB and
21


clonogenic assays are different approaches to measuring drug efficacy. Sulforhodamine B
(SRB) stains for total protein, and the SRB assay determines cell density based on a
measurement of total protein content. SRB is a more high-through put approach, and the
potential for error is greater due to the several steps involving washing, and the rate at
which the cell line grows. Clonogenic assay is a survival assay based on the ability of a
single cell to form a colony of 50 cells or more. The clonogenic assay is a more direct
measurement of viability, but is much more labor intensive. A full screen of the panel of
cell lines using the clonogenic approach may be necessary to better resolve a more
accurate sensitivity profile. Sensitivity to treatment at l.OuM was comparable to the SRB
assay results. However, treatment at the higher concentration prevented colony formation
in all 4 cell lines, while no significant effect was observed at 0. luM. Based on the
preceding results, a l.OuM concentration was used to assess changes in gene expression.
Gene expression profiling in HNSCC cell lines based on ON-01910.Na treatment
sensitivity
We then aimed to identify dynamic biomarkers of ON-01910.Na treatment
susceptibility and/or resistance. qRTPCR was performed on a panel of 15 genes selected
from a critical review of literature based on the proximity to PI3K and whether
fluctuations in gene expression had been observed after PI3K inhibition. An ON-
01910.Na treatment-specific pattern in gene expression change was identified in 6 of the
genes. Myc and Fos encode transcription factors upregulated in response to growth factor
activation of receptor tyrosine kinase cascades, importantly EGFR activation of PI3K
(Hardisson, 2003). INPP4B is a phosphatase that preferentially hydorlyzes
phosphatidylinositol-3,4-bisphosphate. Evidence suggests INPP4B may be involved in
22


Akt activation (Gewinner et al., 2009). Expression of the transcription factors Heyl and
Hesl are induced by the Notch signaling pathway (Schreck et al., 2010).
Down regulation of PI3K in treated cell lines was associated with Myc, Vos,
INPP4B, Hesl, and Heyl induction in the treatment sensitive cell lines (Figure III.2A).
Notably, Fos and Hesl mRNA levels increased by 16.1- and 19.4-fold respectively in
584. Myc, Fos, INPP4B, and Heyl all had moderate increases in expression induced by
ON-01910.Na treatment in HN11. Expression of PI3K, Myc and Fos did not change
significantly in the resistant cell lines when compared to the controls. INPP4B, Heyl and
Hesl were down regulated in response to ON-01910.Na treatment in the resistant
phenotype. There appears to be compensation through the MEK/ERK and NOTCH1
pathways in response to ON-1910.Na treatment downregulation of PI3K.
PI3K pathway activation in response to ON-01910.Na (O) treatment was assessed
by western blotting and compared to PI3K inhibition by ZSTK474 (Z), a molecule which
binds to the ATP-binding site of PI3K, as a positive control (FigureIII.2B). ZSTK474 had
very modest inhibition of the PI3K pathway although reduction of phosphorylation is
consistent in all 4 cell lines. Reduced activity of ZSTK474 is likely due to a faulty stock.
The phosphorylation of Akt at Ser473 in 584 was markedly reduced by ON-
01910.Na treatment, no decrease in phosphorylation was observed in HN11 or the
resistant cell lines. However, phosphorylation of S6 was inhibited completely after ON-
01910.Na treatment in the two sensitive lines, but not the two resistant lines. This data
suggests ON-01910.Na may be inhibiting the PI3K pathway downstream of Akt. Drug
activity of ON-01910.Na seems to working through a different mechanism than
ZSTK474.
23


A
25.00
a 20.00 -
1584
IHN11
IMSK921
I UMSCC19
-5.00 J
P13K
Myc
Fos
1NPP4B Heyl
Hesl
B
584 HN11 MSK921 UMSCC19
COZCOZCOZCOZ
pAkt
pS6
Pan-actin
Figure III.2 ON-01910.Na (l.OuM) treatment induced changes in cell line gene
expression.
A. Relative mRNA expression levels measured by qRTPCR for the 2 sensitive cell lines
shows down regulation of PI3K is associated with compensation in Myc, Fos, INPP4B,
Heyl and Hesl. Untreated control mRNA for each cell line was normalized to 0.0. B.
Differential Akt and S6 phosphorylation patterns associated with treatment were
identified by western blot analysis in untreated control (C), ON-01910.Na treated (O),
and the PI3K inhibitor ZSTK474 treated (Z) cell culture. S6K activation is inhibited by
ON-01910.Na treatment in the sensitive cell lines.
24


Evaluating the human keratinocyte cell line HaCaT stably transfected with genes
encoding for the HPV16 oncoproteins E6 and E7 as an HPV+ model
The observed correlation between enhanced Akt expression and HPV infection
suggests that the PI3K/Akt signaling pathway may have a facilitating role in HPV
directed transformation of squamous epithelia. Dysregulation of one of the several
components within the PI3K/Akt signal transduction pathway resulting in activation is
one of the most frequently observed molecular alterations in HNSCCs (Hennessy, Smith,
Ram, Lu, & Mills, 2005). Understanding the role of enhanced Akt expression during
tumorigenesis in HPV-positive cancers may provide insight into the fundamental
importance of PI3K signaling in oncogenesis.
Current knowledge of the consequences of high-risk HPV transformation has
been primarily based on studies in established cervical cancer cell lines. Due to the
emerging high risk HPV+ HNSCC subtype, an in vitro HPV+ model has become a
desirable preclinical tool. Unfortunately, there are currently no high risk HPV+ HNSCC
immortalized cell lines readily available. Dr. Barb Fredrick(University of Colorado
Denver School of Medicine) kindly provided us with the transformed squamous epithelia
line HaCaT stably transfected with the HPV16 viral oncogenes E6 and E7. There are few
studies elucidating the HPV-dependent mechanism of cancer progression in squamous
epithelia, which highlights the need for a treatment model and novel therapeutic approach
to addressing this emerging sub-type (Lace et al., 2011). Here, we evaluate the
transformed HaCaTs as an HPV16-positive surrogate platform for in vitro drug
screening.
25


Figure III.3 Confirmation of viral gene integration in the host cell genome.
A and B. HaCaT cells stained with secondary anti-rabbit conjugated with Alexafluor
A488 (green) and anti-mouse conjugated with Alexafluor A555 (orange) antibodies
bound to HAE6 and MycE7 respectively. The green and orange fluorescence in III.3B
indicates successful E6 and E7 gene transfection. C. Transfection of HPV16 E6 and E7
viral DNA was confirmed using end point PCR comparing the HaCaT parental (1),
pLXSN/pLHCX empty vector transfect (2) and HAE6/MycE7 dual transfect (3) to the
HPVI 6-positive cell line CaSki control (C).
Confirmation of HPV16 viral DNA integration
Stably transfected cells were selected for by the addition of G418 and hygromycin
to the growth media. Integration of the HP VI6 E6 and E7 viral proteins in the HaCaT
genome was confirmed using immunofluorescence (Figure III.3A). Primary antibodies
specific for HA and Myc were used to stain for the HAE6 and MycE7 conjugate proteins.
In figure III.3A, there is no HAE6 ( Alexaflour A488) localized within the cell, and
minimal background for MycE7 (Alexafluor A555) in the dual empty vector transfect
(pLXSN+pLHCX). However, an increase in staining for both HAE6 and MycE7 is
26


apparent in the dual transfect in Figure III3B. Due to the high background, these data
suggest that there is at least a low level of expression of both E6 and E7 within the
HaCaT dual transfects.
PCR confirmation was obtained using primers specific for E6 and E7 viral DNA
described in Table II.l. CaSki (C), an HPVI 6-positive human cervical cancer cell line,
was used as a positive control (Figure III.3B). No E6 or E7 amplification was observed in
either the parental line (1) or the empty vector transfect (2). However, amplification for
both viral sequences was apparent, albeit faint, in the dual transfect line (3). This data
validates that successful integration of both viral genes has taken place in the dual
transfect.
27


Figure 111.1 Phenotypic classification of the HAE6/MycE7 dual transfect.
Stable E6/E7 transfection led to a significant increase in proliferation and invasiveness
compared to the parental and empty vector HaCaT lines. A. Proliferation measured by
SRB assay. Cultures were normalized to the parental HaCaT line, and run in triplicate
(N=3). B. Invasive property of the HaCaT cell lines measured by counting established
colonies on the invasion chamber membrane then normalizing to the parental line.
Cultures were run in triplicate (N=3) C. Western blot analysis of PI3K/Akt pathway
activation of the HaCaT parental (1), pLXSN/pLHCX empty vector transfect (2) and
HAE6/MycE7 dual transfect (3). Successful E6/E7 transfection increased Akt and S6RP
phosphorylation.
Characterizing the transformed HaCaT phenotype
Phenotypic transformation of the E6/E7 dual transfect was then investigated.
Figure III.4A compares the proliferation between the three lines by assessing colony
formation by clonogenic assay. Each line was seeded in triplicate then allowed to
incubate 96 hours. Colonies were stained and colonies containing <40 cells were counted
28


in each well. The parallel cultures were averaged and normalized to the parental line.
Standard error for the triplicate samples was then calculated. Colony formation of the
parental (HaCaT) and empty vector transfect (pLXSN/pLHCX) were not statistically
different. However, the growth rate of the dual transfect (HAE6/MycE7) was double that
of the parental line.
The invasion potential of each line is characterized in Figure III.4B. Wells of 6-
well plates were filled with 3mL DMEM containing 10% FBS. PET membrane inserts
with 8 micron pores and a thin layer of Matrigel basement membrane matrix were placed
in the wells. The Matrigel surface opposite the PET membrane was then seeded with cells
in serum-free media. The invasion cultures were run in triplicate. Invasive cells detach
from the surface invading through the thin Matrigel layer and the PET membrane pores.
After a 22 hour incubation, cells on the membrane surface and seeding the six well plate
were fixed then stained, and the colonies were counted using the same protocol as the
clonogenic assay. Invasion counts were normalized to the parental line and the standard
error was calculated for the triplicate samples. The parental and empty vector transfects
had minimal invasion with only a few cells staining on the PET membrane for each. A 2-
fold increase in invasion was observed by the dual transfect compared to the parental
HaCaTs.
Activation of the PI3K/Akt pathway was observed by western blot analysis
(Figure III.4C). Increased levels of phosphorylation were observed for both Akt and S6 in
the dual transfect when compared to the parental or empty vector controls.
Western blot analysis of the three lines treated with ON-01910.Na showed no
inhibition of the PI3K activation (Figure III.2C). Increased phosphorylation of both Akt
29


and S6 in all three lines is obvious. Conversely, ZSTK474 treatment inhibited PI3K/Akt
transduction. The antiproliferative effects observed after ON-01910.Na treatment must be
due to interaction with other cellular processes. Observations linking E6 and E7
expression and PI3K/Akt modulation were also challenged. Akt and S6 phosphorylation
in the dual transfect appears to be constant in all three lines.
A
ra
a
o
CL
ai
>
_ra
ai
0£
1.0
0.9
0.8
0.7
0.6
0.5
0.4
0.3
0.2
0.1
0.0
HaCaT
ON-01910,Na O.luM
ON-01910.Na l.OuM
ON-01910,Na lO.OuM
pLHCX/pLXSN E6/E7
HaCaT pLHCX/ HAE6/ HaCaT pLHCX/ HAE6/
pLXSN MycE7_____PLXSN MycE7
CO COCO CZCZCZ
pAkt
pS6
Pan-actin
Figure IIE.2 ON-01910.Na (l.OuM) treatment of HaCaT transfects.
A. SRB data identified no significant change in viability at l.OuM and lO.OuM
concentrations of ON-01910.Na. B. Western blot staining shows treatment with ON-
01910.Na (O) induces Akt and S6RP phosphorylation in the parental, empty vector, and
transfected HaCaT lines compared to the untreated (C) control. The increase in
PI3K/Akt/S6K pathway activation was inhibited by treatment with the PI3K inhibitor
ZSTK474 (Z).
30


Although all three HaCaT lines were sensitive to treatment with ON-01910.Na at
l.OuM and 10.0 uM, growth inhibition did not vary significantly in the transformed
HaCaTs from the controls. Western blotting results from treatment studies suggest an
increase in the PI3K/Akt/S6K pathway with ON-01910.Na treatment. Conversely,
inhibition of Akt and S6 phosphorylation was observed when these cultures were treated
with ZSTK474 suggesting ON-01910.Na works through a very different mechanism of
action than ZSTK474.
Assessing outcome-specific biomarkers of ON-01910.Na treatment using a direct
patient tumor xenograft platform
While in vitro drug screening techniques provide a powerful and simple platform
on which to initially evaluate therapeutic efficacy and mechanism, cell line discoveries
often do not translate well to in vivo drug activity. We next set out to evaluate ON-
01910.Na activity in a direct patient tumor xenograft model, and assess the biomarkers
identified in our cell line panel within a more clinically relevant model system.
Anti-cancer effects of ON-01910.Na in xenografted tumor lines
Treatment data was obtained from 8 established patient tumor lines implanted in
female immunocompromised Athymic Nude-Foxnlnu mice. Tumor measurements
normalized to the average volume of the control group taken on day 28 from each study
are shown in figure in.6. Tumor lines are ordered from most sensitive to most resistant.
Growth reduction in the ON-01910.Na treated group was observed in CUHN014,
CUHN047 and CUHN026. No significant response was observed in the remaining 5
tumor lines.
31


Figure III.3 Patient xenograft ON-01910.Na treatment efficacy.
Mice bearing patient derived tumors received daily ON-01910.Na infusions or vehicle for
28 days. Volumes on the final day of treatment are represented as % normalized to the
vehicle control group. Growth reduction was identified CUHN014, CUHN047 and
CUHN026.
I hypothesized ON-01910.Na treatment is a rational approach to therapy for
HPV16+ HNSCC due to the observed correlation between HPV infection and both the
activation of Akt/MAPK/S6K and enhancement in PLK1 expression (Keysar et al., 2012;
Incassati et al., 2006). Half of the chosen tumor lines were positive for HPV16 infection:
CUHN014, CUHN047, CUHN043 and CUHN022. There was however no correlation
between HPV status and drug response (Figure III.6).
Next, we looked at the gene expression profile identified by qRTPCR in the
sensitive HNSCC cell lines. No trend was observed in relative mRNA expression levels.
We expanded the testing to the remaining 9 genes initially chosen. No biomarkers from
the qRTPCR panel conferred a trend based on treatment sensitivity (data not shown).
32


PIK3CA gene amplification
Fluorescence in situ hybridization (FISH) using probes specific for the catalytic
subunit of PI3K (PIK3CA) was obtained based on the high prevalence of gene copy
number gain abnormalities which exists in HNSCC (Garg et al., 2005). Sensitivity to
EGFR inhibition seems to have a direct correlation with EGFR overexpression in a subset
of patients (Cassell & Grandis, 2010). It follows that amplification of PIK3CA gene
product may yield a more sensitive phenotype to PI3K inhibition. Given the high
prevalence of activating PIK3CA gene abnormalities reported for HNSCC, the next
logical step was to look for copy number gain. The FISH score quantifies the presence of
signal clusters within a given cell after normalization. A FISH score of 5 denotes a
positive hit for gene amplification. Three of the eight tumor lines had PIK3CA gene
amplification (Figure III.7A). Two, CUHN014 and CUHN047, were also sensitive to
treatment with ON-01910.Na. However CUHN013 was resistant to ON-01910.Na
treatment despite having PI3KCA amplification.
33


A
Tumor Line scored cells PK3CA FISH Score
Mean SD % cells w ith <2 signals % cells w ith 3 signals % cells w ith >4 signals
CUHN013 50 6 48 5.18 12.0% 14.0% 74.0%
CUHN014 50 4 78 4.94 20.0% 30.0% 50.0%
CUHN022 50 2.92 1 52 40.0% 32.0% 28.0% 2
CUHN025 34 2 42 1.49 58.0% 30.0% 12 0% 2
CUHN026 50 6 44 3 70 8.0% 6.0% 86 0% 4
CUHN040 50 7.16 2.78 2.0% 4.0% 94.0% 4
CUHN043 50 3.58 1.73 28.0% 26.0% 46.0% 3
CUHN047 50 7.32 8.68 24% 12% 64%
Figure III.4 PI3Kca amplification detected by FISH.
A. Gene amplification was characterized by a FISH score above 4. PI3Kca amplification
was observed in 3 tumor lines (highlighted red). B. CUHN025: PI3Kca-na. C.
CUHN013: PI3Kca-amp.
Mutation profiling
It has been observed that the genetic landscapes of HPV- and HPV+ HNSCC
differ significantly (Klussman et al, 2009). Mutations in 1'P 5 3 and PIK3CA have been
described as drivers in HNSCC tumorigenesis in HPV-negative tumors (Stransky et al.,
2012). Amassing evidence substantiates a relationship between TP53 mutations and
prognosis in head and neck cancers. Due to TP53 inactivation by HPV oncogenes, an
inverse correlation between TP53 mutation and HPV infection has been well documented
(Keysar et al., 2012; Westra et al., 2008).
34


Two studies examining full exome sequencing in large patient cohorts identified
loss-of-function mutations of NOTCH I in 10-15% of HNSCC, second only to TP 5 3
(Agrawal et al., 2011b; Stransky et al., 2011). The high mutation rate suggests that
NOTCH1 functions as a tumor suppressor in HNSCC. We recently identified a
correlation between altered PI3K/Akt pathway activation and inactivating NOTCH1
mutations. Furthermore, we observed interplay between NOTCH1 and MEK/ERK
(Keysar et al., 2012).
Table III.l Exome sequencing of PI3Kca, NOTCH1, and PI3K.
~jr-o'L - -v '.<3CA Vttnon .VOTCVJ V-t: cr,
S12777A(eZs$£( -ete*or^go^s C 5 G RAC G G -
C--S01S Nye Soe ' £1
Cw-SOl- - Nre so-e So"e
C-S0ZZ - srt \0" s eye
C--SGZ^ sore So-e GiSS?*" G2A5* 1 -ffteOTfgo-s G G G C G t C - ' T G r\'
C--S025 giss-a i:^<\ -te'OTf5C!J5 C&C GM5C1G5 A -A.; 'Aa/xIV'aIX So-* G:3-?i-;GZA3VJ -o^crfgo.s 5GGCS-C. a/\/V',.'u ' G A .
C--VWO Sore eKHMuza-i t65i"S5C- -ete-.:.-,. . ^ AAA : Sere
C--SCH- * Sfire So Sere
- So-e \o*e Sore
Whole exome sequencing of PIK3CA, NOTCH 1 and TP53 was completed for the
patient tumor lines (Table III. 1). A single mutation in PI3KCA was identified. CUHN026
harbors a heterozygous E545K substitution. This variant has been catalogued as an
activating mutation located within the helical domain (Lee et al., 2005). Growth of
CUHN026 was reduced in the ON-01910.Na treatment group consistent with our


hypothesis that ON-01910.Na treatment will have a more potent effect in the presence of
PI3K pathway activation.
CUHN040 harbored a heterozygous R1279H substitution in NOTCH1. Agarwal et
al., 2012 annotated this mutation as a loss of function due to its location within the EGF-
like repeats domain. However, this amino acid changed registered as benign using the
PolyPhen-2 program to predict the structural impact of an amino acid substitution.
TP53 somatic mutations were identified in 3 tumor lines. G245V was identified in
two tumor lines; heterozygous in CUHN025 and homozygous in CUHN026. A
heterozygous G266E substitution was identified in CUHNO13. These mutations are
located within the DNA binding domain which suggests they are inactivating.
Confirming prior observation, none of the TP53 mutated tumor lines were HPV-positive.
NOTCH1 expression in ON-01910.Na treated tissue correlates with drug response
Figure IIF8A summarizes the data characterizing PI3Kca, NOTCH1 and IP53
genetic abnormalities within each tumor line. Interestingly the responsive tumors lines all
have a PI3KCA genetic event, be it amplification or activating mutation, and are either
HPV16-positive or harbor an inactivating IP53 mutation. However, this trend is broken
by CUHN013, which has a resistant phenotype in spite of a PI3KCA amplification and
TP53 mutation.
36


A ______ ' Res.
014 047 r 026 r 040 025 043 013 r 022
HPV+
Pik3ca Event Amp Amp Mut Amp
TP53 Mut.
NOTCH1 Mut.
Figure III.5 Summary of genetic profiles and molecular markers of ON-01910.Na
treated tumor lines.
A. Summary of genetic abnormalities within the treated tumor lines. Tumors lines are
arranged in order of increasing resistance to ON-01910.Na treatment. No correlation
exists between any single genetic event and treatment sensitivity. The more sensitive
lines each possess a PIK3CA activating event and a 1'P 5 3 inactivating event. B. Western
blot analysis identifies a correlation between NOTCH1 expression and ON-01910.Na
sensitivity in the control (C) and ON-01910.Na (O) treated tissue.
Phosphorylation of Akt and S6 did not confer the post-treatment trend observed in
HNSCC cell lines (Figure III8B). In fact, no consistent trend of phosphorylation was
observed regardless of treatment outcome. The PI3K/Akf signaling pathway does not
appear to be the target of ON-01910.Na drug activity. However, a comprehensive trend
specific to an ON-01910.Na-sensitive phenotype emerged from NOTCH1 staining. ON-
01910.Na treatment responsive xenografts have a higher baseline level of NOTCH1
expression. Moreover, enhanced NOTCH1 expression is observed in the treated tissue of
the more sensitive tumor lines. Conversely, CUHN013 has a higher baseline level of
NOTCH1 associated with a decrease in NOTCH1 expression in the ON-01910.Na treated
37


tissue. Taken together, these results suggest NOTCH1 may be a biomarker of ON-
01910.Na treatment outcome.
38


CHAPTER IV
DISCUSSION
ON-01910.Na outcome specific biomarkers and treatment efficacy in HNSCC cell
lines
Inhibition of the PI3K/Akt signaling pathway, preliminary data in the treatment of
solid tumors, and clinical relevance purport ON-01910.Na to be a promising candidate
therapeutic for the treatment of HPV-positive HNSCCs. Our treatment data in HNSCC
cell lines bolsters justification to further pursue preclinical experimentation with this
drug. Thirteen out of 18 cell lines had an IC5o>10uM, 3/18 had an IC5o>10.0uM, and
only 2 cells were resistant to ON-01910.Na treatment. Furthermore, ON-01910.Na
completely inhibited colony formation at lO.OuM.
We identified an ON-01910.Na-sensitive gene expression pattern in the HNSCC cell
lines. PI3K downregulation correlated with increased Myc, Vos, INPP4B, Heyl and Hesl
expression. The elevated levels of Myc and Fos can likely be attributed to increased
signaling through the MAPK pathway following EGFR activation. High levels of EGFR
expression are common to a majority of epithelial malignancies including HNSCC (Baba,
Fujii, Tokumaru, & Kato, 2012; Leemans et al., 2011a). Heyl and Hesl are both
transcribed following NOTCH1 activation (Katoh & Katoh, 2007). The observed gene
expression pattern suggests that PI3K down regulation in the sensitive cell lines is
associated with compensation by EGFR and NOTCH1 pathway activation.
Inhibition of the PI3K pathway following ON-01910.Na treatment was confirmed
in the western blot comparison of the sensitive cell lines to the resistant cell lines. We
have found that S6 phosphorylation is a better marker of PI3K pathway inhibition than
39


Akt using the PI3K inhibitor Px-866 (Keysar et al., 2012). Phosphorylation of S6
ribosomal protein was completely inhibited in the ON-01910.Na sensitive cell lines.
However, phosphorylation of Akt was not treatment outcome specific. This suggests that
ON-01910.Na acts downstream of Akt in the mTOR pathway, or through a different
mechanism entirely.
ON-01910.Na efficacy was not a result of PI3K pathway inhibition in the dual
transfected HaCaT cell line
The E6/E7 transfected HaCaTs displayed characteristic changes consistent with a
cancer-like phenotype. Proliferation and invasion rates double compared to the control
lines. More importantly, activation of the PI3K/Akt pathway was observed by western
blotting. ON-01910.Na treatment of the three strains yielded some troubling results.
While the dual transfect was sensitive at all concentrations, relative proliferation did not
differ significantly from the empty vector transfect or the parental line at the higher
concentrations. Furthermore, western blotting showed an increase in PI3K/Akt pathway
activation after treatment with ON-01910.Na., whereas treatment with ZSTK474 yields
significant inhibition of Akt and S6 phosphorylation. Taken together this data suggests
ON-01910.Na inhibits proliferation through an entirely different mechanism than PI3K
pathway suppression. While phenotypic differences existed between the dual transfect
and the controls, there was no significant difference in ON-01910.Na treatment outcome
or PI3K pathway depression. Further characterization is needed to evaluate the potential
of the dual transfect as an HPV-positive surrogate.
40


Identification of biomarkers in ON-01910.Na-sensitive HNSCC xenografts
Only modest drug activity was observed in our patient xenograft model. After 28 days
of treatment, growth reduction was observed in the 3 most sensitive lines. PI3K
modulation by HPV infection did not yield a more sensitive phenotype. There was no
inhibition of phosphorylation of neither Akt nor S6 in response to ON-01910.Na
treatment. Furthermore, no correlation was identified between any PIK3CA activating
event and a treatment sensitive phenotype. Taken together, these results suggest there is
no inhibitory effect on the PI3K pathway by ON-01910.Na in the HNSCC xenografts
treated.
Mutations in TP53 are present in -50% of HNSCC patients. Given that the HPV viral
oncoprotein E6 works to inactivate p53, an inverse correlation has been documented
between HPV infection and TP53 mutations (Goon et al., 2009). Our data confirmed this
observation. Direct exon sequencing of TP53 showed no link between inactivating
mutations and ON-01910.Na sensitivity alone.
However, a correlation between sensitivity to ON-01910.Na treatment and the tumor
line having both a PIK3CA activating event and either a deleterious IP53 mutation or
p53 inactivation by HPV16 infection was identified. CUHN013 satisfied these criteria as
well while having an ON-01910.Na-resistant phenotype. This suggests that the
combination of a PIK3CA activating event and IP53 inactivating event is sufficient, but
does not necessarily yield an ON-01910.Na-sensitive phenotype.
NOTCH 1 was recently identified in two independent studies as being second only to
TP53 in the rate of mutation in HNSCC patients (Agrawal et al., 2011b; Stransky et al.,
2011). In a manuscript currently under review for publication, Keysar et al. showed that
41


inactivating mutations in NOTCH1 correlate with altered PI3K/Akt pathway activation to
compensate. Furthermore, there was interplay between NOTCH1 and MEK/ERK. The
observed upregulation of Hesl and Hey I in our cell lines suggests NOTCH1 signaling
pathway augmentation by ON-01910.Na. Only CUHN040 harbored a NOTCH1 mutation,
and was not sensitive to treatment with ON-01910.Na. PolyPhen-2 analysis scored this
mutation as benign, however this amino acid substitution was annotated as damaging
(Agrawal et al., 2011b). Interestingly, we observed enhanced NOTCH1 protein
expression in the treated tissue of the ON-01910.Na-sensitive xenografts, whereas the
more resistant tumor lines did not express NOTCH1 in measurable concentrations.
Proposed mechanism of action by ON-01910.Na in HNSCC
ON-01910.Na was initially characterized as an inhibitor of PLK1 which led to
interest in its potential as a cancer therapeutic. The mechanism by which PLK1 activity is
inhibited during mitosis was identified within the last year. ON-01910.Na binds to Raf,
preventing its binding to and the phosphorylation of PLK1. Based on our observations
that ON-01910.Na does not inhibit PI3K pathway activation in HNSCC xenografts and
the enhanced NOTCH1 expression observed in ON-01910.Na treated tumor tissue, I
propose that ON-01910.Na is in fact inhibiting the activity of Raf in the Ras/MEK/ERK
signaling pathway. This would explain the presence of elevated NOTCH1 expression to
compensate for EGFR/MEK/ERK pathway inhibition. This mechanism is outlined in
Figure IV. 1. Further investigation is needed to substantiate the effect of ON-01910.Na
treatment on the Ras/MEK/ERK pathway
42


EGFR ON-01910.Na
Ras/MEK/ERK
N0TCH1 Expression
Figure IV.l Proposed mechanism of action by ON-01910.Na in HNSCC xenografts.
43


REFERENCES
Agrawal, N., Frederick, M. J., Pickering, C. R., Bettegowda, C., Chang, K., Li, R. J., . .
Myers, J. N. (2011a). Exome sequencing of head and neck squamous cell
carcinoma reveals inactivating mutations in NOTCH1. Science, 333(6046), 1154-
1157. doi: science. 1206923 [pii]
10.1126/science. 1206923
Agrawal, N., Frederick, M. J., Pickering, C. R., Bettegowda, C., Chang, K., Li, R. J., . .
Myers, J. N. (2011b). Exome Sequencing of Head and Neck Squamous Cell
Carcinoma Reveals Inactivating Mutations in NOTCH1. Science, 333(6046),
1154-1157. doi: DOI 10.1126/science. 1206923
Baba, Y., Fujii, M., Tokumaru, Y., & Kato, Y. (2012). Present and Future of EGFR
Inhibitors for Head and Neck Squamous Cell Cancer. J Oncol, 2012, 986725. doi:
10.1155/2012/986725
Bernier, J., Bentzen, S. M., & Vermorken, J. B. (2009). Molecular therapy in head and
neck oncology. Nature Reviews Clinical Oncology, 6(5), 266-277. doi: DOI
10.1038/nrclinonc.2009.40
Bourhis, J., Lefebvre, J. L., & Vermorken, J. B. (2010). Cetuximab in the management of
locoregionally advanced head and neck cancer: expanding the treatment options?
EurJCancer, 46(11), 1979-1989. doi: 10.1016/j.ejca.2010.05.015
Bunney, T. D., & Katan, M. (2010). Phosphoinositide signalling in cancer: beyond PI3K
and PTEN. Nat Rev Cancer, 10(5), 342-352. doi: 10.1038/nrc2842
Burtness, B. A., Manola, J., Axelrod, R., Argiris, A., & Forastiere, A. A. (2008). A
randomized phase II study of ixabepilone (BMS-247550) given daily x 5 days
every 3 weeks or weekly in patients with metastatic or recurrent squamous cell
cancer of the head and neck: an Eastern Cooperative Oncology Group study.
Annals of Oncology, 19(5), 977-983. doi: DOI 10.1093/annonc/mdm591
Cassell, A., & Grandis, J. R. (2010). Investigational EGFR-targeted therapy in head and
neck squamous cell carcinoma. Expert Opin InvestigDrugs, 19(6), 709-722. doi:
10.1517/13543781003769844
Chaturvedi, A. K., Engels, E. A., Pfeiffer, R. M., Hernandez, B. Y., Xiao, W., Kim, E., .
. Gillison, M. L. (2011). Human papillomavirus and rising oropharyngeal cancer
incidence in the United States. J Clin Oncol, 29(32), 4294-4301. doi:
10.1200/JC0.2011.36.4596
Datta, S. R., Brunet, A., & Greenberg, M. E. (1999). Cellular survival: a play in three
Akts. Genes Dev, 13(22), 2905-2927.
Degenhardt, Y., & Lampkin, T. (2010). Targeting Polo-like kinase in cancer therapy.
Clin Cancer Res, 16(2), 384-389. doi: 10.1158/1078-0432.CCR-09-1380
DeGregori, J., & Johnson, D. G. (2006). Distinct and Overlapping Roles for E2F Family
Members in Transcription, Proliferation and Apoptosis. Curr Mol Med, 6(7), 739-
748.
Duensing, S., & Munger, K. (2004). Mechanisms of genomic instability in human cancer:
insights from studies with human papillomavirus oncoproteins. Int J Cancer,
109(2), 157-162. doi: 10.1002/ijc. 11691
44


Dyson, N. (1998). The regulation of E2F by pRB-family proteins. Genes Dev, 72(15),
2245-2262.
Eder, J. P., Vande Woude, G. F., Boerner, S. A., & LoRusso, P. M. (2009). Novel
therapeutic inhibitors of the c-Met signaling pathway in cancer. Clin Cancer Res,
75(7), 2207-2214. doi: 10.1158/1078-0432.CCR-08-1306
Estilo, C. L., P, O. Charoenrat, Ngai, I., Patel, S. G., Reddy, P. G., Dao, S., . Singh, B.
(2003). The role of novel oncogenes squamous cell carcinoma-related oncogene
and phosphatidylinositol 3-kinase pi lOalpha in squamous cell carcinoma of the
oral tongue. Clin Cancer Res, 9(6), 2300-2306.
Gewinner, C., Wang, Z. G. C., Richardson, A., Teruya-Feldstein, J., Etemadmoghadam,
D., Bowtell, D., . Cantley, L. C. (2009). Evidence that Inositol Polyphosphate
4-Phosphatase Type II Is a Tumor Suppressor that Inhibits PI3K Signaling.
Cancer Cell, 16(2), 115-125. doi: DOI 10.1016/j.ccr.2009.06.006
Goon, P. K., Stanley, M. A., Ebmeyer, J., Steinstrasser, L., Upile, T., Jerjes, W., . .
Sudhoff, H. H. (2009). HPV & head and neck cancer: a descriptive update. Head
Neck Oncol, 1, 36. doi: 10.1186/1758-3284-1-36
Haddad, R. I., & Shin, D. M. (2008). Recent advances in head and neck cancer. New
England Journal of Medicine, 359(11), 1143-1154. doi: Doi
10.1056/Nejmra0707975
Hardisson, D. (2003). Molecular pathogenesis of head and neck squamous cell
carcinoma. European Archives of Oto-Rhino-Laryngology, 260(9), 502-508. doi:
DOI 10.1007/s00405-003-0581-3
Howard, J. D., Lu, B., & Chung, C. H. (2012). Therapeutic targets in head and neck
squamous cell carcinoma: identification, evaluation, and clinical translation. Oral
Oncol, 48( 1), 10-17. doi: 10.1016/j. oral oncology.2011.09.013
Katoh, M., & Katoh, M. (2007). Notch signaling in gastrointestinal tract (review). Ini .1
Oncol, 30(1), 247-251.
Kreimer, A. R., Clifford, G. M., Boyle, P., & Franceschi, S. (2005). Human
papillomavirus types in head and neck squamous cell carcinomas worldwide: a
systematic review. Cancer Epidemiol Biomarkers Prev, 14(2), 467-475. doi:
10.1158/1055-9965.EP1-04-0551
Keysar, S. B., Astling, D. P., Anderson, R. T., Vogler, B. W., Bowles, D. W., Morton, J.
J., . Jimeno, A. (2012) A patient tumor transplant model of squamous cell
cancer identifies PI3K inhibitors as candidate therapeutics in defined molecular
bins. Manuscript submitted for publication.
Lace, M. J., Anson, J. R., Klussmann, J. P., Wang, D. H., Smith, E. M., Haugen, T. H., &
Turek, L. P. (2011). Human papillomavirus type 16 (HPV-16) genomes integrated
in head and neck cancers and in HPV-16-immortalized human keratinocyte clones
express chimeric virus-cell mRNAs similar to those found in cervical cancers. J
Virol, 55(4), 1645-1654. doi: 10.1128/JVI.02093-10
Lechner, M. S., & Laimins, L. A. (1994). Inhibition of p53 DNA binding by human
papillomavirus E6 proteins. J Virol, 68(1), 4262-4273.
Leemans, C. R., Braakhuis, B. J. M., & Brakenhoff, R. H. (2011a). The molecular
biology of head and neck cancer. Nature Reviews Cancer, 77(1), 9-22. doi: Doi
10.1038/Nrc2982
45


Leemans, C. R., Braakhuis, B. J. M., & Brakenhoff, R. H. (2011b). Response to
correspondence on the molecular biology of head and neck cancer. Nature
Reviews Cancer, 77(5), 382-382. doi: Doi 10.1038/Nrc2982-C2
Menges, C. W., Baglia, L. A., Lapoint, R., & McCance, D. J. (2006). Human
papillomavirus type 16 E7 up-regulates ART activity through the retinoblastoma
protein. Cancer Res, 66(11), 5555-5559. doi: 10.1158/0008-5472.CAN-06-0499
Moody, C. A., & Laimins, L. A. (2010). Human papillomavirus oncoproteins: pathways
to transformation. Nat Rev Cancer, 70(8), 550-560. doi: 10.1038/nrc2886
Myers, E. N. (2010). Head and neck oncology2010, Part I. Otolaryngol Pol, 64(3), 136-
146. doi: 10.1016/S0030-6657(10)70049-4
Nicholson, K. M., & Anderson, N. G. (2002). The protein kinase B/Akt signalling
pathway in human malignancy. Cell Signal, 14(5), 381-395.
Or, Y. Y., Hui, A. B., Tam, K. Y., Huang, D. P., & Lo, K. W. (2005). Characterization of
chromosome 3q and 12q amplicons in nasopharyngeal carcinoma cell lines. IntJ
Oncol, 26(1), 49-56.
Penton, A. L., Leonard, L. D., & Spinner, N. B. (2012). Notch signaling in human
development and disease. Semin Cell Dev Biol, 23(4), 450-457. doi:
10.1016/j.semcdb.2012.01.010
Pirn, D., Massimi, P., Dilworth, S. M., & Banks, L. (2005). Activation of the protein
kinase B pathway by the HPV-16 E7 oncoprotein occurs through a mechanism
involving interaction with PP2A. Oncogene, 24(53), 7830-7838. doi: DOI
10.1038/sj.one. 1208935
Scheffner, M., Huibregtse, J. M., Vierstra, R. D., & Howley, P. M. (1993). The HPV-16
E6 and E6-AP complex functions as a ubiquitin-protein ligase in the
ubiquitination of p53. Cell, 75(3), 495-505.
Schreck, K. C., Taylor, P., Marchionni, L., Gopalakrishnan, V., Bar, E. E., Gaiano, N., &
Eberhart, C. G. (2010). The Notch Target Hesl Directly Modulates Glil
Expression and Hedgehog Signaling: A Potential Mechanism of Therapeutic
Resistance. Clinical Cancer Research, 76(24), 6060-6070. doi: Doi
10.1158/1078-0432.Ccr-10-1624
Sjoblom, T., Jones, S., Wood, L. D., Parsons, D. W., Lin, J., Barber, T. D., . .
Velculescu, V. E. (2006). The consensus coding sequences of human breast and
colorectal cancers. Science, 314(5191), 268-274. doi: 10.1126/science. 1133427
Snow, A. N., & Laudadio, J. (2010). Human Papillomavirus Detection in Head and Neck
Squamous Cell Carcinomas. Advances in Anatomic Pathology, 77(6), 394-403.
doi: Doi 10.1097/Pap.0b013e3181f895cl
Stransky, N., Egloff, A. M., Tward, A. D., Kostic, A. D., Cibulskis, K., Sivachenko, A., .
. Grandis, J. R. (2011). The mutational landscape of head and neck squamous
cell carcinoma. Science, 333(6046), 1157-1160. doi: 10.1126/science. 1208130
Termine, N., Panzarella, V., Falaschini, S., Russo, A., Matranga, D., Lo Muzio, L., &
Campisi, G. (2008). HPV in oral squamous cell carcinoma vs head and neck
squamous cell carcinoma biopsies: a meta-analysis (1988-2007). Annals of
Oncology, 79(10), 1681-1690. doi: DOI 10.1093/annonc/mdn372
Vermorken, J. B., Mesia, R., Rivera, F., Remenar, E., Kawecki, A., Rottey, S., . Hitt,
R. (2008). Platinum-based chemotherapy plus cetuximab in head and neck cancer.
N Engl J Med, 359(11), 1116-1127. doi: 10.1056/NEJMoa0802656
46


Wilken, R., Veena, M. S., Wang, M. B., & Srivatsan, E. S. (2011). Curcumin: A review
of anti-cancer properties and therapeutic activity in head and neck squamous cell
carcinoma. Mol Cancer, 10, 12. doi: 10.1186/1476-4598-10-12
Woenckhaus, J., Steger, K., Werner, E., Fenic, I., Gamerdinger, U., Dreyer, T., & Stahl,
U. (2002). Genomic gain of PIK3CA and increased expression of pi lOalpha are
associated with progression of dysplasia into invasive squamous cell carcinoma. J
Pathol, 198(3), 335-342. doi: 10.1002/path.l207
Yeager, T. R., & Reddel, R. R. (1999). Constructing immortalized human cell lines.
Current Opinion in Biotechnology, 10(5), 465-469. doi: Doi 10.1016/S0958-
1669(99)00011-7
Zerfass, K., Schulze, A., Spitkovsky, D., Friedman, V., Henglein, B., & Jansen-Durr, P.
(1995). Sequential activation of cyclin E and cyclin A gene expression by human
papillomavirus type 16 E7 through sequences necessary for transformation. J
Virol, 69(10), 6389-6399.
47


Full Text

PAGE 1

IN VITRO AND IN VIVO DRUG EFFICACY OF THE MULTI KINASE INHIBITOR ON 01910.NA IN HIGH RISK HUMAN PAPILLOMAVIRUS POSITIVE HEAD AND NECK SQUAMOUS CELL CARCINOMA by Ryan Taylor Anderson B.A., University of Colorado, 2006 A thesis submitted to the Faculty of the Graduate School of the University of Colorado in partial fulfillment of the requirements for the degree of Master of Biology 2012

PAGE 2

2012 RYAN TAYLOR ANDERSON ALL RIGHTS RESERVED

PAGE 3

ii This thesis for the Master of Biology degree by Ryan Taylor Anderson has been approved for the Department of Integrative Biology by Dr. Bradley J. Stith Chair Dr. Antonio Jimeno Dr. Amanda Charlesworth November 28 2012

PAGE 4

iii Ryan Taylor Anderson (M.S., Biology) I n vitro and in vivo dr ug efficacy of the multi kinase inhibitor ON 01910.Na in high risk human papilloma virus positive head and neck squamous cell carcinomas Thesis directed by Professor Bradley J. Stith ABSTRACT Head and neck squamous cell carc inoma (HNSCC) is a common malignancy with a ~50% mortality rate. Genetic predisposition, tobacco exposure, alcohol co nsumption and high risk HPV infection are the major risk factors. G enetic analysis and DNA profiling studies suggest HPV negative and HPV positive tumors fall into two different molecular subclasses of HNSCC ( Leemans, Braakhuis, & Brakenhoff, 2011a ) F urthermore, whole exome sequencing of HNSCC tumor tissue obtained from large patient cohorts in two independent studies revealed a diverse mutational etiology regardless of the site of primary growth A high frequency of a ctivating mutations of TP53 and PI K3CA as well as loss of function mutations of NOTCH1 were common to both investigations ( Agrawal et al., 2011b ; Stransky et al., 2011 ) R elevant mod els are needed to investigate the differential treatment responses associated with the full s pectrum of HNSCC subtypes In this study we evaluated the efficacy of the phosphoinositide 3 kinase (PI3K) inhibitor ON 01910.Na against HNSCCs with differential HPV status both in vitro and in vivo. ON 01910.Na had potent antiproliferative effects on 11 o f a panel of 18 HPV negative HNSCC cell lines. Inhibition of S6 ribosomal protein phosphorylation and differential expression of PI3K, Myc, Fos, INPP4B, Hes1 and Hey1 were associated with a treatment sensitive phenotype We employed the transformed squamous epithelial cell line HaCaT expressing the HPV16 oncoproteins E6 and E7 as an in vitro surrogate to an HPV positive HNSCC cell line. Initial characterization of these cells indicated that E6 and E7 expression increased proliferation,

PAGE 5

iv i nvasion, and PI3K/Akt pathway activation. Treatment of the transformed HaCaTs with ON 01910.Na did not inhibit activation of the PI3K/Akt pathway. We have developed a direct patient tumor xenograft mouse model as a pre clinical platform to better mimic tum or environment. Primary tumors from 8 HNSCC patients, 4 positive for HPV16 infection were implanted in to mouse recipients to investigate the genetic and molecular basis as well as epidemiologic trends of treatment response in vivo D rug efficacy was mod est and there was no observed correlation between HPV status S6 phosphorylation, or differential gene expression and treatment outcome. However, a direct association between ON 01910.Na treatment sensitivity and NOTCH1 expression was identified. The form and content of this abstract are approved. I recommend its publication. Approved: Bradley J. Stith

PAGE 6

v DEDICATION I dedicate this work to my loving parents whose support has been instrumental in my success th roughout this experience. I would also like to dedicate this to Karla, for her support, patience and understanding while completing this thesis.

PAGE 7

vi ACKNOWLEDGMENTS I would like to thank my research advisor, Dr. Antonio Jimeno, for his gracious mentorship. I also wish to thank my committee chair, Dr. Bradley J. Stith, and committee member, Dr. Amanda Charlesworth, for their guidance throughout this program. In addition, a special thanks to Dr. Steven Keysar, Dr. John Jason Morton, Dr. Phuong Le, Todd Pitts, Dr. Lisa Johansen, Brian Vogler, Justin Eagles Soukup, and all other members of the Jimeno Lab past and present.

PAGE 8

vii TABLE OF CONTENTS CHAPTER I. INTRODUCTION ................................ ................................ ................................ ....... 1 HNSCC ................................ ................................ ................................ ................... 1 Risk Factors ................................ ................................ ................................ ............ 1 HPV in SCCs ................................ ................................ ................................ .......... 2 Treatment Modalities ................................ ................................ .............................. 3 PI3K ................................ ................................ ................................ ........................ 5 NOTCH1 Interplay with PI3K Signaling ................................ ............................... 6 Effect of ON 01910.Na Treatment in HNSCC ................................ ....................... 7 II. MATERIALS AND METHODS ................................ ................................ ................ 9 Cell Culture ................................ ................................ ................................ ............. 9 Clonogenic Assay ................................ ................................ ................................ ... 9 SRB Proliferation Assay ................................ ................................ ......................... 9 Generation of HPV16 E6 and E7 expressing HaCaT cells ................................ 10 Confirmation of viral DNA integration into host genome by PCR ...................... 11 Cellular proliferation and invasion assays ................................ ............................ 11 Tumor Xenograft Experiments ................................ ................................ ............. 12 Western Blotting ................................ ................................ ................................ ... 13 qRT PCR gene expression analysis ................................ ................................ ...... 14 Human papillomavirus detection ................................ ................................ .......... 14 FISH analysis ................................ ................................ ................................ ........ 15 DNA Isolation ................................ ................................ ................................ ....... 16 DNA Sequencing ................................ ................................ ................................ .. 16

PAGE 9

viii III. RESULTS ................................ ................................ ................................ .................. 20 In vitro evaluation of ON 01910.Na activity in HNSCC immortalized cell lines 20 ON 01910.Na induced growth inhibition in HNSCC cell lines ..................... 20 Gene expression profiling in HNSCC cell lines based on ON 01910.Na treatment sensitivity ................................ ................................ ........................ 22 Evaluati ng the human keratinocyte cell line HaCaT stably transfected with genes encoding for the HPV16 oncoproteins E6 and E7 as an HPV+ model ................. 25 Confirmation of HPV16 viral DNA integration ................................ ............. 26 Characterizing the transformed HaCaT phenotype ................................ ......... 28 Assessing outcome specific biomarkers of ON 01910.Na treatment using a direct patient tumor xenograft platform ................................ ................................ .......... 31 Anti cancer effects of ON 01910.Na in xenografted tumor lines ................... 31 PIK3CA gene amplification ................................ ................................ ............ 33 Mutation profiling ................................ ................................ ........................... 34 NOTCH1 expression in ON 01910.Na treated tissue correlates with drug response ................................ ................................ ................................ ........... 36 IV. DISCUSSION ................................ ................................ ................................ ............ 39 ON 01910.Na outcome specific biomarkers and treatment efficacy in HNSCC cell l ines ................................ ................................ ................................ .......... 39 ON 01910.Na efficacy was not a result of PI3K pathway inhibition in the dual transfected HaCaT cell line ................................ ................................ ............. 40 Identification of biomarkers in ON 01910.Na sensitive HNSCC xenografts 41 Proposed mechanism of action by ON 01910.Na in HNSCC ........................ 42 REFERENCES ................................ ................................ ................................ ................. 44

PAGE 10

ix LIST OF TABLES T able II.1 Primers for cloning E6 and E7 into the retroviral vectors pLXSN and pLHCX. ..... 11 II.2 PCR amplification and sequencing primers. ................................ ............................. 17 III.1 Exome sequencing of PI3Kca NOTCH1 and PI3K. ................................ .............. 35

PAGE 11

x LIST OF FIGURES Figure I.1 PI3K/Akt Signaling Pathway ................................ ................................ ....................... 5 I.2 Interplay between PI3K/Akt, MEK/ERK, and NOTCH1 Signaling Pathways. ........... 7 III.1 In vitro ON 01910.Na efficacy. ................................ ................................ ............... 21 III.2 ON 01910.Na (1.0uM) treatment induced changes in cell line gene expression. ... 24 III.3 Confirmation of viral gene integration in the host cell genome. ............................. 26 III.4 Phenotypic classification of the HAE6/MycE7 dual transfect. ............................... 28 III.3 ON 01910.Na (1.0uM) treatment of HaCaT transfects. ................................ .......... 30 III.6 Patient xenograft ON 01910.Na treatment efficacy. ................................ ............... 32 III.7 PI3Kca amplification detected by FISH. ................................ ................................ 34 III.8 Summary of genetic profiles and molecular markers of ON 01910.Na treated tumor lines. ................................ ................................ ................................ ................................ .. 37 IV.1 Proposed mechanism of action by ON 01910.Na in HNSCC xenografts. .............. 43

PAGE 12

xi LIST OF ABBREVIATIONS CUHN U niversity of Colorado head and neck EGFR epidermal growth factor receptor FISH fluorescence in situ hybridization HPV human papilloma virus HNSCC head and neck squamous cell carcinoma PI3K phosphoinositide 3 kinase PIK3CA phosp hatidylinositol 4,5 bisphosphate 3 kinase, catalytic subunit alpha PLK1 polo like kinase 1 qRTPCR quantitative reverse transcriptase polymerase chain reaction SRB sulfor hodamine B

PAGE 13

1 CHAPTER I INTRODUCTION HNSCC Collectively, squamous cell carcinomas (SCC) are the most abundant ectodermal cancers worldwide. SCCs arise in the squamous epithelia located in the cervix, skin, lung, esophagus and oral cavity ( Goon et al., 2009 ) HNSCC is the sixth most prevalent cancer worldwide by incidence These cancers present in the oral cavity, oropharynx, larynx, or hypopharynx. Patient prognosis is determined largely by the tumor stage at presentation. Stage is determined by tumor progression and the presence of metastasis after clinical examination, imaging, lymph node cytology and post surger y histopathology. One third of patients present with early stage disease at diagnosis while a majority of new cases present with advanced cancer and lymph node metastasis ( Haddad & Shin, 2008 ) Current estimates suggest that more than 600,000 cases will arise globally in 2012 with a 5 year patient survival r ate of 40 50% ( Wilken, Veena, Wang, & Srivatsan, 2011 ) Despite the recent advancements in cancer treatment, little progress has been made in overall survival of HNSCC patients. Risk Factors Tobacco use and alcohol consumption have historically been the most important risk factors. Current epidemiologic understanding is that these factors are synergi stic in effect. Incidence of HNSCC in the western world has been on a slow decline over the past decade which can be attributed to a decrease in the prevalence of tobacco use.

PAGE 14

2 However, a subgroup associated with infection of high risk HPV infection, notabl y in the oropharynx, is becoming more prevalent ( Leemans, Braakhuis, & Brakenhoff, 2011b ) HPV in SCCs Extensive studies have shown that certain high risk subtypes of HPV cause malignancies of the cervix Two high risk subtypes, HPV 16 and 18 are responsible for about 70% of all cer vical cancers ( Moody & Laimins, 2010 ; Snow & Laudadio, 2010 ) More recently, a strong association has emerged between high risk HPV infection and the development of HNSCC, especially in younger male patients. Meta analysis data suggests that HPV is detectable in 2 6 35% of HNSCC patients ( Kreimer, Clifford, Boyle, & Fr anceschi, 2005 ; Termine et al., 2008 ) Registry data collected by the Surveillance, Epidemiology, and End Results (SEER) Program for HPV positive oropharyngeal squamous cell carcinomas documented an increase from 16% in 1984 to 72% in 2004 ( Chaturvedi et al., 2011 ) HPV viral oncoproteins E6 and E7 are the p rimary transforming factors following infection. E6 and E7 work in concert to overcome cell cycle checkpoints and progress cells through S phase The E6 oncoprotein has evolved to prevent growth inhibition and ap optosis by interfering with p53 function through two identified mechanisms. E6 recruits cellular E3 ubi quitin ligase E6 associated protein leading to ubiquitination and degradation of p53 ( Scheffner, Huibregtse Vierstra, & Howley, 1993 ) E6 can also bind p53 directly, preventing p53 DNA binding activity ( Lechner & Laimins, 1994 ) The E7 onco protein promotes cellular proliferation by binding to the retinoblastoma (RB) family of proteins. RB proteins inte ract with E2F, repressing transcription at E2F dependent promoters ( Dyson, 1998 ) The E2F family of transcription factors regulate genes

PAGE 15

3 involved in cell cycle progression, differentiation, mitosis and apoptosis ( DeGregori & Johnson, 2006 ) Thus, E7 promotes premature entry into S phase by disrupting RB E2F complexes and targeting RB for ubiquitin dependent degradation, leading to constitutive E2F dependent gene expression ( Zerfass et al., 1995 ) Interestingly, E7 expression has been shown to upregulate Akt activity promoting PI3K pathway activation in human keratinocytes which is likely a contributing factor in the progression to cancer ( Menges, Baglia, Lapoint, & McCance, 20 06 ; Pim, Massimi, Dilworth, & Banks, 2005 ) High risk HPV infection is necessary, but not sufficient for the progression to malignancy. The habitual insult in differentiating cells by HPV infection leads to genetic instability over time, promoting malignant transformation ( Duensing & Munger, 2004 ) Observatio ns from genetic analysis and DNA profiling studies suggest that HPV negative and HPV positive tumors fall into two distinct molecular subclasses of HNSCCs suggesting that each may require a different approach to treatment ( Leemans et al., 2011a ) Treatment Modalities Patie nts with early stage tumors and a more favorable prognosis are treated with either surgery or radiotherapy. Surgery combined with p ost operative radiotherapy has become the bastion of treatment for patients with advanced disease. A large proportion of pati ent deaths are due to locoregional recurrences, second primary tumors and distant metastasis ( Myers, 2010 ) The complexity of the molecular carcinogenesis and biological heterogeneity present in HNSCC emphasize the need for novel therapeutic strategies. E xtensive investigation is currently devoted to targeted molecular therapies either alone

PAGE 16

4 or in combination with cytotoxic treatments such as traditional chemotherapeutic agents and radiotherapy ( B ernier, Bentzen, & Vermorken, 2009 ) Targeted molecular therapeutics are a promising and relevant approac h to cancer therapy. An ideal a molecular target should be required by proliferating cells, overexpressed in the tumor tissue with minimal expression in normal tissue to limit drug toxicity, have a proven role in onco genesis, have robust pharmacodynamic biomarkers to monitor target inhibition, and be associated with biomarkers predictive of therapeutic outcome ( Degenhardt & Lampkin, 2010 ) E pidermal growth factor receptor (EGFR) over expression is a characteristic in the majority of HNSCCs. The EGFR specific antibody Cetuximab is a potent inducer of cell mediated antibody dependent cytotoxicity in HNSCC. Several clinical studies evaluating Ce tuximab/platinum based chemotherapy have observed significantly improved overall survival in patients with recurrent or metastatic HNSCC compared to either therapy alone ( Bourhis, Lefebvre, & Vermorken, 2010 ; Burtness, Manola, Axelrod, Argiris, & Forastiere, 2008 ; Vermorken et al ., 2008 ) A plethora of targeted agents have followed suit, and are currently being tested as augmentation therapy to mainstay therapeutic strategies. As knowledge of the molecular pathways involved in pathogenesis, t umorigenesis and acquired resistance to therapy of HNSCC continues to progress, new treatment protocols including relevant targeted therapies will no doubt gain a stronghold. There are currently a variety of targeted therapies which inhibit pathways critic al to HNSCC maintenance and development undergoing active clinical trial. The PI3K/Akt signaling pathway is currently a focus of intense research as a targetable pathway ( Howard, Lu, & Chung, 2012 )

PAGE 17

5 Figure I .1 PI3K/Akt Signaling Pathway PI3K Alterations to the PI3 K/Akt signaling pathway are common across a broad spectrum of cancer types. A simplified version of the PI3K/Akt signaling cascade is detailed in FigureI.1. PI3K transduces stimuli received from receptor tyrosine kinases (RTKs) into s ignaling cascades involved in the regulation of several normal cellular processes including neovascularization, proliferation, cell motility, adhesion, survival and apoptosis ( Datta, Brunet, & Greenberg, 1999 ; Nicholson & Anderson, 2002 ) Several studies have shown this pathway to be constitutively active in malignant cells, and a direct associat ion between enhanced PI3K/Akt pathway activation and tumor formation within HNSCC has been identified ( Estilo et al., 2003 ; Or, Hui, Tam, Huang, & Lo, 2005 ; Woenckhaus et al., 2002 ) Multiple components within the PI3K signaling cascade

PAGE 18

6 have been well characterized as oncogenic. Dysregulation and/or genetic aberrations of the phosphoinositide 3 kinas e catalytic gene ( PI3Kca ), Akt PDK1, mTOR and PTEN have been associated with HNSCC development ( Bunney & Katan, 2010 ) Targeted agents to members within this pathway are currently being evaluated in several cancer types. NOTCH1 Interplay with PI3K Signaling Notch signaling during development regulates cell fate determination, growth and survival in a context dependent ma nner ( Penton, Leonard, & Spinner, 2012 ) In two studies published last year, loss of function mutations in NOTCH1 were identified in 10 15% of HNSCC patients, second only to TP53 ( Agrawal et al., 2011b ; Stransky et al., 2011 ) The high inactivating mutation rate suggests that NOTCH1 functions as a tumor suppressor in normal squamous epithelia. Recently, we identified a c orrelation between altered PI3K/Akt pathway activation and inactivating NOTCH1 mutations ( Keysar et al., 2012 ). Cross talk within intracellular signaling networks has become a focus in characterizing the pharmacological response by to treatment in cancer c ells ( Eder, Vande Woude, Boerner, & LoRusso, 2009 ) Interplay between the signaling cascades addressed in this study is shown in Figure I.2. The genes written in red are biomarkers used to identify pathway activation.

PAGE 19

7 Figure I.2 Interplay between PI3K/Akt, MEK/ERK, and NOTCH1 Signaling Pathways. Effect of ON 01910.Na Treatment in HNSCC Our lab is currently involved in the preclinical evaluation of ON 01910.Na as a potential therapeutic treatment of HNSCC. ON 01910.Na is a mul tikinase non ATP binding small molecule targeted agent that exhibits inhibitory activity of the PI3K pathway, and disrupts PLK1 mediated G 2 M phase transition. The mechanism of PI3K/Akt pathway inhibition has not yet been elucidated. ON 01910.Na prevent s P LK1 phosphorylation through R af during the G 2 M phase transition thus promoting mitotic catastrophe. ON 01910.Na is the only dual inhibitor of the PI3K and PL K1 pathways currently being investigated as a cancer therapeutic ( Chapman et al., 2012 ) The biological behavior of HPV+ HNSCCs is distinct from cancers associated with alcohol and tobacco use ( Myers, 2010 ) HPV status is an important prognostic consideration in directing treatment strategies. The link between Akt activation and HPV infection suggest s that PI3K inhibition may be an appropriate therapeutic approach to treating HPV positive HNSCC. In this study our aim is to evaluate the efficacy of PI3K

PAGE 20

8 inhibition by ON 01910.Na in HNSCC both in vitro and in vivo. Furthermore, we will investigate the differential response to treatment in correlation to HPV status, genetic aberrations, and molecular trends in an effort to identify biological markers of an ON 01910.Na sensitive phenotype.

PAGE 21

9 CHAPTER II MATERIALS AND METHODS Cell Culture Cells were cultured in DMEM (Invitrogen) supplemented with 10% fetal bovine serum (Atlanta Biologicals) and 1% penicillin streptomycin (Cellgro) at 37 C in a humidified incubator with a 5% CO2 atmosphere. Clonogenic Assay Cells were seeded into 6 well plates (Greiner) at 500 cells/well in triplicate. 24 hours after the plates were seeded the media was removed and replaced with fresh media or DMEM in the presence of On 01910.Na in 0.01, 0.1 and 1.0 uM conce ntrations for an additional 96 hours. After 96 hours, cells were fixed with 1% formalin and stained using 0.5% Cresyl Violet (Invitrogen). Colonies were counted then normalized to the untreated control which was considered to be 100%. SRB Proliferation Assay Cells were seeded into 96 well plates (Greiner) at 3000 cells/well in sextuplicate. 24 hours after the plates were seeded the media was removed and replaced with fresh media or DMEM in the presence of On 01910.Na in 0.01, 0.1 and 1.0 uM concentrati ons for an additional 96 hours. After 96 hours, cells were fixed in 10% trichloroacetic acid, washed with DI water, stained with sulforhodamine B (Gbiosciences), washed with 1% acetic acid, then dissolved in 10mM unbuffered Tris Base. Plates were put on a plate shaker for 12 minutes at 400 rpm. Measurements at 750nm were taken using the Synergy

PAGE 22

10 2 (Biotek) plate reader and samples were analyzed using Gen5 software (Biotek). Data was normalized to the untreated control which was considered to be 100%. Generat ion of HPV16 E6 and E7 expressing HaCaT cells The immortalized keratinocytic cell line HaCaT and its transfected derivatives were given to our lab by Barb Frederick (University of Colorado School of Medicine, Division of Radiation Oncology). The parental line and transfects were maintained in DMEM/F12 supplemented with 10% FBS. The viral oncogenes E6 and E7 were PCR amplified from the HPV16 positive cervical cell line CaSki using primers listed in Table end of the E6 primer included a n HA tag, a nd a myc epitope tag was added to the E7 primer. PCR products were gel purified and cut with Eco RI/ Bam HI (E6) or Hin dIII/ Cla I (E7). E6 was cloned into pLXSN (cut with Eco RI/ Bam HI) and E7 was cloned into pLHCX (cut with Hin dIII/ Cla I). Correct insertion was confirmed by sequencing. Plasmids were transfected into the retroviral packaging cell line instructions. Stable pLXSN and pLHCX Transfected AmphoPak293 supernates were used to transduce HaCaT cells according to was performed as described in Barb Fre

PAGE 23

11 Table II.1 Primers for cloning E6 and E7 into the retroviral vectors pLXSN and pLHCX Primer Gg gaattc atgtacccatacgacgtgccagactacgct atgcaccaaaagagaact 1 gg ggatcc ttacagctgggtttctct gg aagctt atggaacaaaaacttatttctgaagaagatctg atgcatggagatacacct gg atcgat ttatggtttctgagaaca cccttgaacctcctcgttcgacc gagcctggggactttccacaccc agctctgtttagtgaaccgtcagatc acctacaggtggggtctttcattccc 1 Single underline= restriction site; double underline = epitope tag Confirmation of viral DNA integration into host genome by PCR DNA was extracted from 1x10 6 cells using the Quick gDNA MiniPrep (Zymo control. The E6 and E7 products were amplified from 0.7ug of DNA using the GeneAmp protocol with an annealing temperature of 55 C for 30 cycles. The primers used are described in Table 1. PCR product was electrophoretically resolved on a 1% agarose gel containing 0.005% ethidium bromide. Bands were observed using the ChemiDoc XRS Imaging System and Quantity One software (BioRad). Cellu lar proliferation and invasion as says To examine proliferation 4x10 5 cells were plated in T75 flasks and allowed to grow for 96 hours. Confluency of the lines ranged from 70 80% at the time which the photographs were taken. All pictures were taken at a magnification of 40X. At this time

PAGE 24

12 cell counts were made using the Coun tess Cell Counter (Invitrogen). All counts were normalized to the parental line, and the data points were taken from triplicate samples. For the invasion assay, 5x10 4 cells were spun down and washed with PBS. This was repeated three times. Each aliquot o f cells was then resuspended in serum free media and seeded in BioCoat Matrigel Invasion Chamber (BD Biosciences) according to the companion plate using sterile forceps. The wel ls of the companion plate contained DMEM with 10% FBS to be used as the chemoattractant. After 24 hours of incubation at 37 C and 5% CO 2 the PET membrane was fixed in 1% formalin, washed three times with PBS, and stained by 0.1% crystal violet. The PET mem branes were excised using a scalpel, and fixed to a slide. All cells within frame were counted at 20X magnification. The assay was run in triplicate, and each transfect was normalized to the parental cell count. Tumor Xenograft Experiments Experiments inv olving athymic nude mice (Harlan Spraque Dawley) were approved by the Office of Laboratory Animal Resources at the University of Colorado Denver Anschutz Medical Campus. Athymic nude mice were used between the ages of 6 and 12 weeks. All mice were housed i n the same environmental conditions where the temperature, humidity, and light/dark cycles were controlled. Ideally, 20 tumors are used for each treatment study; 10 per treatment group. A minimum of 7 tumors are needed per treatment group for the data to be statistically relevant. Tumor growth is then followed in 10 tumors throughout the 28 day treatment study.

PAGE 25

13 All patient tumor lines were taken from the head and neck tumor tissue bank kept by our laboratory. These are direct patient xenografts taken from patients consented prior to their surgery. Patient tumor lines were expanded once one tumor reached a volume of 1500 mm 3 Tumor volume was approximated by digital caliper measurements using the formula 0.5236 (length*width*width). Tumor tissue was sectione d into 3 mm 3 subsections in a sterile petri dish. A tumor subsection was then surgically implanted subcutaneously into each hind flank after being washed in DMEM and coated with matrigel. The tumor take rate of patient tumor lines ranged from 75 95%. Once tumor volumes reached an average of 200 mm 3 mice were randomly divided into cages of 5 mice/treatment group. On 01910.Na was given via intraperitoneal injection (6mg/kg) daily for 28 days. Treated mice were monitored daily, and tumor sizes were measured twice weekly. Tumor sizes were then normalized to the first measurement, which was considered to be 1.0, and averaged for each treatment group. Standard error for each treatment group was calculated by the following equation: std dev/sqrt(# mice). All mic e were euthanized at the end of treatment Western Blotting Tumors were harvested for protein extractions and immediately frozen in liquid nitrogen on the final day of treatment 6 hours after drug administration. 50mg tissue subsections were thawed in a 4X volume of RIPA Buffer (Cell Signaling Technologies). Tissue was homogenized using individual single use plastic pestles. Samples were centrifuged at 16000rpm at 4 C. Protein concentration measurements were taken using the ELx800 Absorbance Microplate Re ader and Gen5 software (BioTek) according to the

PAGE 26

14 12% Bis Tris Midi Gel (Invitrogen), transferred using the iBlot Gel Transfer Stack System (Invitrogen) then processed acco primary antibodies were purchased from Cell Signaling Technologies ( 4060 Phospho Akt (S er473) (D9E) XP(R) Rabbit mAb 4821 Akt (pan) (40D4) Mouse mAb (Biotinylated) and 4228 Phospho PI3 Kinase p85 (Tyr458)/p55 (Tyr199) A ntibody) and used in dilutions recommended by the manufacturer. Secondary anti rabbit IgG was purchased from Immuno Research, and used in a 1:50,000 dilution. q RT PCR gene expression analysis RNA isolated from tumor tissue was reverse transcribed to cDNA in 20uL reactions using the Verso cDNA Synthesis Kit (Fisher Scientific). Reverse transcription reactions followed the protocol recommendations and were performed using the Verti 96 Well Thermal Cycler (Applied Biosystems). TaqMan primer probes (Applied Bi osystems) and reactions were set up using the recommended volumes and concentrations. PCR amplification and probe detection were accomplished utilizing the StepOnePlus Real Time PCR System (Applied Biosystems). All data are representative of experiments pe rformed at least two times in triplicate. Data are represented graphically as the mean the standard error of the mean (SEM) after normalized to the endogenous control. Human papillomavirus detection In situ hybridization of HPV low and high risk types w as conducted using the Ventana INFORM HPV II (low risk HPV types 6 and 11) and HPV III (high risk HPV types 16, 18, 31, 33, 35, 39, 45, 51, 52, 56, 58 and 66) automated assays (Ventana Medical systems, AZ) on 4 m thick paraffin embedded tissue sections. T he Benchmark

PAGE 27

15 system uses the Ventana ISH Protease 3 enzyme to remove proteins surrounding the target DNA. A biotinylated antiflourescin antibody is used to detect the hybridized probe, followed by streptaviridin to bind biotin and then a chromagen reaction with nitoblue tetrazolium and 5 Bromo 4 chloro 3 indolyl phosphate for detection. FISH analysis Each sample was incubated at 56 degrees Celsius for 4 h, soaked in CitriSolv 3 times for 5 min each, dehydrated and allowed to air dry. The tissue area to be hybridized was marked with a diamond pen. The slides were incubated in pretreatment solution at 80oC for ~12min, in protease solution IV at 37oC for ~20 min, washed in milli Q water at room temperature, dehydrated and air dried. The 3 color probe mixture w as applied to the selected hybridization areas, covered with coverslips and sealed with rubber cement. DNA codenaturation was performed at 76oC for 5 min in a thermocycler and hybridization was allowed to occur at 37oC for 40 48 hours. Post hybridization washes were performed through incubations in 2xSSC/0.3% NP 40 at 74oC for 2 min and 2xSSC for 2 min each, followed by dehydration. Finally, 14 ul of DAPI/anti fade (0.3 ug/ml in Vectashield mounting medium) was applied to the slide and the area covered wit h a 22x50 mm coverslip. Analysis was performed on epifluorescence microscopes using single interference filters sets for green (FITC), red (Texas red), blue (DAPI), gold, dual (red/green), and triple (blue, red, green) band pass filters. For each interfere nce filter, monochromatic images were acquired and merged using CytoVision (Leica Microsystems Inc).

PAGE 28

16 DNA Isolation Fresh frozen resected tumor tissue or cell s were obtained from consented patients treated for SCC at the University of Colorado Denver Ansc hutz Medical Campus, under an IACUC approved protocol. Genomic DNA was isolated using the DNeasy Blood and Tissue Kit (Qiagen, Germantown, MD). DNA Sequencing Extracted gDNA was PCR amplified using the GeneAmp High Fidelity PCR System (Applied Biosystems P/N 4328214, Carlsbad, CA) containing 6% DMSO. All primers were synthesized by Integrated DNA Technologies (Coralville, IA). Reactions were carried out in 96 well ABI Veriti thermocycler (Applied Biosystems) using a touchdown PCR protocol as described by ( Sjoblom et al., 2006 ) DNA sample quality and concentrations were assessed by gel electrophoresis. PCR amplification and Sanger sequencing were performed using primer sets referenced in ( Agrawal et al., 2011a ) Primers were renamed by the authors to better reflect the exon sequenced based on c urrent GenBank identification, and are referenced in table 1. PCR product was directly sequenced using the BigDye Terminator Cycle Sequencing Ready Reaction kit version 1.1 (Applied Biosystems P/N 4337451) by modification of the standard protocol. In the case of difficult templates, this Ready Mix it was combined with an aliqout of the dGTP BigDye Terminator Cycle Sequencing Ready Reaction kit (Applied Biosystems P/N 4307175). The standard sequencing thermo cycling parameters were as follows: denaturation for 5 min at 94C, followed by 30 cycles of denaturation at 96C for 10 sec, annealing at 50C for 5 sec, and

PAGE 29

17 extension/termination at 60C for 4 min, followed by incubation at 10C until the samples were processed. Residual dye labeled dideoxynucleotides (dye terminators) were removed from the cycle sequencing reaction products using the paramagnetic bead technology (CleanSEQ, P/N 000136) from Agencourt Bioscience Corporation (Beverly MA 01915) or (PureSeq, P/N P 3001 50) from Aline Biosciences, and a modi fication of the capillary automated sequencer an Applied Biosystems / Hitachi 3730 Genetic Analyzer with a 50 cm long, 48 capillary array containing POP7 polymer. Analyses of DNA sequences were done with Sequencing Analysis version 5.2 and Sequence Scanner version 1.0 (both from Applied Biosystems). Alignments of DNA sequences were done with Sequencher 4.8 (Gene Codes Corporation) and/or SeqScape (from Applied Biosystems). P CR product sequence comparison to GenBank reference sequence and mutation identification were accomplished using Mutation Surveyor version 4.0.4 (SoftGenetics, State College, PA). Table II.2 PCR amplification and sequencing primers. Gene Symbol Coding Exon Number Forward PCR Primer Sequence Reverse PCR Primer Sequence TP53 1 AGGGTTGGAAGTGTCTCATGC AGCCCAACCCTTGTCCTTAC TP53 2 CAGTCAGATCCTAGCGTCGAG AAATCATCCATTGCTTGGGAC TP53 3 GAGGAATCCCAAAGTTCCAAAC ACGTTCTGGTAAGGACAAGGG TP53 4 GGGCCAGACCTAAGAGCAATC AAGCTCCTGAGGTGTAGACGC TP53 5 CTGCTCAGATAGCGATGGTG AGGCCCTTAGCCTCTGTAAGC TP53 6 AGAAATCGGTAAGAGGTGGGC CATCCTGGCTAACGGTGAAAC TP53 7 TTGGGCAGTGCTAGGAAAGAG GTTGGGAGTAGATGGAGCCTG TP53 8 GGAGCACTAAGCGAGGTAAGC TTGTCTTTGAGGCATCACTGC TP53 9 AGCTGCCTTTGACCATGAAG ATTGCACCATTGCACTCCC

PAGE 30

18 TP53 10 CCATCTTGATTTGAATTCCCG ATTGCAAGCAAGGGTTCAAAG NOTCH1 1 GCCTCACTAGTGCCTCGG CAAAGTTTCCAAAGGGCG NOTCH1 2 AATGGCCTAGTGTTCTGTCCC CAGCAACCCATGATACTGAGC NOTCH1 3 AAGTACCTCAAGTTGCCTGGG CTGTGCCCATGACAGGTTC NOTCH1 4 CAGGTGGCCTGAAGGGAG ATCCCGCCTTCCCAACTC NOTCH1 5 CTTCTCGGCCAACCCTAGTC GAGGCCAGGCTCTTGTGTC NOTCH1 6 ATTGCCACCCTGCGTCTTAG TCAGGTTATCCTGGGTGCAG NOTCH1 7 ACCCAGGATAACCTGAAAGGG CCAGAATCGACTTCTCATCGG NOTCH1 8 GGTGGTGTGCAGTGAGGTG GAAGCAACCCACAGATGTTCC NOTCH1 9 GGTTCGTTTCTGTCCCAAGTC GACACAATCCACGGCCAG NOTCH1 10 CCACTGTAGCCATAGCAACCC CTTGTCAGTTTCACTGCCCTG NOTCH1 11 CAGGTCTGGTCATGGGTGTC GTTGATCTCGCAGTTGGGTC NOTCH1 12 CTGCCAGTTATAGCCCTGGTC GACAACGCCTACCTCTGCTTC NOTCH1 13 GGCTCAACAGACAGGGAAATC ATCTCAAGCTCTGTGCAGGTG NOTCH1 14 CTCTGCGAGTCTGAGTGGATG GTCCCGATCCTGTGTCTCC NOTCH1 15 ATGCATGGTGTCTCCCTCC CCACCACTTTACCCTCCAGTC NOTCH1 16 AGACTCATCTAGCCTGCCTGG ACTCTGATGGCGGAAAGACC NOTCH1 17 CCAACTCCAGTTCCTGTGACC CACACCTGACCCAACCCTC NOTCH1 18 AGACACCTTTGTCACAGGGC CAGGCTGCCAGCTACTGC NOTCH1 19 GTGACGTGGTGTGAGAGCC GTGACCGTTCCCACCTCC NOTCH1 20 CGGCAGTTTCCACTTCTGTAG GGGTGGTAGACAGGTGAGGC NOTCH1 21 AGCGACAAGGTAACCTGCTG CATGGGCCTATCAGGTTCAG NOTCH1 22 TCTCTCTCCAGGTCTGACAGG CTGGTTCCTGGATGCCTCT NOTCH1 23 GGTAAGAGCAGGGCAGTGAG CTCTCCCGAGTGTCCGTG NOTCH1 24 GTCAATGACTTCCACTGCGAG AAAGACATCAGGGTGAGGAGG NOTCH1 25 CCTTAGAACTGCATGCTGGC CATCCTGGACTACAGCTTCGG NOTCH1 25 TGTGAGAATGACGCTCGTACC TTGAGGGAGCAGTCACCG NOTCH1 25 GCTTTGTGGTTGTGGGTTTG GGATGTGGGCTCACAGGTC NOTCH1 26 AGGTCCTCTCGGAACCTCC ACGACCAGTACTGCAAGGACC NOTCH1 26 CTGAGGGAGGACCTGAACTTG GGGAAGATCATCTGCTGGC NOTCH1 27 GTAGCAACTGGCACAAACAGC CTGCTGTCAGACCTGGCTTC NOTCH1 28 GATAGAGTCGGCTGGTGCAG GCAGACTCCCGGTGAGGA NOTCH1 29 TCGAACTACATAGAGGGAGTGAGC AGGGCTTCAAAGTGTCTGAGG NOTCH1 30 AAGAAGTTCCGGGTGAGTCG CCCACGTCTACTCTGAATGGG NOTCH1 31 GTAAGCCTGGCCACTGCC ACCAAGTGCTGGGTGGTG NOTCH1 32 ATCTCAGGAGGGTCTCGTCTG GAGACCAGCTGGAGGCAAC NOTCH1 33 CCGTAGATGACCTGGGTGAG AAGGAAGGCAGGAGCACTAAC NOTCH1 34 AAGGCTCCTCTGGTCGGC CATCCTCGCTGGTCCCAC

PAGE 31

19 NOTCH1 34 CTGAGTGGAGAGCCGAGC GCGCCGTTTACTTGAAGG NOTCH1 34 AGTTTGAATGGTCAATGCGAG TGTCCACAGGCGAGGAGTAG NOTCH1 34 AAGGCACGGAGGAAGAAGTC TAGCTCATCATCTGGGACAGG NOTCH1 34 CTGCTGGACGAGTACAACCTG TCGCATTGACCATTCAAACTG NOTCH1 34 ACTTCTTCCTCCGTGCCTTG TCTCTGGGTGGGTTTCAGAAG PIK3CA 2 TTTAGGTTTCTGCTTTGGGACAAC TTTCTTCACGGTTGCCTACTGG PIK3CA 2 TGTTACTCAAGAAGCAGAAAGGGAAG AACAAATCTAAGTCATCCCACAAATG PIK3CA 3 TCCAAATCTACAGAGTTCCCTGTTTG TAAGCAGTCCCTGCCTTCAAGA PIK3CA 4 TTGTTGAAATTTCTCCCTTGAAA CAGATACTCATCCTCAATGTGATT PIK3CA 5 TTTGCCTCCAGTTAAGGGTAGAA AGCTGTGGAAATGCGTCTGG PIK3CA 5 TAATGCTTGGGAGGATGCCC CATTCGGAGATTTGGATGTTCTC PIK3CA 6 CAAAAATTCCGTGGTTTTATATTTG CCCAGGCTGGTCTAAAAAAATATAC PIK3CA 7 GTAGGAGTCATTTATATACTTTGATG CAATCAGCGGTATAATCAGGAG PIK3CA 8 GGAAAGAATGGGCTTAAACCTTGA CCACACTGCTGAACCAGTCAAA PIK3CA 9 AATCTTTGGCCAGTACCTCATGG TTGCAATATTGGTCCTAGAGTTCAT PIK3CA 10 TTTCTGTAAATCATCTGTGAATCC CATGCTGAGATCAGCCAAATTCA PIK3CA 11 TTTGAACAGCATGCAAGAAT TTTCATTTATTTATGTGGACTTTCTGA PIK3CA 12 TGGCTCATTCACAACTATCTTTCCC AAACAAATCAGGGTCAGTTTCTGC PIK3CA 13 TCTTTAGATCGGCCATGCAGAA GAACCACGGGAGTTTGACATTG PIK3CA 15 TGAGTGTTGCTGCTCTGTGTTG TTTGAGGGTAGGAGAATGAGAGAGAG PIK3CA 16 TTGAGGTGAAAGTTGTAAATCTTTG GCTAAATTCATGCATCATAAGCTC PIK3CA 17 CCAAATTTGCATCTGTGGCATT TGATAATTACTGCATACATTTCTTT PIK3CA 18 GGAAAGGCAGTAAAGGTCATGC CATCAAATATTTCAAAGGTTGAGCA PIK3CA 19 TTAAATGGAAACTTGCACCCTG AAACAAATGGCACACGTTCTCG PIK3CA 20 TCATGGTGAAAGACGATGGACA TGATTGTTTCTAATAGAGCAGCCAGA PIK3CA 21 TCATTTGCTCCAAACTGACCAA CTATGCAATCGGTCTTTGCCTG

PAGE 32

20 CHAPTER III RESULTS In vitro evaluation of ON 01910.Na activity in HNSCC immortalized cell lines Ap p lication of cultured human cancer cells in research is greatly restricted by the proliferative potential of the cells. Most human cells are limited to a finite number of division s prior to becoming senescent in culture Several techniques exist to immortalize cell lines derived from human tumors ( Yeager & Reddel, 1999 ) Immortalized human cancer cell lines are a valuable biological model to readily evaluate drug efficacy and investigate treatment response of molecular pathways. Here we investigat e ON 01910.Na activity in a panel of 18 immortalized HNSCC cell lines. The HNSCC cell lines which constitute our panel had been screened for high risk HPV infection, and all tested negative. Unfortunately we did not have an HPV positive immortalized HNSCC cell line available to us at the time of this study. ON 01910.Na induced growth inhibition in HNSCC cell lines Our panel of immortalized HNSCC cell lines was treated with ON 01910.Na in 0.1uM, 1.0uM and 10.0uM concentrations (Figure III.1A) D rug efficac y was assessed by SRB assay 96 hours after drug addition. Average viability and standard error were calculated from sextuplicate (N=6) cultures treated in parallel. Treatment data at each concentration for every cell line was then normalized to the vehicle control, and cell lines were arranged graphically based on their sensitivity profile. ON 01910.Na showed potent anti proliferative activity at concentrations equal to or greater than 1.0uM in eleven cell

PAGE 33

21 lines. M oderate growth inhibition was observed in 5 HNSCC lines. MSK921 and UMSCC19 were both resistant to treatment with ON 01910.Na at 10uM Figure III.1 In vitro ON 01910.Na efficacy Treated cultures (N=6) were normaliz ed to the untreated control data for eac h cell line which was set at 1. 0. A. Cellular viability of 18 HNSCC cell lines as measured by SRB assay at 0.1uM, 1.0uM, and 10.0uM concentration s. ON 01910.Na is a potent antiproliferative agent at 1.0uM and 10.0uM. B. Viability of 2 sensitive (58 4 and HN11) and the 2 most resistant (MSK921 and UMSCC19) cell lines verified by clonogenic assay at 0.1uM and 1.0uM. Treatment at 10.0uM prevented colon y formation in all cell lines. Two sensitive (584 and HN11) and 2 resistant (MSK921 and UMSCC19) cel l lines were chosen to investigate response specific changes in gene expression. Treatment sensitivity for these cell lines was verified by clonogenic assay (Figure III.1B). SRB and

PAGE 34

22 clonogenic assays are different approaches to measuring drug efficacy. Sul forhodamine B ( SRB ) stains for total protein and the SRB assay determines cell density based on a measurement of total protein content. SRB is a more high through put approach, and the potential for error is greater due to the several steps involving wash ing, and the rate at which the cell line grows. Clonogenic assay is a survival assay based on the ability of a single cell to form a colony of 50 cells or more. The clonogenic assay is a more direct measurement of viability, but is much more labor intensiv e. A full screen of the panel of cell lines using the clonogenic approach may be necessary to better resolve a more accurate sensitivity profile. Sensitivity to treatment at 1.0uM was comparable to the SRB assay results. However, treatment at the higher co ncentration prevented colony formation in all 4 cell lines, while no significant effect was observed at 0.1uM. Based on the preceding results, a 1.0uM concentration was used to assess changes in gene expression. Gene expression profiling in HNSCC cell line s based on ON 01910.Na treatment sensitivity We then aimed to identify dynamic biomarkers of ON 01910.Na treatment susceptibility and/or resistance. qRTPCR was performed on a panel of 15 genes selected from a critical review of literature based on the prox imity to PI3K and whether fluctuations in gene expression had bee n observed after PI3K inhibition. An ON 01910.Na treatment specific pattern in gene expression change was identified in 6 of the genes. Myc and Fos encode transcription factors upregulated in response to growth factor activation of receptor tyrosine kinase cascades, importantly EGFR activation of PI3K ( Hardisson, 2003 ) INPP4B is a phosphatas e that preferentially hydorlyzes phosphatidylinositol 3,4 bisphosphate. Evidence suggests INPP4B may be involved in

PAGE 35

23 Akt activation ( Gewinner et al., 2009 ) Expression of the transcription factors Hey1 and Hes1 are induced by the Notch signaling pathway ( Schreck et al., 2010 ) D own regulation of PI3K in treated cell lines was associated with Myc Fos INPP4B Hes1 and Hey1 induction in the treatment sensitive cell lines (Figure III.2A). Notably Fos and Hes1 mRNA levels increased by 16.1 and 19 .4 fold respectively in 584. Myc Fos INPP4B and Hey1 all had moderate increases in expression induced by ON 01910.Na treatment in HN11. Expression of PI3K Myc and Fos did not change significantly in the resistant cell lines when compared to the controls. INPP4B Hey1 and Hes1 were down regulated in re sponse to ON 01910.Na treatment in the resistant phenotype. There appears to be c ompensation through the MEK/ERK and NOTCH1 pathways in response to ON 1910.Na treatment downregulation of PI3K PI3K pathway activation in response to ON 01910.Na (O) treatment was assessed by western blotting and compared to PI3K inhibition by ZSTK474 (Z), a molecule which binds to the ATP binding site of PI3K, as a positive control (FigureIII.2B). ZSTK474 had very modest inhibition of the PI3K pathway although reduction of phosphorylation is consistent in all 4 cell lines. Reduced activity of ZSTK474 is likely due to a faulty stock. The phosphorylation of Akt at Ser473 in 584 was markedly reduced by ON 01910.Na t reatment, no decrease in phosphorylation was observed in HN11 or the resistant cell lines. However, phosphorylation of S6 was inhibited completely after ON 01910.Na treatment in the two sensitive lines, but not the two resistant lines. This data suggests O N 01910.Na may be inhibiting the PI3K pathway downstream of Akt. Drug activity of ON 01910.Na seems to working through a different mechanism than ZSTK474.

PAGE 36

24 Figure III.2 ON 01910.Na (1.0uM) treatment induc ed changes in cell line gene expression. A. Relative mRNA expression levels measured by qRTPCR for the 2 sensitive cell lines shows down regulation of PI3K is associated with compensation in Myc Fos INPP4B Hey1 and Hes1 Untreated control mRNA for each cell line was normalized to 0.0. B. Differential Akt and S6 phosphorylation patterns associated with treatment were identified by western blot analysis in untreated control (C), ON 01910.Na treated (O), and the PI3K inhibitor ZSTK474 treated (Z) cell cult ure. S6K activation is inhibit ed by ON 01910.Na treatment in the sensitive cell lines

PAGE 37

25 Evaluating the human keratinocyte cell line HaCaT stably transfected with genes encoding for the HPV 16 oncoproteins E6 and E7 as an HPV+ model The observed correlation between enhanced Akt expression and HPV infection suggests that the PI3K/Akt signaling pathway may have a facilitating role in HPV directed transformation of squamous epithelia. Dysregulation of one of the several components within the PI3K/Akt signal tran sduction pathway resulting in activation is one of the most frequently observed molecular alterations in HNSCCs (Hennessy, Smith, Ram, Lu, & Mills, 2005). Understanding the role of enhanced Akt expression during tumorigenesis in HPV positive cancers may pr ovide insight into the fundamental importance of PI3K signaling in oncogenesis. Current knowledge of the consequences of high risk HPV transformation has been primarily based on studies in established cervical cancer cell lines. Due to the emerging high ri sk HPV+ HNSCC subtype, an in vitro HPV+ model has become a desirable preclinical tool. Unfortunately, there are currently no high risk HPV+ HNSCC immortalized cell lines readily available. Dr. Barb Fredrick(University of Colorado Denver School of Medicine) kindly provided us with the transformed squamous epithelia line HaCaT stably transfected with the HPV16 viral oncogenes E6 and E7. There are few studies elucidating the HPV dependent mechanism of cancer progression in squamous epithelia, which highlights the need for a treatment model and novel therapeutic approach to addressing this emerging sub type ( Lace et al., 2011 ) Here, we ev aluate the transformed HaCaT s as an HPV16 positive surrogate platf orm for in vitro drug screening.

PAGE 38

26 Figure III.3 Confirmation of viral gene integration in the host cell genome. A and B. HaCaT cells stained with secondary anti rabbit conjugated with Alexafluor A488 (green) and anti mouse conjugated with Alex afluor A555 (orange) antibodies bound to HAE6 and MycE7 respectively. The green and orange fluorescence in III.3 B indicates successful E6 and E7 gene transfection. C. Transfection of HPV16 E6 and E7 viral DNA was confirme d using end point PCR comparing the HaCaT parental (1), pLXSN/pLHCX empty vector transfect (2) and HAE6/MycE7 dual transfect (3) to the HPV 16 positive cell line CaSki control (C) Confirmation of HPV16 viral DNA integration Stably transfected cells were selected for by the addition of G418 and hygromycin to the growth media. Integration of the HPV16 E6 and E7 viral proteins in the HaCaT genome was confirmed using immunofluorescence (Fig ure III.3 A ). Primary antibodies specific for HA and Myc were used to stain for the HAE6 and MycE7 conjugate proteins. In figure III.3A, t here is no HAE6 ( Alexaflour A488) localized within the cell, and minimal background for MycE7 (Alexafluor A555) in the dual empty vector transfect (pLXSN+pLHC X). However, an increase in staining for both HAE6 and MycE7 is

PAGE 39

27 appare nt in the dual transfect in Figure III3B Due to the high background, these data suggest that there is at least a low level of expression of both E6 and E7 within the HaCaT dual transf ects. PCR confirmation was obtained using primers specific for E6 and E7 viral DNA described in Table II 1. CaSki (C), an HPV16 positive human cervical cancer cell line, was used as a positive control (Fig ure III.3B ). No E6 or E7 amplification was observed in either the parental line (1) or the empty vector transfect (2) However, amplification for both viral sequences was apparent albeit faint, in the dual transfect line (3) This data validates that successful inte gration of both viral genes has taken place in the dual transfect.

PAGE 40

28 Figure III. 1 Phenotypic classification of the HAE6/MycE7 dual transfect. Stable E6/E7 transfection led to a significant increase in prolif eration and invasiveness compared to the parental and empty vector HaCaT lines. A Prolifera tion measured by SRB assay. Cultures were normalized to the parental HaCaT line, and run in triplicate (N=3). B. Invasive property of the HaCaT cell lines measured by counting established colonies on the invasion chamber membrane then normalizing to the parental line. Cultures were run in triplicate (N=3) C. Western blot analysis of PI3K/Akt pathway activation of the HaCaT parental (1), pLXSN/pLHCX empty vector tran sfect (2) and HAE6/MycE7 dual transfect (3) Successful E6/E7 transfection increase d Akt and S6RP phosphorylation. Characterizing the transformed HaCaT phenotype Phenotypic transformation of the E6/E7 du al transfect was then investigated Figure III.4A compares the proliferation between the three lines by assessing colony formation by clonogenic assay. Each line was seeded in triplicate then allowed to incubate 96 hours. Colonies were stained and colonies containing <40 cells were counted

PAGE 41

29 in each well. T he parallel cultures were averaged and n ormalized to the parental line. Standard error for the triplicate samples was then calculated. Colony formation of the parental (HaCaT) and empty ve ctor transfect (pLXSN/pLHCX) were not statistically different. Howev er, the growth rate of th e dual transfect (HAE6/MycE7) was double that of the parental line. The i nvasion potential of each line is characterized in Figure III.4B. Wells of 6 well plates were filled with 3mL DMEM containing 10% FBS. PET membrane inserts wi th 8 micron pores and a thin layer of Matrigel basement membrane matrix were placed in the wells. The Matrigel surface opposite the PET membrane was then seeded with cells in serum free media. The invasion cultures were run in triplicate. Invasive cells de tach from the surface invading through the thin Matrigel layer and the PET membrane pores. After a 22 hour incubation cells on the membrane surface and seeding the six well plate were fixed then stained, and the colonies were counted using the same protoc ol as the clonogenic assay. Invasion counts were normalized to the parental line and the standard error was calculated for the triplicate samples. The parental and empty vector transfects had minimal invasion with only a few cells staining on the PET membr ane for each. A 2 fold increase in invasion was observed by the dual transfect compared to the parental HaCaTs. Activation of the PI3K/Akt pathway was observed by western blot analysis (Figure III.4C). Increased levels of phosphorylation were observed fo r both Akt and S6 in the dual transfect when compared to the parental or empty vector controls. Western blot analysis of the three lines treated with ON 01910.Na showed no inhibition of the PI3K activation (Figure III.2C). Increased phosphorylation of both Akt

PAGE 42

30 and S6 in all three lines is obvious. Conversely, ZSTK474 treatment inhibited PI3K/Akt transduction. The antiproliferative effects observed after ON 01910.Na treatment must be due to interactio n with other cellular processes. Observations linking E6 a nd E7 expression and PI 3K/Akt modulation were also challenged Akt and S6 phosphorylation in the dual transfect appears to be constant in all three lines. Figure III 2 ON 01910.Na (1.0uM) treatment of HaCaT transfects. A. SRB data identified no significant change in viability at 1.0uM and 10.0uM concentrations of ON 01910.Na. B. Western blot staining shows treatment with ON 01910.Na (O) induces Akt and S6RP phosphorylation in the parental, empty vector, and transfected HaCaT lines compared to the untreated (C) control. The increase in PI3K/Akt/S6K pathway activation was inhibited by treatment with the PI3K inhibitor ZSTK474 (Z).

PAGE 43

31 Although all three HaCaT lines were sensitive to treatment with ON 01910.Na at 1.0uM and 10.0 uM, growth inhibition did not vary significantly in the transformed HaCaTs from the controls. Western blottin g results from treatment studies suggest an increase in the PI3K/Akt/S6K pathway with ON 01910.Na treatment. Conversely inhibition of Akt and S6 phosphorylation was observed when these cultures were treated with ZSTK474 suggesting ON 01910.Na works throug h a very different mechanism of action than ZSTK474 Assessing outcome specific biomarkers of ON 01910.Na treatment using a direct patient tumor xe nograft platfor m While in vitro drug screening techniques provide a powerful and simple platform on which t o initially evaluate therapeutic efficacy and mechanism, cell line discoveries often do not translate well to in vivo drug activity. We next set out to evaluate ON 01910.Na activity in a direct patient tumor xenograft model, and assess the biomarkers ident ified in our cell line panel within a more clinically relevant model system Anti cancer effects of ON 0191 0.Na in xenografted tumor lines Treatment data was obtained from 8 established patient tumor lines implanted in female immunocompromised Athymic Nude Foxn1 nu mice. Tumor measurements normalized to the average volume of the control group taken on day 28 from each study are shown in figure III.6. Tumor lines are ordered from most sensitive to most resistant. Growth reduction in the ON 01910. Na treated group was observed in CUHN014, CUHN047 and CUHN026. No significant response was observed in the remaining 5 tumor lines.

PAGE 44

3 2 Figure III 3 Patient xenograft ON 01910.Na treatment efficacy Mice bearing patient derived tumors received daily ON 01910.Na infusions or vehicle for 28 days. Volumes on the final day of treatment are represented as % normalized to the vehicle control group. Growth reduction was identified CUHN014, CUHN047 and CUHN026. I hypot hesized ON 01910. Na treatment is a rational approach to therapy for HPV16+ HNSCC due to the observed correlation between HPV infection and both the activation of Akt/MAPK/S6K and enhancement in PLK1 expression (Keysar et al., 2012; Incassati et al., 2006). Half of the chosen tumor lines were positive for HPV16 infection: CUHN014, CUHN047, CUHN043 and CUHN022. There was however no correlation between HPV status and drug response (Figure III.6 ). Next, we looked at the g ene expression profile identified by qR TPCR in the sensitive HNSCC cell lines. No trend was observed in relative mRNA expression levels. We expanded the test ing to the remaining 9 genes initially chosen No biomarkers from the qRTPCR panel conferred a trend based on treatment sensitivity (data not shown).

PAGE 45

33 P I K3CA gene amplification Fluorescence in situ hybridization ( FISH ) using probes specific for the catalytic subunit of PI3K ( PIK3CA ) was obtained based on the high prevalence of gene copy number gain abnormalities which exists in HNSCC (Garg et al., 2005). Sensitivity to EGFR inhibition seems to have a direct correlation with EGFR overexpression in a subset of patients ( Cassell & Grandis, 2010 ) It follows that a mplification of PIK3CA gene product may yield a more sensitive phenotype to PI3K inhibition. Given the high prevalence of activating PIK3CA gene abnormalities reported for HNSCC the next logical step was to look for copy number gain. The FISH score quanti fies the presence of signal clusters within a given cell after normalization. A FISH score of 5 denotes a positive hit for gene amplification. Three of the eight tumor lines had PI K 3CA gene amplification (Figure III.7A ). Two, CUHN014 and CUHN047, were also sensitive to treatment with ON 01910.Na. However CUHN013 was resistant to ON 01910.Na treatment despite having PI3KCA amplification.

PAGE 46

34 Figure III 4 PI3Kca amplification detected by FISH A. Gene amplification was characterized by a FISH score above 4. PI3Kc a amplification was observed in 3 tumor lines (highlighted red) B CUHN025: PI 3 K ca na. C. CUHN013: PI3K ca amp. Mutation profiling It has been observed that the genetic landsc apes of HPV and HPV+ HNSCC differ significantly (Klussman et al, 2009) Mutations in TP53 and PI K 3CA have been described as drivers in HNSCC tumorigenesis in HPV negative tumors (Stransky et al., 2012). Amassing evidence substantiates a relationship between TP53 muta tions and prog nosis in head and neck cancers. Due to TP53 inactivation by HPV oncogenes, an inverse correlation between TP53 mutation and HPV infection has been well documented (Keysar et al., 2012; Westra et al., 2008).

PAGE 47

35 Two studies examining full exome s equencing in large patient cohorts identified loss of function mutations of NOTCH1 in 10 15% of HNSCC second only to TP53 ( Agrawal et al., 2011b ; Stransky et al., 2011 ) The high mutation rate suggests that NOTCH1 functions as a tumor suppressor in HNSCC We recently identified a correlation between altered PI3K/Akt pathway activation and inactivating NOTCH1 mutations. Furthermore, we observed inte rplay between NOTCH1 and MEK/ERK (Keysar et al., 2012) Table III 1 Exome sequencing of PI3Kca NOTCH1 and PI3K Whole exome sequencing of PIK3CA, NOTCH1 and TP53 was completed for the patient tumor lines (Table III.1). A single mutation in PI3KCA was identified. CUHN026 harbors a heterozygous E545K substitution. This variant has been catalogued as an activating mutation located within the helical domain (Lee et al ., 2005). Growth of CUHN026 was reduced in the ON 01910.Na treatment group consistent with our

PAGE 48

36 hypothesis that ON 01910.Na treatment will have a more potent effect in the presence of PI3K pathway activation. CUHN040 harbored a heterozygous R1279H substitut ion in NOTCH1 Agarwal et al., 2012 annotated this mutation as a loss of function due to its location within the EGF like repeats domain. H owever this amino acid changed register ed as benign using the PolyPhen 2 program to predict the structural impact of an amino acid substitution. TP53 s omatic mutations were identified in 3 tumor lines. G245V was identified in two tumor lines; heterozygous in CUHN025 and homozygous in CUHN026. A heterozygous G266E substitution was identified in CUHN013. These mutations a re located within the DNA binding domain which suggests they are inactivating. Confirming prior observation, none of the TP53 mutated tumor lines were HPV positive. NOTCH1 expression in ON 01910.Na treated tissue correlates with drug response Figure III.8 A summarizes the data characterizing PI3K ca NOTCH1 and TP53 genetic abnormalities within each tumor line. Interestingly the responsive tumors lines all have a PI3K CA genetic event, be it amplification or activating mutation and are either HPV16 positive or harbor an inactivating TP53 mutation However, this trend is broken by CUHN013, which has a resistant phenotype in spite of a PI3KCA amplification and TP53 mutation

PAGE 49

37 Figure III 5 Summary of genetic profiles and molecular markers of ON 01910.Na treated tumor lines A. Summary of genetic abnormalities within the treated tumor lines. Tumors lines are arranged in order of increasing resistance to ON 01910.Na treatment. No corre lation exists between any single genetic event and treatment sensitivity. The more sensitive lines each possess a PIK3CA activating event and a TP53 inactivating event. B. Western blot analysis identifies a correlation between NOTCH1 expression and ON 0191 0.Na sensitivity in the control (C) and ON 01910.Na (O) treated tissue Phosphorylation of Akt and S 6 did not confer the post treatment trend observed in HNSCC cell lines (Figure III8B) In fact, no consistent trend of phosphorylation was observed regardless of treatment outcome. The PI3K/Akt signaling pathway does not appear to be the target of ON 01910.Na drug activity. However, a comprehensive trend specific to a n ON 01910.Na sensitive phenotype emerged from NOTCH1 staining. ON 01910.Na treatment responsive xenografts have a higher baseline level of NOTCH1 expression. Mor e over, enhanced NOTCH1 expression is observed in the treated tissue of the more sensitive tumor lines. Conversely, CUH N013 has a higher baseline level of NOTCH1 associated with a decrease in NOTCH1 expression in the ON 01910.Na treated

PAGE 50

38 tissue. Taken together, these results suggest NOTCH1 may be a biomarker of ON 01910.Na treatment outcome.

PAGE 51

39 CHAPTER IV DISCUSSION ON 01910 .Na outcome specific biomarkers and treatment efficacy in HNSCC cell lines Inhibition of the PI3K/Akt signaling pathway, preliminary data in the treatment of solid tumors, and clinical relevance purport ON 01910.Na to be a promising candidate therapeutic f or the treatment of HPV positive HNSCCs. Our treatment data in HNSCC cell lines bolsters justification to further pursue preclinical experimentation with this drug. Thirteen out of 18 cell lines had an IC 50 >1.0uM, 3/18 had an IC 50 10.0uM, and only 2 cells were resistant to ON 01910.Na treatment. Furthermore, ON 01910.Na completely inhibited colony formation at 10.0uM. We identified a n ON 01910.Na sensitive gene expression pattern in the HNSCC cell li nes. PI3K downregulation correla ted with increased Myc Fos INPP4B Hey1 and Hes1 expression. The elevated levels of Myc and Fos can likely be attributed to increased signaling through the MAPK pa thway following EGFR activation. High levels of EGFR expression are common to a majority of epithelial malignancies including HNSCC ( Baba, Fujii, Tokumaru, & Kato, 2012 ; Leemans et al., 2011a ) Hey1 and Hes1 are both transcribed following NOTCH1 activation ( Katoh & Katoh, 2007 ) The observed gene exp ression pattern suggests that PI3K down regulation in the sensitive cell lines is associated with compensation by EGFR and NOTCH1 pathway activation. Inhib ition of the PI3K pathway following ON 01910.Na treatment was confirmed in the western blot comparison of the sensitive cell lin es to the resistant cell lines. We have found that S6 phosphorylation is a better marker of PI3K pathway inhibition than

PAGE 52

40 Akt using the PI3K inhibitor Px 866 ( Keysar et al., 2012 ). Phosphorylation of S6 ribosomal protein was completely inhibited in the ON 01910.Na sensitive cell lines However, p hosphorylation of Akt was not treatment outcome specific This suggests that ON 01910.Na acts downstream of Akt i n the mTOR pathway, or through a different mechanism entirely. ON 0 1910 .Na efficacy was not a result of PI3K pathway inhibition in the dual transfected HaCaT cell line The E6/E7 transfected Ha CaTs displayed characteristic changes consistent with a cancer like phenotype. Proliferation and invasion rates double compared to the control lines. More importantly, activation of the PI3K/Akt pathway was observed by western blotting. ON 01910.Na treatment of the three strains yield ed some troubling results. While the dual tra n sfect was sensitive at all concentrations, relative proliferation did not differ significantly from the empty vector transfect or the parental line at the higher concentrations. Furthermore, western blotting sh owed an increase in PI3K/Akt pathway activation after treatment with ON 01910.Na., whereas treatment with ZSTK474 yields significant inhibition of Akt and S6 phosphorylation Taken together this data suggest s ON 01910.Na inhibits proliferation through an e ntirely different mechanism than PI3K pathway suppression While phenotypic differences existed between the dual transf ect and the controls, there was no significant difference in ON 01910.Na treatment outcome or PI3K pathway depression Further characteri zation is neede d to evaluate the potential of the dual transfect as an HPV positive surrogate

PAGE 53

41 Identification of biomarkers in ON 01910.Na sensitive HNSCC xen o grafts Only modest drug activity was observed in our patient xenograft model. After 28 days of treatment, growth reduction was observed in the 3 most sensitive lines. PI3K modulation by HPV infection did not yield a more sensitive phenotype. There was no inhibition of phosphorylation of neither Akt nor S6 in response to ON 01910.Na treatment. Fur thermore, no correlation was identified between any PIK3CA activating event and a treatment sensitive phenotype. Taken together, these results suggest there is no inhibitory effect on the PI3K pathway by ON 01910.Na in the HNSCC xenografts treated. Mutations in TP53 are present in ~50% of HNSCC patients. Given that the HPV viral oncoprotein E6 works to inactivate p53, an inverse correlation has been documented between HPV infection and TP53 mutations ( Goon et al., 2009 ) Our data confirmed this observation. Direct exon sequencing of TP53 showed no link between inac tivating mutations and ON 01910.Na sensitivity alone. However, a correlation between sensitivity to ON 01910.Na treatment and the tumor line having both a PIK3CA activating event and either a deleterious TP53 mutation or p53 inactivation by HPV16 infectio n was identified CUHN013 satisfied these criteria as well while having an ON 01910.Na resistant phenotype. This suggests that the combination of a PIK3CA activating event and TP53 inactivating event is sufficient, but does not necessarily yield an ON 0191 0.Na sensitive phenotype. NOTCH1 was recently identified in two independent studies as being second only to TP53 in the rate of mutation in HNSCC patients ( Agrawal et al., 2011b ; Stransky et al., 2011 ) In a manuscript currently under review for publication, Keysar et al. showed that

PAGE 54

42 i nactivating mutations in NOTCH1 correlate with altered PI3K/Akt pathway activation to compensate Furthermor e, there was interplay between NOTCH1 and MEK/ERK. The observed upregulation of Hes1 and Hey1 in our cell lines suggests NOTCH1 signaling pathway augmentation by ON 01910.Na. Only CUHN040 harbored a NOTCH1 mutation, and was not sensitive to treatment with ON 01910.Na. PolyPhen 2 analysis scored this mutation as benign, however this amino acid substitution was annotated as damaging ( Agrawal et al., 2011b ) Interestingly, w e observed enhanced NOTCH1 protein expression in the treated tissue of the ON 01910.Na sensitive xenografts, whereas the more resistant tumor lines did not express NOTCH1 in measurable concentrations. Proposed mechanism of action by ON 01910.Na in HNSCC ON 01910.Na was initially characterized as an inhibitor of PLK1 which le d to inte rest in its potential as a cancer therapeutic. The mechanism by which PLK1 activity is inhibited during mitosis was identified within the l ast year. ON 01910.Na binds to R af, preventing its binding to and the phosphorylation of PLK1. Based on our observations that ON 01910.Na does not inhibit PI3K pathway activation in HNSCC xenografts and the enhanced NOTCH1 expression observed in ON 01910.Na treated tumor tissue, I propose that ON 01910.Na is in fact inhibiting the activity of Raf in the Ras/MEK/ERK signaling pathway. This would explain the presence of elevated NOTCH1 expression to compensate for EGFR/MEK/ERK pathway inhibition This mechanism is outl ined in Figure IV.1. Further investigation is needed to substantiate t he effect of ON 01910.Na treatment on the Ras/MEK/ERK pathway

PAGE 55

43 Figure IV 1 Proposed mechanism of action by ON 01910.Na in HNSCC xenog rafts.

PAGE 56

44 REFERENCES Agrawal, N., Frederick, M. J., Pickering, C. R., Bettegowda, C., Chang, K., Li, R. J., . Myers, J. N. (2011a). Exome sequencing of head and neck squamous cell carcinoma reveals inactivating mutations in NOTCH1. Science, 333 (6046), 1154 1157. doi: science.1206923 [pii] 10.1126/science.1206923 Agrawal, N., Frederick, M. J., Pickering, C. R., Bettegowda, C., Chang, K., Li, R. J., . Myers, J. N. (2011b). Exome Sequencing of Head and Neck Squamous Cell Carcinoma Reveals Inactivating Mutations in NOT CH1. Science, 333 (6046), 1154 1157. doi: DOI 10.1126/science.1206923 Baba, Y., Fujii, M., Tokumaru, Y., & Kato, Y. (2012). Present and Future of EGFR Inhibitors for Head and Neck Squamous Cell Cancer. J Oncol, 2012 986725. doi: 10.1155/2012/986725 Bernier J., Bentzen, S. M., & Vermorken, J. B. (2009). Molecular therapy in head and neck oncology. Nature Reviews Clinical Oncology, 6 (5), 266 277. doi: DOI 10.1038/nrclinonc.2009.40 Bourhis, J., Lefebvre, J. L., & Vermorken, J. B. (2010). Cetuximab in the mana gement of locoregionally advanced head and neck cancer: expanding the treatment options? Eur J Cancer, 46 (11), 1979 1989. doi: 10.1016/j.ejca.2010.05.015 Bunney, T. D., & Katan, M. (2010). Phosphoinositide signalling in cancer: beyond PI3K and PTEN. Nat Re v Cancer, 10 (5), 342 352. doi: 10.1038/nrc2842 Burtness, B. A., Manola, J., Axelrod, R., Argiris, A., & Forastiere, A. A. (2008). A randomized phase II study of ixabepilone (BMS 247550) given daily x 5 days every 3 weeks or weekly in patients with metastat ic or recurrent squamous cell cancer of the head and neck: an Eastern Cooperative Oncology Group study. Annals of Oncology, 19 (5), 977 983. doi: DOI 10.1093/annonc/mdm591 Cassell, A., & Grandis, J. R. (2010). Investigational EGFR targeted therapy in head a nd neck squamous cell carcinoma. Expert Opin Investig Drugs, 19 (6), 709 722. doi: 10.1517/13543781003769844 Chaturvedi, A. K., Engels, E. A., Pfeiffer, R. M., Hernandez, B. Y., Xiao, W., Kim, E., . Gillison, M. L. (2011). Human papillomavirus and risin g oropharyngeal cancer incidence in the United States. J Clin Oncol, 29 (32), 4294 4301. doi: 10.1200/JCO.2011.36.4596 Datta, S. R., Brunet, A., & Greenberg, M. E. (1999). Cellular survival: a play in three Akts. Genes Dev, 13 (22), 2905 2927. Degenhardt, Y ., & Lampkin, T. (2010). Targeting Polo like kinase in cancer therapy. Clin Cancer Res, 16 (2), 384 389. doi: 10.1158/1078 0432.CCR 09 1380 DeGregori, J., & Johnson, D. G. (2006). Distinct and Overlapping Roles for E2F Family Members in Transcription, Proliferation and Apoptosis. Curr Mol Med, 6 (7), 739 748. Duensing, S., & Munger, K. (2004). Mechanisms of genomic instability in human cancer: insights from s tudies with human papillomavirus oncoproteins. Int J Cancer, 109 (2), 157 162. doi: 10.1002/ijc.11691

PAGE 57

45 Dyson, N. (1998). The regulation of E2F by pRB family proteins. Genes Dev, 12 (15), 2245 2262. Eder, J. P., Vande Woude, G. F., Boerner, S. A., & LoRusso, P. M. (2009). Novel therapeutic inhibitors of the c Met signaling pathway in cancer. Clin Cancer Res, 15 (7), 2207 2214. doi: 10.1158/1078 0432.CCR 08 1306 Estilo, C. L., P, O. Charoenrat, Ngai, I., Patel, S. G., Reddy, P. G., Dao, S., . Singh, B. (2003 ). The role of novel oncogenes squamous cell carcinoma related oncogene and phosphatidylinositol 3 kinase p110alpha in squamous cell carcinoma of the oral tongue. Clin Cancer Res, 9 (6), 2300 2306. Gewinner, C., Wang, Z. G. C., Richardson, A., Teruya Felds tein, J., Etemadmoghadam, D., Bowtell, D., . Cantley, L. C. (2009). Evidence that Inositol Polyphosphate 4 Phosphatase Type II Is a Tumor Suppressor that Inhibits PI3K Signaling. Cancer Cell, 16 (2), 115 125. doi: DOI 10.1016/j.ccr.2009.06.006 Goon, P. K., Stanley, M. A., Ebmeyer, J., Steinstrasser, L., Upile, T., Jerjes, W., . Sudhoff, H. H. (2009). HPV & head and neck cancer: a descriptive update. Head Neck Oncol, 1 36. doi: 10.1186/1758 3284 1 36 Haddad, R. I., & Shin, D. M. (2008). Recent advanc es in head and neck cancer. New England Journal of Medicine, 359 (11), 1143 1154. doi: Doi 10.1056/Nejmra0707975 Hardisson, D. (2003). Molecular pathogenesis of head and neck squamous cell carcinoma. European Archives of Oto Rhino Laryngology, 260 (9), 502 5 08. doi: DOI 10.1007/s00405 003 0581 3 Howard, J. D., Lu, B., & Chung, C. H. (2012). Therapeutic targets in head and neck squamous cell carcinoma: identification, evaluation, and clinical translation. Oral Oncol, 48 (1), 10 17. doi: 10.1016/j.oraloncology.2 011.09.013 Katoh, M., & Katoh, M. (2007). Notch signaling in gastrointestinal tract (review). Int J Oncol, 30 (1), 247 251. Kreimer, A. R., Clifford, G. M., Boyle, P., & Franceschi, S. (2005). Human papillomavirus types in head and neck squamous cell carcinomas worldwide: a systematic review. Cancer Epidemiol Biomarkers Prev, 14 (2), 467 475. doi: 10.1158/1055 9965.EPI 04 0551 Keysar, S. B., Astling, D. P., Anderson, R. T. Vogler, B. W., Bowles, D. W., Morton, J. J., . Jimeno, A. (2012) A patient tumor transplant model of squamous cell cancer identifies PI3K inhibitors as candidate therapeutics in defined molecular bins Manuscript submitted for publication Lace, M. J ., Anson, J. R., Klussmann, J. P., Wang, D. H., Smith, E. M., Haugen, T. H., & Turek, L. P. (2011). Human papillomavirus type 16 (HPV 16) genomes integrated in head and neck cancers and in HPV 16 immortalized human keratinocyte clones express chimeric viru s cell mRNAs similar to those found in cervical cancers. J Virol, 85 (4), 1645 1654. doi: 10.1128/JVI.02093 10 Lechner, M. S., & Laimins, L. A. (1994). Inhibition of p53 DNA binding by human papillomavirus E6 proteins. J Virol, 68 (7), 4262 4273. Leemans, C R., Braakhuis, B. J. M., & Brakenhoff, R. H. (2011a). The molecular biology of head and neck cancer. Nature Reviews Cancer, 11 (1), 9 22. doi: Doi 10.1038/Nrc2982

PAGE 58

46 Leemans, C. R., Braakhuis, B. J. M., & Brakenhoff, R. H. (2011b). Response to correspondence on the molecular biology of head and neck cancer. Nature Reviews Cancer, 11 (5), 382 382. doi: Doi 10.1038/Nrc2982 C2 Menges, C. W., Baglia, L. A., Lapoint, R., & McCance, D. J. (2006). Human papillomavirus type 16 E7 up regulates AKT activity through the retinoblastoma protein. Cancer Res, 66 (11), 5555 5559. doi: 10.1158/0008 5472.CAN 06 0499 Moody, C. A., & Laimins, L. A. (2010). Human papillomavirus oncoproteins: pathways to transformation. Nat Rev Cancer, 10 (8), 550 560. doi: 10.1038/nrc2886 Myers, E. N (2010). Head and neck oncology -2010, Part I. Otolaryngol Pol, 64 (3), 136 146. doi: 10.1016/S0030 6657(10)70049 4 Nicholson, K. M., & Anderson, N. G. (2002). The protein kinase B/Akt signalling pathway in human malignancy. Cell Signal, 14 (5), 381 395. O r, Y. Y., Hui, A. B., Tam, K. Y., Huang, D. P., & Lo, K. W. (2005). Characterization of chromosome 3q and 12q amplicons in nasopharyngeal carcinoma cell lines. Int J Oncol, 26 (1), 49 56. Penton, A. L., Leonard, L. D., & Spinner, N. B. (2012). Notch signal ing in human development and disease. Semin Cell Dev Biol, 23 (4), 450 457. doi: 10.1016/j.semcdb.2012.01.010 Pim, D., Massimi, P., Dilworth, S. M., & Banks, L. (2005). Activation of the protein kinase B pathway by the HPV 16 E7 oncoprotein occurs through a mechanism involving interaction with PP2A. Oncogene, 24 (53), 7830 7838. doi: DOI 10.1038/sj.onc.1208935 Scheffner, M., Huibregtse, J. M., Vierstra, R. D., & Howley, P. M. (1993). The HPV 16 E6 and E6 AP complex functions as a ubiquitin protein ligase in t he ubiquitination of p53. Cell, 75 (3), 495 505. Schreck, K. C., Taylor, P., Marchionni, L., Gopalakrishnan, V., Bar, E. E., Gaiano, N., & Eberhart, C. G. (2010). The Notch Target Hes1 Directly Modulates Gli1 Expression and Hedgehog Signaling: A Potential Mechanism of Therapeutic Resistance. Clinical Cancer Research, 16 (24), 6060 6070. doi: Doi 10.1158/1078 0432.Ccr 10 1624 Sjoblom, T., Jone s, S., Wood, L. D., Parsons, D. W., Lin, J., Barber, T. D., . Velculescu, V. E. (2006). The consensus coding sequences of human breast and colorectal cancers. Science, 314 (5797), 268 274. doi: 10.1126/science.1133427 Snow, A. N., & Laudadio, J. (2010). Human Papillomavirus Detection in Head and Neck Squamous Cell Carcinomas. Advances in Anatomic Pathology, 17 (6), 394 403. doi: Doi 10.1097/Pap.0b013e3181f895c1 Stransky, N., Egloff, A. M., Tward, A. D., Kostic, A. D., Cibulskis, K., Sivachenko, A., . Grandis, J. R. (2011). The mutational landscape of head and neck squamous cell carcinoma. Science, 333 (6046), 1157 1160. doi: 10.1126/science.1208130 Termine, N. Panzarella, V., Falaschini, S., Russo, A., Matranga, D., Lo Muzio, L., & Campisi, G. (2008). HPV in oral squamous cell carcinoma vs head and neck squamous cell carcinoma biopsies: a meta analysis (1988 2007). Annals of Oncology, 19 (10), 1681 1690. doi: D OI 10.1093/annonc/mdn372 Vermorken, J. B., Mesia, R., Rivera, F., Remenar, E., Kawecki, A., Rottey, S., . Hitt, R. (2008). Platinum based chemotherapy plus cetuximab in head and neck cancer. N Engl J Med, 359 (11), 1116 1127. doi: 10.1056/NEJMoa0802656

PAGE 59

47 Wilken, R., Veena, M. S., Wang, M. B., & Srivatsan, E. S. (2011). Curcumin: A review of anti cancer properties and therapeutic activity in head and neck squamous cell carcinoma. Mol Cancer, 10 12. doi: 10.1186/1476 4598 10 12 Woenckhaus, J., Steger, K., W erner, E., Fenic, I., Gamerdinger, U., Dreyer, T., & Stahl, U. (2002). Genomic gain of PIK3CA and increased expression of p110alpha are associated with progression of dysplasia into invasive squamous cell carcinoma. J Pathol, 198 (3), 335 342. doi: 10.1002/ path.1207 Yeager, T. R., & Reddel, R. R. (1999). Constructing immortalized human cell lines. Current Opinion in Biotechnology, 10 (5), 465 469. doi: Doi 10.1016/S0958 1669(99)00011 7 Zerfass, K., Schulze, A., Spitkovsky, D., Friedman, V., Henglein, B., & Ja nsen Durr, P. (1995). Sequential activation of cyclin E and cyclin A gene expression by human papillomavirus type 16 E7 through sequences necessary for transformation. J Virol, 69 (10), 6389 6399.