Citation
Single-molecule analysis of synaptotagmin & lateral diffusion across a supported lipid bilayer

Material Information

Title:
Single-molecule analysis of synaptotagmin & lateral diffusion across a supported lipid bilayer
Creator:
Chantranuvatana, Kan ( author )
Language:
English
Physical Description:
1 electronic file (44 pages). : ;

Subjects

Subjects / Keywords:
Pancreatic beta cells ( lcsh )
Bilayer lipid membranes ( lcsh )
Genre:
bibliography ( marcgt )
theses ( marcgt )
non-fiction ( marcgt )

Notes

Review:
Synaptotagmin 7 is an important protein involved with insulin secretion in pancreatic ß-cells. It acts as a Ca2+ sensor for the SNAREs prote that facilitates the fusion between the secretory vesicle and the plasma membrane. Synaptotagmin 7 binds to the calcium using its two C2 domains, the C2A and the C2B. TIRFM was used to test the diffusion coefficient of Syt 7 C2 domains across a supported lipid bilayer in order to further understand how they bind to membranes. Should both C2 domains bind within the same orientation as each other, the frictional coefficient should become additive as the linker length between them lengthens and approach the free draining limit. Results show that the diffusion coefficient is not additive despite the elongated linker length. This leads to the plausible explanation tha the C2 domains interact with each other when bound to a lipid layer. Further research would delve into this interaction between the two C2 domains.
Thesis:
Thesis (M.S.)--University of Colorado Denver, Department of Chemistry
Bibliography:
Includes bibliographical references.
System Details:
System requirements: Adobe Reader.
Statement of Responsibility:
by Kan Chantranuvatana.

Record Information

Source Institution:
Auraria Library
Holding Location:
Auraria Library
Rights Management:
All applicable rights reserved by the source institution and holding location.
Resource Identifier:
891209377 ( OCLC )
ocn891209377

Downloads

This item is only available as the following downloads:


Full Text

PAGE 1

SINGLE MOLECULE ANALYSIS OF SYNAPTOTAGMIN 7 LATERAL DIFFUSION ACROSS A SUPPORTED LIPID BILAYER b y KAN CHANTRANUVATANA B.S. Chemistry, University of Colorado Denver, 20 09 A thesis submitted to the Faculty of the Graduate School of the University of Colorado in partial fulfillment of the requirements for the degree of Master of Science Chemistry 201 3

PAGE 2

ii 2013 KAN CHANTRANUVATANA ALL RIGHTS RESERVED

PAGE 3

iii This thesis for the Master of Science degree by Kan Chantranuvatana has been approved for the Department of Chemistry by Jefferson Knight C hair Xiao jun Ren Scott Reed November 13 th 2013

PAGE 4

iv Chantranuvatana, Kan (M.S., Chemistry) Single Molecule Analysis Of Synaptotagmin 7 Lateral Diffusion Across A Supported Lipid Bilayer Thesis directed by Professor Jefferson Knight. ABSTRACT cells. It act s as a Ca 2+ sensor for the SNAREs protein that facilitates the fusion between the secretory vesicle and the plasma membrane. Synaptotagmin 7 binds to the calcium using its two C2 domains, the C2A and the C2B. TIRFM was used to test the diffusion coefficient of Syt 7 C2 domains across a supported lipid bilayer in order to further understand how t hey bind to membranes. Should both the C2 domains bind with the same orientation as each other, then the frictional coefficient should become additive as the linker length between them lengthens and approach the free draining limit. Results show that the d iffusion coefficient is not additive despite the elongated linker length. This leads to the plausible explanation that the C2 domains interact with each other when bound to a lipid bilayer. Further research would delve into this interaction between the two C2 domains. The form and content of this abstract approved. I recommend its publication Approved: Jefferson Knight

PAGE 5

v ACKNOWLEDGMENTS I would like to thank all the members of the Knight lab for their help and support. I greatly appreciate Jefferson Knight for allowing me to work in his lab all these years and to help other members of the lab learn and grow together. I would especially li ke to thank Joseph Vasquez for his dedication and hard work in the lab, Tatyana Liakhova for her friendship and knowledge with laboratory techniques, and Salazar Beatrice for being a spectacular lab mate. Additionally, I would like to acknowledge all my fr iends and family for their continued support of me through these years.

PAGE 6

vi TABLE OF CONTENTS CHAPTER I. INTRODUCTION ................................ ................................ ................................ ......... 1 Introduction to S ynaptotagmin protein ................................ ................................ ................ 1 Function of SNAREs ................................ ................................ ............................... 1 C2 Domains in Synaptotagmin isoforms ................................ ................................ 1 Function of Synaptotagmin 7 ................................ ................................ ................... 3 Membrane targeting of Synaptotagmin C2A and C2B domains ............................. 4 Lipid bilayers and binding ................................ ................................ ....................... 5 Diffusion measurement across a supported lipid bilayer ................................ ......... 6 Introduction to TIRF ................................ ................................ ................................ .............. 7 TIRF concept ................................ ................................ ................................ ........... 7 II. EXPERIMENTAL ................................ ................................ ................................ ......... 9 Materials ................................ ................................ ................................ ................................ .. 9 Protein mutagenesis ................................ ................................ ................................ ....... 9 Protein expression and purification ................................ ................................ ............. 10 Sfp purification ................................ ................................ ................................ ............ 11 Labeling and purification of fluorescent labeled protein ................................ ............. 11 Preparation of phospholipid vesicles ................................ ................................ ........... 11 Sample preparation for single molecule experiment ................................ ................... 12 TIRFM measurement ................................ ................................ ................................ ... 12 Single particle tracking and analysis ................................ ................................ ...... 1 3 Slidebook particle tracking ................................ ................................ .................... 1 3

PAGE 7

vii Single molecule diffusion analysis ................................ ................................ ........ 1 3 III. RESULTS ................................ ................................ ................................ .............................. 1 5 Dif fusion coefficient of lipids ................................ ................................ ............................. 1 5 Diffusion measurements of isolated domains and wild type C2AB tandem domain .. 1 6 Mutagenesis and expression of Syt7 C2AB linker extension variants ........................ 1 8 Purification and characterization of SFP ................................ ............................... 1 9 Purification and characterization of Syt 7 proteins ................................ ................ 1 9 TIRFM experiments ................................ ................................ ................................ ..... 21 Diffusion coefficient of increased linker ................................ ............................... 21 IV. DISCUSSIONS ................................ ................................ ................................ ............ 25 TIRF measurements ................................ ................................ ................................ ............. 25 Implication of the cooperativity between the C2 domains ................................ .... 26 V. CONCLUSIONS ................................ ................................ ................................ .......... 28 REFERENCES ................................ ................................ ................................ ............ 2 9

PAGE 8

viii LIST OF TABLES TABLE 1. Syt isoform expression in various endocrine system ................................ ............... 2 2 Summarizes the different linker region extensions. ................................ .............. 1 0 3. Summary of diffusion coefficients. ................................ ................................ ....... 1 6 4 Su mmary of diffusion coefficients with linker extension ................................ ..... 22

PAGE 9

ix LIST OF FIGURES FIGURE 1. Diagram of the domain structure of synaptotagmin. ................................ .............. 3 2. Diagram showing the location of S yt 7 and 9 on the surface of synaptic vesicle ... 4 3 Objective type TIRF microscopy. ................................ ................................ ........... 8 4 The two options for when linker region is increased. ................................ ........... 18 5. 14% SDS PAGE gel of purified SFP protein. ................................ ...................... 1 9 6. Absorbance spectra of gel filtrated protein. ................................ .......................... 20 7. 15% SDS PAGE gel of fluorescent labeled proteins. ................................ ........... 21 8 Representative images of fluorescent protein binding to lipid bilayer ................. 22 9 Mat hematic analysis plots of Syt 7 4x and 16x diffusion coefficient. .................. 23

PAGE 10

x LIST OF EQUATIONS EQUATION 1. Stokes Einstein equation ................................ ................................ .......................... 6 2. Additive diffusion coefficient equation ................................ ................................ .. 6 3. Rayleigh probability density function ................................ ................................ .... 1 4 4. 1 component Cumulative probability distribution ................................ ................. 14 5. 2 component Cumulative probability distribution ................................ ................ 14 6. Reduced average of C2A and C2B diffusion ................................ ........................ 16 7. Additive diffusion coefficient of C2AB ................................ ............................... 17 8. Simplified diffusion coefficient of C2AB ................................ ............................. 17

PAGE 11

xi LIST OF ABBREVIATIONS Syt Synaptotagmin TIRF Total internal reflection fluorescence TIRFM Total internal reflection fluorescence microscopy WT Wild type BME Mercaptoethanol EDTA Ethylenediaminetetraacetic acid DOPC 1,2 di (9Z octadecenoyl) sn glycero 3 phosphocholine DOPS 1,2 di (9Z octadecenoyl) sn glycero 3 phospho L serine SNARE soluble N ethylmaleimide sensivite fusion protein attachment receptor SMB Single Molecule Buffer FAB Fluorescent Assay Buffer FPLC Fast Protein Liquid Chromatography SDS Sodium dodecyl sulfate EPI epifluorescence SV Synaptic vesicles LDCVs Large dense core vesicles SDHPW Saffman Delbruck Hughes Palithorpe White MWCO Molecular weight cut off

PAGE 12

1 CHAPTER I INTRODUCTION Introduction to S ynaptotagmin protein Function of SNAREs Neurotransmitters, neuropeptides and hormones are released through regulated exocytosis, a process controlled by the influx and concentration of calcium. 26 29 This event involves a fusion of synaptic vesicles (SV) or large dense core vesicles (LDCVs) with the plasma membrane of the cell. The fusion process is facilitated by a large number of proteins, of most importance being the soluble N ethylmaleimide sensit ive factor attachment protein receptor (SNARE) proteins. 20 The SNARE proteins can be divided into two sets: target membrane SNAREs (t SNAREs) which include S yntaxin and S ynaptosome associated protein of 25 kDa (SNAP 25); and the vesicle SNARE (v SNARE) s ynaptobrevin. 30 The SNARE complex forms a four helix bundle that inserts into the vesicle and the target membrane to mediate fusion, a mechanism that is still not completely understood. What is known however is that the presence of Ca 2+ and Ca 2+ sensors s uch as synaptotagmin are required for fast SNARE mediated fusion in vivo The severe impairment in Ca 2+ triggered release observed in synaptotagmin null ex periment s in Drosophila and C. elegans p rovide evidence of the functional importance of this system 37 C2 Domains in Synaptotagmin Isoforms The synaptotagmin family is composed of a short N terminal sequence, an N terminal transmembrane region, a sequence of variable length, and two functional C2 domains C2A and C2B. 4,5 ( Figure 1 .) Currently there are 17 known synaptotagmin

PAGE 13

2 (Syt) isoforms in mammals, each of which contains a tandem C2 domain. 1 Of those seventeen isoforms, Syt 1, 4, 7, and 9 are found to be expressed in multiple endocrine systems with 1, 4, and 7 being conserved proteins across a wide array of metazoan genomes 2 ( Table 1 ). Interestingly t he Syt 9 isoform has been mista ken as Syt 5 in some studies leading to confusion of the actual 386 amino acid isoform 3 Table 1. Syt isoform expression in various endocrine systems. Cells Syt isoforms PC12 cells 1, 3 10 Chromaffin cells 1, 4, 7, 9 Hypothalamus 1 4 Anterior pituitary 1, 3, 4 Posterior pituitary 1, 4 Intermediate pituitary (melanotrophs) 1, 3, 4, 7, 9 Pancreatic islets 3, 4, 5, 7, 9 cells 1 5, 7, 8, 9, 11, 13 7 Table edited from the review of Jackson and Moghadam mostly based on immunocytochemistry (see reference). C2 domains are found in a multitude of proteins that act as a Ca 2+ sensors and phospholipid binding modules. 11 The domain consists of a conserved sequence motif of 130 140 amino acid residues, first defined in protein kinase C. 32 34 C2 domains typically serve as Ca 2+ sensors and bind anionic phospholipid head groups of a lipid bilayer in response to Ca 2+ 11 Studies have shown that C2 domains utilize hydrophobic and /or electrostatic interactions when docking to their target membranes. 13 17 The precise

PAGE 14

3 combination of hydrophobic and electrostatic interactions varies among C2 domains in different proteins, and even varies between C2A domains in different synaptotagmin isoforms 54 Figure 1. Diagram of Synaptotagmin domain structure ; TM, transmembrane domain. Not all synaptotagmin isoforms bind calcium; the ones that do (1, 2, 3, 5, 6, 7, 9, and 10) 36 also bind membranes upon sensing Ca 2+ concentrations in the range of 1 40 M. 35 Synaptotagmin 1 has a calcium sensitivity on the high (weak) end of this range, bu t binds membranes and Ca 2+ extremely rapidly in processes such as neurotransmitter secretion. Synaptotagmin 1 has been extensively studied and is typically used as a point of comparisons to the other isoforms. On the other hand, Syt 7 is the most Ca 2+ se nsitive synaptotagmin isoform, and is typically involved in low Ca 2+ secretory processes such as insulin secretion Function of Synaptotagmin 7 Synaptotagmin 7 is the primary isoform involved in Ca 2+ triggered insulin 6,7 Deletion of Syt 7 has been shown to significantly decrease Ca 2+ cells. 8 Syt 7 in cells can be found anchored to the vesicle membrane via the transmembrane domain as shown in Figure 2 Similar to Syt 1, Syt 7 functions in conjunction with the SNARE proteins to facilitate fusion of the secretory vesicle and the plasma membrane. 9 Syt 7 has been found in other intracellular locations depending upon cell types and expression levels 7,52,53 In studying Syt 7, we take a deeper look into how

PAGE 15

4 its two C2 domain s interact with lipid bilayers upon influx of calcium Figure 2. Diagram showing the location of Syt 7 and 9 on the surface of synaptic vesicle. T he surface of the secretory vesicles on its way to merge with the plasma membrane. The N terminal helix of Syt 7 and Syt 9 is anchored to the secretory vesicle and exists throughout the surface of the vesicle. 1 Membrane targeting of S ynaptotagmin C2A and C2B domains The exact mechanism by which synaptotagmin Ca 2+ binding triggers membrane fusion occurs is still under debate However, mutation of the C2B and C2A Ca 2+ binding site on Syt 1 has been shown to severely hinder the rate of secretion 12 Furthermore, evidence suggests that the Syt 1 C2 domains act synergistically based on how tightly they bind to chromaffin granules 18 and their penetration into the membrane as tandem domains compared to isolated domains. 19 Furthermore the ability of Syt1 C2B to bind membranes containing the anionic lipid phosphatidylserine (PS) is enhanced by the presence of adjacent C2A domain 42 lending support to the idea that the two domains bind their target membrane(s) cooperatively The interaction between C2AB and the phospholipid bilayer occurs with diffusion limited kinetics and generates high affinity protein membrane complex es. 9,42,43 Overall, these observations suggest that role of the C2AB tandem in synaptotagmin function is more than just the simple combination of properties of the individual C2 domains.

PAGE 16

5 An interesting question has arisen on how the two C2 domains within a C2AB tandem interacts in the presence of two different bil ayers; do the membrane bind in the same direction or opposite fashion such that they dock to opposing bilayers ? 20 Binding of the two domains to opposing bilayer could help bring the secretory vesicle and the plasma membrane closer together for fusion. However, the transmembrane domain of Syt 7 is anchored into the secretory vesicle, the binding of both domains to the plasma membrane could also bring the membranes close r together for fusion. To further complicate matter the plasma membrane and the secretory vesicle becomes one contiguous and curved membrane after fusion, making it difficult to identify where the C2 domains was bound prior to the merging. For Syt 1, it is still unclear as to how the C2 domain s bind to membranes singularly, oppositely, or only to curved membrane; these scenarios have not been explored for the C2 domains of Syt 7. For this study, we have chosen to study Syt 7 C2AB binding to planar supported lipid bilayers to better understand how the tandem C2 domain work together to bind lipids. Lipid bilayers and binding Deposition of phospholipid bilayers on solid supports has been used in a number of analytical techniques from atomic force microscopy, surface plasmon resonance, fluorescence correlation spectroscopy 38 and for this paper, single molecule (SM) total internal reflection fluorescence microscopy (TIRFM ) A solution of vesicles is brought into contact w ith a suitable substrate then, given favorable conditions, the vesicles then adsorb to the surface, rupture, and spontaneously condense into a continuous bilayer covering the substrate. 38 Here, binding and lateral diffusion are made for C2AB tandem domains on lipid bilayers composed of a 3:1 mixture of the zwitterionic lipid

PAGE 17

6 phosphatidylcholine (PC) and the anionic lipid phosphatidylserine (PS). B oth C2 dom ains are known to interact with anionic PS via interactions involving their Ca 2+ binding loops 9,37,39 Diffusion measurement across a supported lipid bilayer Lateral diffusion of lipids, proteins, lipid domains and other assemblies is a vital aspect of biological membrane dynamics essential for physiological functions in cells. 44 Diffusion coefficient for membrane embedded obje cts can be explained by the Saffman Delbruck Hughes Palithorpe White (SDHPW) theory 45,46 which describes the membrane as a two dimensional structureless fluid sheet, surrounded by an infinite bulk fluid and the diffusing object as a solid cylinder spannin g the membrane and coupled by a no slip boundary conditions to its surrounding. SDHPW has been used to describe the behavior of integral membrane proteins 47,48 D depends on the frictional coefficient of its contact with the membrane. Isotropic molecular diffusion in fluids can be described usi ng the Stoke s Einstein equation : D = k B (1) where k B T is the temperature, and f is frictional drag coefficient. 21 P revious studies indicate that frictional coefficients of multimeric membrane targeting protein domains can be additive, when their bound lipids are separated by distances as short as 6 nm. 21 The total friction felt by the multimer becomes the total sum of each number of monomers and thus the diffusion constant for a polymer with N monomers is given by D = k B 1 2 3 N ) (2)

PAGE 18

7 In order for this relationship to hold, the lipids bound by each domain must be sufficiently separated or they could hydrodynamically screen each other in the membrane. 21 If they are not sufficiently separated, the diffusion of one domain in one direction will influence a preference in the nearby domain to diffuse in the same direction. 49,50 The minimum separation distance between these bound lipids is termed the free drai ning limit as lipid molecules in between the two domains are able to move freely without being hydrod yn amically hindered by the tightly bound limits. The precise distance required for free draining versus coupled diffusion is controversial ; simulations h ave indicated that a separation of up 1.6 nm is correlated. 51 Introduction to TIRF TIRF concept T otal internal reflection fluorescence m icroscopy allow s for selective excitation of fluorophores near 22 A thin evanescent field is produced by a light beam incident at a high angle on the interface between two phases with different refractive indices, such as the interface between a glass slide and an aqueous sample (Figure 4) The incident angle must be greater than the critical angle for the beam to totally internally reflect rather than refract through the interface. The generated thin electromagnetic field in the liquid is the same freque ncy as the incident light and decays exponentially in intensity with increasing distance from the surface. This field excite s fluorophores near the surface (within ~100 nm) and avoid exciting the rest of the fluorophores further in the liquid. 22 Using TIRF we can focus only on the proteins bound to the lipid bilayer (which has a thickness of ~4 5 nm) with a minimal contribution to fluorescence from molecules in the bulk solution By

PAGE 19

8 taking snapshots of the illuminated field over time, mathematical programs such as ImageJ and Slidebook can track the particle from frame to frame and read out the trajectory of the particle. The trajectories can then be compiled and use d to calculate the diffusion coefficient of each tracked particles. A summation of all diffusion coefficient for each movie can then be used to describe the diffusion coefficient of the protein being tested. Figure 3 Objective type TIRF microscopy. Fluorescence is collected from the sample on the same side as the excitation light is delivered. Green dots encircled by red circles are fluorophores that bind to the lipid bilayer.

PAGE 20

9 CHAPTER II EXPERIMENTAL Materials All water was deionized to 18.2 q Water Purification Systems, Milipore, Bellerica, MA), and reagents were reagent grade unless otherwise specified. Synthetic phospholipids 1,2 dioleoyl sn glycero 3 phosphocholine (DOPC ; PC ); 1,2 dioleoyl sn glycero 3 [phospho L serine] (DOPS ; PS ) were from Avanti Polar Lipids (Alabaster, AL). Alexa Fluor 488 (A488) C2 maleimide; Alexa Fluor 555 (A555) maleimide; and Alexa Fluor (647) C2 maleimide were from Invitrogen (Carlsbad, CA). Hydrogen Peroxide 30% from J.T. Baker (Cen ter Valley, PA). Protein mutagenesis cDNA encoding hu man Synaptotagmin 7 was obtained from American Type Culture Collection (Syt 7: 11045721, Syt 9: 10436661) The C2A, C2B, and C2AB domains were subcloned into a n N terminal GST expression plasmid developed in the Knight lab, termed pRDX2 21 The following mutagenesis reaction was performed to lengthen the linker region between C2A and C2B ( Table 2) Site directed mutagenesis (Quikchange II XL, Agil ent) was used to insert six amino acid sequence ( CTCGAG ) that acted as a unique Xho I restriction site within the Syt7 C2A C2B linker. The restriction site coded for an additional Ser Ser inserted between Gly Ser Gly Ser. Site directed mutagenesis (Quikchange II XL, Agilent) was used to insert Gly Ser residue upstream from the Ser Ser residue in the C2A C2B linker Oligonucleotides were synthesized ( fwd: cgctaccatcgccatcaaggcctccgagtccatcgccgagct rev: tcgagccgctacctgagcctccggaactaccgctaccatcgc ) (Integrated DNA Technologies, Coralville)

PAGE 21

10 encoding 14 residues (SSGGSGSSGGSGSG) was inserted upstream from the Ser Ser residue in the C2A C2B linker region thus totaling 16 inserted residues DNA seq uencing was performed by SeqWright. Table 2. Summarizes the different linker region extensions. G stands for glycine and S stands for serine. The sequence CSDGSGS is the inter domain linker region between C2A and C2B. Species Linker Region # of Amino Acids Inserted Syt 7 C 2 AB WT CSDGSGS N/A Syt 7 C 2 AB 2x CSDGS SS GS 2 Syt 7 C 2 AB 4x CSDGS GSSS GS 4 Syt 7 C 2 AB 16x CSDGS SSGGSGSSGGSGSGSS GS 16 Protein expression and purification Syt 7 wild type (WT) extended linker with 2 residues (2x) extended linker with 4 residues ( 4x ) and extended linker with 16 residues ( 16x ) were expressed in E. coli purified using a glutathione affinity column and eluted following thrombin cleavage. 23 In order to remove contaminating nucleic acids and single domains from the C2AB tandem domain purifications, t he proteins were further purified via FPLC gel filtration chromatography on a Superdex 75 column (GE Healthcare, Piscataway NJ) in high salt buffer [ 140mM KCl, 25mM N (2 hydroxyethyl) piperazine N 2 ethanesulfonic acid (HEPES), 0.5M NaCl, 0.5mM MgCl 2 pH 7.4 ]. Protein purity was determined by SDS

PAGE 22

11 PAGE and absorbance at 280 nm in the same elution buffer. A 260/280 abs orbance ratio below 0.6 confirmed that protein is free of contaminat ing nucleic acids Sfp purification Sfp protein was expressed as a His 6 tagged protein carrying kanamycin resistance in E. coli and purified using a Ni NTA column. 24 Sfp purity confirmed by SDS PAGE and quantified with absorbance at 280 nm in Sfp labeling buffer (140 mM KCl, 0.5mM MgCl 2 15 mM NaCl, 50 mM L glutamic acid, 50 mM L arginine, 25 mM HEPES, pH 7.1). Labeling and purification of fluorescent labeled protein Flu orescent labeling reaction was performed using procedures developed by Yin and Walsh. 24 Alexa fluorophore CoA constructs ( A488 CoA, A555 CoA, A647 CoA ) were characterized by their maximum absorbance wavelength (495nm for the A488, 555nm for the A555, and 650nm for the A647) Sfp catalyzed protein labeling reaction performed with 2 protein concentration incubated with 4 Fluorophore CoA conjugate and 0.5 Sfp protein for 1 hr at room temperature in Sfp labeling buffer. Labeled protein was then concentrated using a 10,000 molecular weight cut off ( MWCO ) centrifugal concentrator (Amicon). Concentration of A488 labeled protein were determined by absorbance measurements of tryptophan and A488 SDS PAGE was employed to test for absence of fragmented protein and the resulting gel was imaged using a UV transilluminator (Bio Rad ChemiDoc XRS+). Preparation of phospholipid vesicles DOPC and DOPS in chloroform was mixed at a 3 to1 DOPC to DOPS ratio, dried under a stream of nitrogen, and then further dried under vacuum for 2 hrs. The dried

PAGE 23

12 lipids were then hydrated with liposome buffer ( 20 mM 2 mercaptoethanol, 0.14 M KCl, 25 mM HEPES, 15 mM NaCl, 0.5 mM MgCl 2 pH 7.4 ) Sonicated unilamellar vesicles (SUVs) were generated by sonicating the hydrated lipids using a Vibra Cells VCX130 sonicator. The SUVs were stored at 4 o C for up to 1 week before use. Sample preparation for single molecule experiment Glass coverslips (VWR) were soaked for 1 hr. in piranha solution (3:1 mixture of sulfuric acid to 30% hydrogen peroxide), extensively rinsed with MQ water, dried under a stream of N 2 and then stored in a dust free box to be used the same or the following day. A 60 uL perfusion chamber ( Invitrogen) was adhered to the cleaned cover slip. 3:1 DOPC:DOPS SUVs was mixed 1:1 with the bilayer deposition buffer (BDB) (1M NaCl in liposome bu ffer ) were injected into the perfusion chamber and incubated for 30 min. at room temperature. T he chambers were rinsed with MQ water then assay buffer ( 20 mM 2 mercaptoethanol and 0.2mM CaCl 2 in SMB). Samples are then imaged to test that background fluorescent contamination is negligible. TIRFM measurement TIRF excitation was achieved using 488 and 552 nm solid state lasers (3i) and images are collected with a Zeiss microscope built by 3i uti lizing a CCD camera (Nikon) at 20 frames/sec. To help focus and collect lipid diffusion, 1% rhodamine labeled lipid was added to a concentration of 100 ppb on the bilayer and focused using the 552 nm laser in TIRF mode. Streaming movies are acquired and an alyzed using Slidebook 5.0. D ata analysis carried out using Mathematica notebooks previously coded by the Knight lab (Wolfram Research) detailed in the following two sections

PAGE 24

13 Single particle tracking and analysis Trajectories for lipid and protein molecules were determined using the Particle Tracker plugin for ImageJ and a built in tracker for Slidebook The program determines the center position and intensity of each particle above the set intensity threshold in e ach frame and l inks them throughout the movie. Slidebook particle tracking Images w ere converted to Laplacian 2D movie with default parameters. The Mask option was used to change the maximum and minimum intensit y until the particles are clear or of desired quality. Minimum and maximum size for normal visualization of protein changed to 7 and 40 respectively for all the movies generated. Next the particle tracking plug in was utilized with the following settings: of 9 pixels, minimum pathlength for 6 or 7 timepoints. After the tracking is done, the Path Statistics and Object Statistics w ere calculated before transporting the notebook files to Mathematica. Single molecule diffusion analysis The trajectories were then imported to Mathematica where extremely bright or dim contaminants, spurious trajectories, and immobile particles are removed using a series of exclusion tests. The first test calculates the average intensity of each trajectory and removes contaminant trajectories that fail to meet minimum or maximum average intensity cutoffs Next the diffusion coefficient of each trajectory is calculated and trajectories are removed for wh ich the diffusion coefficients are either very low ( immobile ; ) or impossibly high (spurious trajectories ) The distribution of

PAGE 25

14 the rema ining step size values are then plotted and fit to the Rayleigh distribution (Equation 3 ) : r ) = ( 3 ) a probability density function where r represents the displacement (step size) and is the standard deviation, which is related to the diffusion constant D = ( 2 D ) 1/2 A residual plot is also calculated to analyze how the distribution of step sizes varies from this ideal distribution This method can also be used to fit step size data to the sum of two or three Rayleigh distributions, to account for possible multiple populations A second fitting method is also performed on the distribution of measured squared displacements (r 2 ) based on previous work by Schmidt et al 55 in this method, the cumulative probability distribution P(r 2 t ) of square displacement r 2 or gr e ater over a given time interval was plotted and fit to a 1 ( Equation 4 ) or 2 ( Equation 5 ) component model using these equations: P(r 2 ) = 1 ( 4 ) for 1 component and P(r 2 ( 5 ) for the 2 component where is the mean square displacement value and is the fraction exhibiting mean square displacement value 25 For simple two dimensional diffusion the mean square displacement is linearly related to as = 4 thus the constant D can be determined by fitting the least squares to a straight line 25 Only data that passed the exclusion tests of >2000 steps per movie are analyzed. The diffusion coefficient calculated are averaged for each cover slip and then altogether averaged for the spec ific linker length species.

PAGE 26

15 CHAPTER III RESULTS Diffusion coefficient of lipids Diffusion measurements for rhodamine labeled phospholipid bilayers are performed before the diffusion of the proteins themselves. This is to test both the fluidity of the membrane and to use as an exclusion factor when analyzing protein data. The diffusion coefficient of the fluorescent phos pho lipid (lissamine rhodamine B DOPE at 100 ppb) is measured to be 2.5 0.2 m 2 /s shown in Table 3. The resulting coefficient is used as a standard to test for consistency in lipid bilayers diffusion and is in agreement with previous report 25 The composi tion of the lipid bilayer is a 3:1 ratio of DOPC to DOPS sonicated to generate unilamellar vesicles. The addition of the 100 ppb rhodamine phospho lipid provides for better focusing to get into TIRF mode and measurements for consistency. The lipid diffusion coefficient actually had two components to it; a slow component and a fast component. The explanation for the slow component stems from slip offering a different viscosity factor than the top leaflet. Any thin layer of water trapped between the bottom leaflet and the cover slip starts to behave less like bulk water and more like confined and ordered water that markedly increases the viscosity of the bottom leaflet. 44 Essentially what happens is that the interaction between the bottom leaflet and the support creates asymmetry in translation diffusion between the two leaflets. 44 Thus any of the rhodamine labeled lipids that are in the bottom leaflet will show up as the slow component and the fast component consist of the upper leaflet; all lipids should have been washed away from the bulk fluid matrix above the supported bilayer or filtered out as too fast during the

PAGE 27

16 Mathematica calculations. The rhodamine labeled lipids excites at a high intensity with the 555 laser and shows up dimly when excited with the 488 laser, this allows Mathematica to filter out the diffusion contribution from rhodamine by setting a higher dim cutoff value. Diffusion measurements of isolated dom ains and wild type C2AB tandem domain The diffusion coefficient of the isolated C2A and C2B was obtained along with the wild type ( Table 3 ). Table 3. Summary of diffusion coefficients. Values compiled from experiments conducted on protein without impurities. Predicted diffusion used single domains values for calculation. Species D of AF 2 /s) 2 Lipid 2.46 0.17 ( 13 repeats) C2A 1.73 0.04 (4 repeats) C2B 1.59 0.04 (3 repeats) C2AB WT 1.03 0.01 (3 repeats) Predicted D based on additive friction 0.83 0.06 Predicted diffusion coefficient was obtained by finding the reduced average of the C2A and C2B domains : D predicted = (6)

PAGE 28

17 which is based on the additive diffusion coefficient equation ( Equation 2 ). By defining the diffusion of the tandem C2AB domain as related to the additive frictional coefficient of the C2A and C2B domains: D C2AB = (7) Substituting in D C2A and D C2B for the frictional coefficient term simplifies to: (8) which is just another form of the reduced average equation. The predicted diffusion coefficient 2 /s ) 2 0.06 2 /s ) 2 ] was calculated out to be 20% slower than the measured wild type diffusion coefficient [1.03 2 /s) 0.01] Different fluorophores (A555 and A647) were tested to see whether they would affec t the diffusion coefficient and was found to be within error of each other (data not shown). It was decided that since the predicted diffusion coefficient did not match the measured coefficient, the interaction of the tandem domain does not behave additively and could be interacting with eac h other. The additive frictional coefficient theory can be used to test the cooperative binding of the tandem domain by increasing the linker region. Two scenarios play ou t in ( Figure 3 ) Scenario 1 ; the two domains bind independently of each other and increasing the linker region will push the diffusion coefficient to the additive value and we measure the free draining limit range or Scenario 2 ; the two domains bind dependently with each other and increasing the linker region between the two domains will not change the diffusion constant. Based on the diffusion coefficient obtained, we can postulate whether the two C2A and C2B domains of Syt 7 in teract with each other cooperatively because

PAGE 29

18 they are tethered to each other by the linker or through other interaction. We can test this by varying the linker length between the C2A and C2B domains. Figure 4 The two options for when linker region is increased. From left to right: W ild type increases in linker to 4x and then to 16x residues. Option one shows independent interaction and option 2 shows depending interaction. Mutagenesis and expression of Syt7 C2AB linker extension variants Synaptotagm in 7 wild type tandem domain s contain a seven residue linker between its C2A and C2B domains. In order to test whether this short linker holds the two domains too close together to meet the free draining limit, engineered protein mutants were purified including linkers extended by 2, 4, and 16 flexibl e amino acids, namely serine and glycine residues ( Table 2 ). Insertion o f the 2x linker length was performed on the wild type DNA to such that the reading frame will encode for two serine residues. The insertion for the 4x linker w as performed on the 2x specie, insert ing the sequence GGG AGC which encodes for glycine and serine residue (GS) upstream from the two serine residue inserted in 2x. The 16x insertion ( TGG TGG CAG CGG TAG TTC CGG AGG CTC AGG TAG CGG CTC GAG T ) was performed on the 2x specie where the sequence encoding for 14 residue s was inserted downstream from the two serine residue in the 2x specie.

PAGE 30

19 Purification and characterization of SFP SFP protein purified by Ni NTA column FPLC is shown how concentrated and pure the protein in Figure 5 Only fraction 1 5 was kept for use. The left most lane containing the flowthrough shows an absence of the SFP protein band that is present in the before filtration (BF) and after filtration (AF) lane s this indicates that all of the Sfp protein was bound to the column and eluted out into each of the fractions obtained. The concentratio n of each fraction was found to be on average of 450 M from a 280 nm absorbance test (data not shown). Figure 5 14% SDS PAGE gel of purified SFP protein. Marked lanes from right to left goes as; FT flow through, Marker mass marker, AF After filtration, BF before filtration. AF and BF are lanes of SFP before filtration with a 0.20 m cellulose acetate membran e. All other lanes are different fractions collected from the FPLC. Purification and characterization of Syt 7 protein s Originally the protein purification method for Syt 7 tandem domains yielded contamination from DNA and fragmentation of the tandem domain. DNA contamination was believed to be due to the tandem domain binding to the DNA with enough affinity to resist a high salt wash prior to the thrombin cleavage. Fragmentation of the protein was

PAGE 31

20 encountered across all constructs but more apparent in the 16x variant due to the added residues aggregation more likely to occur with the flexible linker. A gel filtration was used to dist inguish the contaminants based on size ; DNA bound protein elutes before the DNA free version. The absorbance spectra in Figure 6 details the low absorbance value at 260nm, showing that DNA contamination in the protein stocks are low enough to be negligible. Figure 6 Absorbance spectra of gel filtrated protein. The light blue line represents the 16x linker, red line as the WT, and dark blue as the 4x. Absorbance at 260 nm for WT, 4x, and 16x are, in that order: 0.20608, 0.19512, 0.26491. Absorbance at 280 nm for WT, 4x and 16x are, in that order: 0.30326, 0.24008, 0.37603. Along with UV Vis spectra, the labeled proteins were characterized with SDS PAGE gel ( Figure 7 ) Syt 7 WT, 4x, and 16x bands appeared approximately at 35 kDa region. The absence of smaller kDa ba nds suggests that only one fluorescent protein is present in each lane The SDS PAGE gel was imaged with UV light because the A488 attached to the protein emits in the visible region. This allows us to determine any

PAGE 32

21 fluorescent contaminants within the protein stock. Ideally all the protein in the protein stock should be labeled, however unlabeled protein would not fluoresce under TIRF so removal of unlabeled proteins was not required. Figure 7 15% SDS PAGE gel of fluorescent labeled proteins. Imaged using UV light, right most lane contain fluorescent mass marker. Bands colored green for clearer distinction. TIRFM experiments Diffusion coefficient of increased linker Diffusion coefficient for Syt 7 4x and 16x are calculated and shown on Table 4 The data for the different linker length s were performed on the same day with different coverslips. The addition of fluorescent protein in a solution of 20uM Ca 2+ generates an image with fluorescent particle ( Figure 8 ) given the microscope is in TIRF mode. A488 labeled protein was found to be less stable than A55 labeled protein and photobleach at a much faster rate, hence the power setting of the 488 nm laser was turned down to

PAGE 33

22 optimize diffusion measurements. Some particles were observed with high mobility and some random spots that pop in and out of focus these signals are filtered out in t he Mathematica calculations. Table 4. Summary of diffusion coefficients with linker extension. Values compiled from experiments conducted on protein without impurities. An adaptation of Table 3 with extended linker length data. Species D of AF 488 fusion 2 /s) 2 Lipid 2. 46 0. 17 ( 4 repeats ) C2AB WT 1.03 0.01 (3 repeats) C2AB 4x 0.98 0.01 (4 repeats) C2AB 16x 0.96 0.03 (5 repeats) Predicted D based on additive friction 0.83 0.06 Figure 8. Representative images of fluorescent protein binding to lipid bilayer. All of the lipid bilayers are consisted of 3:1 DOPC to DOPS with a protein concentration varying from 50 100 pM. The fluorophore imaged is A488 with the 488 nm laser. Exposure time for all panels was 20 ms.

PAGE 34

23 The diffusion coefficient of each Syt 7 4x and 16x specie is calculated within Mathematica with two different analytical methods ( Figure 9 ). Figure 9. Mathematic analysis plots of Syt 7 4x and 16x diffusion coefficient. ( A1 ) Representative probability dis tribution function used in the Rayleigh method for the 16x linker length specie. ( A2 ) Representative probability distribution function calculated by the Rayleigh method for the 4x linker le ngth specie. ( B1 ) Cumulative distribution plot of the square displacement for the 16x linker length from one representative movie. Solid line represents the best fit to a double exponential distribution. ( B2 ) Cumulative distribution plot of the square displacement for the 4 x linker length from one representative movie. Solid line represents the best fit to a double exponential B2 A1 B 1 A 2 C 1 C2

PAGE 35

24 distribution. ( C1 ) Plot of mean square displacement vs. time interval for 16x linker length bound to lipid bilayer. ( C2 ) Plot of mean square displacement vs. time interval for 4x linker length bound to lipid bilayer. The diffusion coefficient for both the 4x and 16x linker lengths fall within error of each other and less than 1 0% within the range of the wild type This suggests that the interaction between the C2A and C2B domain is not due to the linker enforcing a hydrodynamic effect

PAGE 36

25 CHAPTER IV DISCUSSION TIRF measurements Diffusion measurement of the 4x and 16x linker lengths on supported lipid bilayer shows that the C2A and C2B tandem domain behave the same regardless of the linker region Based on the frictional coefficient of the isolated C2A and C2B domain s, the predict ed diffusion coefficient for the tandem domain should be 2 /s) 2 if the coefficients are additive. The diffusion coefficient measured for both the wild type C2AB 2 /s) 2 2 /s) 2 2 /s) 2 ] do not match the predicted coefficient meaning that they are not additive. Here are some of the plausible explanations for non additive frictional coefficient: 1) Both the C2A and C2B domain bind independantly to the supported lipid bilayer with the same penetration depth and orientation, but due to the short linker they are within the free draining limit thus the diffusion is affected by the hydrodynamic effect. 2) The C2A and C2B are constrained by the short linker length such that they do not bind to supported lipid bilayer with the same penetration and orientation thus leading to different frictional coefficient. 3) The C2A and C2B domain interact with each other when bound to the supported lipid bilayer in such a way that keeps them within the free draining limit despi te the elongated linker length.

PAGE 37

26 The data obtained from expansion of the linker length supports the third explanation that the two C2 domains of Syt 7 somehow interact with each other when bound to lipid membrane. Originally the linker length for Syt 7 C2AB wild type is 7 residue long, by inserting 16 residue s domains. This increased in linker length then allows for each of the domain to separate and approach the free draining limit and l owers the possibility of a hydrodynamic effect happening. However, it should be noted that although the length between the tandem domains has increased, the actual length is unquantifiable due to the flexibility of the glycine and serine residues. In part icular, if there are interactions between C2A and C2B that are mediated by attractive forces other than the linker itself, then the flexible extended linker can bend to accommodate this C2A C2B interaction (Refer to Figure 4 ). Implication of the cooperativity between the C2 domains The measured diffusion coefficient remains the same for the Syt 7 tandem C2 domains despite the increase in linker length suggests that the C2 domain interact with each other in a cooperative fashion. This interaction could be due to a few factors; hydrophobic interactions and /or electrostatic interactions between the two domains the C2AB tandem domain bind differently to the lipid membrane than isolated domains To test for the hydrophobic interacti ons, point mutations of conserved hydrophobic regions of both domains can help identify the area of interactions. Addition of a chaotropic agents would also help weaken any hydrophobic interactions between the two domains. This method would also help eluci date the structure that the C2A and C2B form when bound to membrane, a question that is difficult to answer for both Syt 7 and

PAGE 38

27 Syt 1. To test for the electrostatic interactions, different salt concentrations could be added to weaken the interaction between the two domains. For Syt 1, it has already been shown that the C2AB tandem domain penetrates deeper into the lipid bilayer than the isolated C2A and C2B domains. 19 This would lead to a breakdown in the predicted diffusion coefficient since the values for frictional forces felt by the tandem domain would be different than isolated domains. For Syt 7, this kind of phenomenon has not been explored. Clarifications of these interactions should lead to a better binding model of Syt 7.

PAGE 39

28 CHAPTER V CONCLUSIONS This study shows that variation of the linker length of up to 16 residues does not affect the diffusion coefficient of the Syt 7 C2 tandem domain when they are binding to a supported bilayer. Therefore the two C2 domains of Syt 7 must be interacting with each other in such a way that is dependent rather than independent of each other. The study has also shown the value of TIRFM in measuring and elucidating the physical characteristic of a protein and lipid system. Further experi ments should be performed exploring this dependency of the two C2 domains and how it affects their binding affinity to the lipid bilayer. Variation of the phospholipid head groups would also server to further probe the affinity of each of the C2 domains. A probe into the possible electrostatic and/or hydrophobic interaction between the two C2 domain will help better understand the conformational changes that Syt 7 C2 domain undergo during exocytosis. Membrane curvature experiments could also be performed t o test the changes in affinity towards curved and planar membranes.

PAGE 40

29 REFERENCES 1. Moghadam, P. K., Jackson, M. B. The functional significance of synaptotagmin diversity in neuroendocrine secretion. Frontiers in Endocrinology (2013) 4 ( 124 ) : 1 7. 2. Craxton M. A manual collection of Syt, Esyt, Rph3a, Rph3al, Doc2, and Dblc2 genes from 46 metazoan genomes an open access resource for neuroscience and evolutionary bilogy. BMC Genomics (2010) ( 11 ) : 37 3. Fukuda M, Sagi Eisenber R. Confusion in the nomenclature o f synaptotagmin V and IX. Calcium Bind Proteins (2008) 3: 1 4 4. Fukuda M. Synaptotagmins, Ca2+ and phospholipid binding proteins that control Ca2+ regulated membrane trafficking. Recent Res Devel Chem Phys Lipids (2003) 1: 15 51 5. Sudhof T. C. Synaptotag mins, why so many? J Biol Chem (2002) 277: 7629 7632 6. Gauthier, B. R., and Wollheim, C. B. Synaptotagmins bind calcium to release insulin. Am. J. Physiol. Endocrinol. Metab. (2008) 295: E1279 1286. 7. Gao, Z., Reavey Cantwell, J., Young, R. A., Jegier P., and Wolf, B. A. Synaptotagmin III/VII isoforms mediate Ca2+ induced insulin secretion in pancreatic islet beta cells. J. Biol. Chem. (2000) 275, 36079 36085. 8. Gustavsson, N., Lao, Y., Maximov, A., Chuang, J. C., et al. Impaired insulin secretion an d glucose intolerance in synaptotagmin 7 null mutant mice. Proc Natl Acad Sci USA (2008) 105:3992 7. 9. Chapman, E. R. How does Synaptotagmin trigger neurotransmitter release? Annual Review of Biochemistry ( 2008 ) 77:615 41. 10. Brandt, D. S., Coffman, M. D. Falke, J. J., Knight, J. D. Hydrophobic contributions to the membrane docking of synaptotamin 7 C2A domain: Mechanistic contrast between Isoforms 1 and 7. Biochemistry ( 2012 ) 51: 7654 7664 11. Nalefski EA, Wisner MA, Chen JZ, Sprang SR, Fukuda M, et al. C 2 domains from different Ca2+ signaling pathways display functiona l and mechanistic diversity Biochemistry (2001) 40:3089 100. 12. Reist, N. E. and co. Membrane Penetration by Synaptotagmn is required for coupling calcium binding to vesicle fusion in vivo Journal of Neurosceince ( 2011 ) 31: 2248 2257.

PAGE 41

30 13. Perisic, O., Paterson, H. F., Mosedale, G., Lara Gonzalez, S., and Williams, R. L. Mapping the phospholipid binding surface and translocation determinants of the C2 domain from cytosolic phospholipase A2, J. Biol. Chem. (1999) 274 14979 14987. 14. Nalefski, E. A., and Falke, J. J. (1998) Location of the membranedocking face on the Ca2+ activated C2 domain of cytosolic phospholipase A2, Biochemistry (1998) 37 17642 17650 15. Frazier, A. A., Wisner, M. A., Malmberg, N. J., Victor, K. G., Fanucci, G. E., Nalefski, E. A., Falke, J. J., and Cafiso, D. S. (2002) Membrane orientation and position of the C2 domain from cPLA2 by site directed spin labeling. (The erratum appears in Biochemistry (2002) Jun 11, 41 75 28.), Biochemistry 41 6282 6292 16. Malmberg, N. J., Van Buskirk, D. R., and Falke, J. J. Membrane docking loops of the cPLA2 C2 domain: detailed structural analysis of the protein membrane interface via sitedirected spin labeling, Biochemistry (2003) 42 1 3227 13240 17. Corbin, J. A., Evans, J. H., Landgraf, K. E., Falke, J. J. Mechanism of specific membrane targeting by C2 Domains: Localized pools of Target Lipids enhance Ca 2+ Affinity. Biochemistry ( 2007 ) 46:4322 4336 18. Damer, C. K. and Creutz C. E. Synergistic membrane interactions of the two C2 domains of synaptotagmin. J. Biol. Chem (1994) 49:31115 31123 19. Herrick, D.A., Sterbling, S., Rasch, K. A., Hinderliter, A., Cafiso, D. S. Position of synaptotagmin I at the membrane interface: Coope rative interactions of tandem C2 domains. Biochemistry ( 2006 ) 45:9668 9674 20. Cafiso, D. S. and co. Solution and membrane bound conformations of the tandem C2A and C2B domains of synaptotagmin 1: evidence for bilayer bridging. J. Mol. Biol. ( 2009 ) 390:913 923. 21. Knight, J.D., Lerner, M. G., Marcano Valazquez, J. G., Pastor, R. W., Falke, J. J. (2010) Single Molecule Diffusion of Membrane Bound Proteins: Window into Lipid Contacts and Bilayer Dynamics, Biophysical Journal (2010) 99: 2879 2887. 22. Axelr od, D. Total internal reflection fluorescent microscopy in cell biology. Biophotonics (2003) 361B: 1 33. 23. Corbin, J. A ., R. A. Dirkx, and J. J. Falke GRP1 pleckstrin homology domain: activation parameters and novel search mechanism for rare target lipid Biochemistry (2004) 43: 16161 16173.

PAGE 42

31 24. Yin, J., Lin, A. J. G olan, D. E. & C. T. Walsh. Site specific protein labeling by Sfp phosphopantetheinyl transferase. Nature Protocols (2006) 1: 280 285. 25. K night, J. D., Falke, J. J. Single Molecule Fluorescence Studies of a PH Domain: New Insights into the Membrane Docking Reaction. Biophysical Journal (2009) 96: 566 582. 26. Rubin, R. P. The role of calcium in the release of neurotransmitter substances and hormones. Pharmacol. Rev (19 70) 22: 389 428 27. Grodsky, G. M. and Bennett, L. L. Cation requirements for insulin secretion in the isolated perfused pancreas. Diabetes (1966) 15: 910 913 28. Johansson, H., Gylfe E. and Hellman, B. The actions of arginine and glucose on glucagon secretion are mediated by opposite effects on cytoplasmic Ca2+. Biochem. Biophys. Res. Commun. (1987) 147: 309 314 29. Gromada, J., Franklin, I. and Wollheim C. B. Alpha cells of the endocrine pancreas: 35 years of research but the enigma remains. Endocr. Rev (2007) 28: 84 116 30. Bai J, Wang CT, Richards DA, Jackson MB, Chapman ER. Fusion pore dynamics are regulated by synaptotagmin*t SNARE interactions. Neuro n ( 2004 ) 41(6):929 42. 31. Sutton RB, Fasshauer D, Jahn R, Brunger AT. Crystal structure of a SNARE complex involved in synaptic exocytosis at 2.4 A resolution. Nature ( 1998 ) 395 (6700): 347 53. 32. Perin, M. S., Fried, V. A., Mignery, G. A., Jahn, R. and Sudhof, T. C. Phospholipid binding by a synaptic vesicle protein homologous to the regulatory region of protein kinase C. Nature (1990) 345, 260 263 33. Sudhof, T. C. and Rizo, J. Synaptotagmins: C ¨ 2 domain proteins that Neuron (1 996) 17: 379 388 34. Rizo, J. and Sudhof, T. C. C2 domains, structure and function of a universal Ca2+ binding domain. J. Biol. Chem (1998) 273, 15879 15882 35. Sugita, S., Shin, O. H., Han, W., Lao, Y. and Sudhof, T. C. Synaptotagmins form a hierarchy of exocy totic Ca 2+ sensors with distinct Ca 2+ affinities. EMBO J. (2002) 21, 270 280 36. Gustavsson N, Han W. Calcium sensing beyond neurotransmitters: functions of synaptotagmins in neuroendocrine and endocrine secretion. Biosci Rep ( 2009 ) 4 : 245 59.

PAGE 43

32 37. Rizo J, Chen X Ara D. Unraveling the mechanisms of synaptotagmin and SNARE function in neurotransmitter release. Trends Ce ll Biol. (2006) 7: 339 50. 38. Fuhrmans M, Mller M. Mechanisms of vesicle spreading on surfaces: coarse grained simulations. Langmuir ( 2013 ) 13 : 4335 49. 39. Jahn R, Fasshauer D. Molecular machines governing exocytosis of synaptic vesicles. Nature ( 2012 ) 490 (7419): 201 7. 40. Perin MS, Fried VA, Mignery GA, Jahn R, Sdhof TC. Phospholipid binding by a synaptic vesicle protein homologous to the regulatory region of protein kinase C. Nature ( 1990 ) 345 (6272): 260 3. 41. Desai RC, Vyas B, Earles CA, Littleton JT, Kowalchyck JA, Martin TF, Chapman ER. The C2B domain of synaptota gmin is a Ca(2+) sensing module essential for exocytosis. J Cell Biol ( 2000 ) 150 (5): 1125 36. 42. Bai J, Wang P, Chapman ER. C2A activates a cryptic Ca(2+) triggered membrane penetration activity within the C2B domain of synaptotagmin I. Proc Natl Acad Sci US A ( 2002 ) 99 (3): 1665 70. 43. Hui E, Bai J, Chapman ER. Ca2+ triggered simultaneous membrane penetration of the tandem C2 domains of synaptotagmin I. Bio phys J (2006) 91 (5):1767 77. 44. Camley B, Brown F.Diffusion of complex objects embedded in free and s upported lipid bilayer membranes: role of shape anisotropy and leaflets structure. Soft Matter. ( 2013 ) 9: 4767 45. Henle ML, Levine AJ. Hydrodynamics in curved membranes: the effect of geometry on particulate mobility. Phys Rev E Stat Nonlin Soft Matter Phys ( 2010 ) 81(1 Pt 1): 011905. 46. Vaz WL, Clegg RM, Hallmann D. Translational diffusion of lipids in liquid crystalline phase phosphatidylcholine multibilayers. A comparison of experiment with theory. Biochemistry ( 1985 ) 24 (3): 781 6. 47. Peters R, Cherry RJ. Lateral and rotational diffusion of bacteriorhodopsin in lipid bil ayers: experimental test of the Saffman Delbrck equations. Proc Natl Acad Sci US A (1982) 79 (14): 4317 21 48. Vaz WL, Criado M, Madeira VM, Schoellmann G, Jovin TM. Size dependence of the translational diffusion of large integral membrane proteins in liquid crystalline phase lipid bilayers. A study using fluorescence recovery after photobleaching. Biochemistry ( 1982 ) 21 (22): 5608 12

PAGE 44

33 49. Falck E, Rg T, Karttunen M, Vattulainen I. Lateral diffusion in lipid membranes through collective flows. J Am Chem Soc ( 2008 ) 130(1): 44 5. 50. Prasad, A., J. Kondev, and H. A. Stone Drift in supported membranes. Phys. Fluids (2007) 19: 113103 51. Klauda, J. B., B. R. Brooks, and R. W. Pastor Dynamical motions of lipids and a finite size effect in simulations of bilayers. J. Chem. Phys (2006) 125: 144710 144718. 52. Gauthier BR, Duhamel DL, Iezzi M, Theander S, Saltel F, Fukuda M, Wehrle Haller B, Wollheim CB. Synaptotagmin VII splice variants alpha, beta, and delta are expressed in pancreatic beta cells and regulate insuli n exocytosis. FASEB J (2008) 22 (1): 194 206 53. Sugita S, Han W, Butz S, Liu X, Fernndez Chacn R, Lao Y, Sdhof TC. Synaptotagmin VII a s a plasma membrane Ca(2+) sensor in exocytosis. Neuron (2001) 30 (2): 459 73 54. Brandt DS, Coffman MD, Falke JJ, Knight JD. Hydrophobic contributions to the membrane docking of synaptotagmin 7 C2A domain: mechanistic contrast between isoforms 1 and 7. Biochemistry ( 2012 ) 51(39): 7654 6 4. 55. Sonnleitner A, Schtz GJ, Schmidt T. Free Brownian motion of individual lipid molecules in biomembranes. Biophys J ( 1999 ) 77 (5): 2638 42.