Citation
The effects of sonic hedgehog inhibition on cell cycle kinetics in the developing tongue

Material Information

Title:
The effects of sonic hedgehog inhibition on cell cycle kinetics in the developing tongue
Creator:
Liggins, Casandra
Publication Date:
Language:
English
Physical Description:
x, 63 leaves : illustrations ; 28 cm

Subjects

Subjects / Keywords:
Sonic hedgehog homolog ( lcsh )
Taste buds ( lcsh )
Cell cycle ( lcsh )
Contact inhibition (Biology) ( lcsh )
Genre:
bibliography ( marcgt )
theses ( marcgt )
non-fiction ( marcgt )

Notes

Bibliography:
Includes bibliographical references (leaves 59-63).
General Note:
Department of Integrative Biology
Statement of Responsibility:
by Casandra Liggins.

Record Information

Source Institution:
|University of Colorado Denver
Holding Location:
|Auraria Library
Rights Management:
All applicable rights reserved by the source institution and holding location.
Resource Identifier:
71754698 ( OCLC )
ocm71754698
Classification:
LD1193.L45 2006m L53 ( lcc )

Full Text
THE EFFECTS OF SONIC HEDGEHOG
INHIBITION ON CELL CYCLE KINETICS IN
THE DEVELOPING TONGUE
Casandra Liggins
B.S., University of Colorado, 2002
A thesis submitted to the
University of Colorado at Denver
in partial fulfillment
of the requirements for the degree of
Master of Science
by
Biology
2006


This thesis for the Master of Science
degree by
Casandra Liggins
has been approved
by
ami!
Linda Barlow
Date
Charles Ferguson


Liggins, Casandra (M.S., Biology)
The Effects of Sonic Hedgehog Inhibition on Cell Cycle Kinetics in
the Developing Tongue
Thesis directed by Dr. Lisa Johansen
ABSTRACT
Shh is a diffusible factor that regulates many embryonic events,
including development of taste papillae in rodents. Inhibition of Shh
in embryonic tongue explants results in more and larger taste papillae
(Hall et al., 2003; Mistretta et al., 2003); yet the cellular mechanism(s)
underlying these morphological changes is unknown. Shh stimulates
both cell survival and cell proliferation in the branchial arches, which
give rise to the tongue epithelium and subepithelial mesenchyme, and
thus may influence mitosis and cell death in developing taste papillae.
To test this hypothesis, tongue explants were cultured from embryonic
day (E) 11.5, prior to papilla formation, exposed to Shh function-
blocking antibody or control medium for 3 days, and then processed
to visualize both taste papillae and cells undergoing mitosis or
apoptosis. We found virtually no apoptotic cells in the developing
tongue during the time when taste papillae are patterned. While


treated with Shh function blocking antibody and control tongues. In
contrast, dividing cells were encountered within developing taste
papillae, both in the epithelium and mesenchyme of these structures.
Additionally, blocking Shh appears to increase the cell proliferation in
the taste papillae, when compared with the level of mitosis in control
papillae. While this outcome is consistent with an increase in papillae
size when Shh is blocked, it is in stark contrast to normal Shh
function, i.e., Shh typically stimulates proliferation. We are currently
investigating how inhibition of Shh causes increased proliferation.
This abstract accurately represents the content of the candidates
thesis. I recommend its publication.
Signed


DEDICATION
I dedicate this thesis to Chad whose constant encouragement,
overwhelming support and love has given me the strength to continue
to reach for my dreams.


ACKNOWLEDGEMENT
My thank you to my captain, Lisa Johansen, for your advice and
support during this thesis completion. I also wish to thank Linda
Barlow for assistance in her lab over the past two years. Finally, my
appreciation to Charles Ferguson for being the rock that my future is
built on.


CONTENTS
Figures.................................................27
CHAPTER
1. INTRODUCTION.................................. 11
2. MATERIALS AND METHODS..........................18
Animals......................................18
Embryo Tongue Collection................... 18
Tongue Explant Cultures......................19
Shh In Situ Hybridization....................21
Anti-Shh Immunofluorescence..................23
Phosphorylated Histone 3 / Activated Caspase 3
Immunofluorescence...........................23
Glil, 2, 3 RT-PCR........................... 25
Image Acquisition............................26
Data Acquisition.............................26
3. RESULTS........................................28
Spatio-temporal expression of Shh in developing taste
papillae.....................................28
Vll


Shh inhibition on tongue explants in vitro results in more
papillae that are larger............................29
Control levels of proliferation in vivo.............30
Control levels of apoptosis in vivo.................31
Effects on proliferation of Shh inhibition in vitro.32
Effects of apoptosis from Shh inhibition in vitro...33
Confirmation of Gli transcription factors via
RT-PCR............................................. 34
4. DISCUSSION.............................................36
Shh as a tool to visualize papillary development....36
Inhibition of Shh results in altered tongue morphology
and papillary pattern...............................37
Shh inhibition increases the rate of proliferation within
the cells associated with developing papillae.......39
Shh inhibition has no effects on programmed cell death
in cells associated with developing papillae........40
5. REFRENCES..............................................59
viu


FIGURES
Figure
1. Characterization of cells surrounding papillae............27
2. SEM of adult rodent tongue displaying lingual papillae....43
3. Taste papillae house taste buds...........................44
4. Development of rodent lingual taste buds..................45
5. Shh signaling pathway.................................... 46
6. Shh spatiotemporal expression via In Situ Hybridization...47
7. Shh spatiotemporal expression via Shh
immunofluorescence.........................................48
8. Shh inhibition in vitro results in more papillae that are larger
and closer together........................................49
9. Effects of Shh inhibition on the number and size of fungiform
papillae...................................................50
10. Control levels of proliferation in vivo..................52
11. Control levels of apoptosis in vivo......................53
12. The effects of Shh inhibition on proliferation in vitro..54
13. The effects of Shh inhibition on proliferating cells associated
with papillae..............................................55
IX


14. The effects of Shh inhibition on dying cells in vitro
56
15. Effects of Shh inhibition on apoptotic cells associated with
fungiform papillae..........................................57
16. Gli transcription factors RT-PCR in embryonic tissue.......58
x


CHAPTER 1
INTRODUCTION
Taste, one of the five senses, is responsible for transduction of the
chemical stimuli, which provides information about nutrition and toxins; and thus
is key for survival. The primary gustatory sensory organ, the tongue, has an array
of epithelial specializations, termed taste papillae. In mammals, there are three
distinct types of papillae: fungiform, foliate, and circumvallate (Figure 2).
Fungiform papillae form in parasagittal rows on the anterior portion of the tongue.
Mice have a single midline circumvallate papilla, whereas humans have multiple
circumvallate papillae, which form on the midline at the oral-pharyngeal boarder
of the tongue. The foliate papillae are vertical folds and grooves located on the
extreme posterior-lateral surface of the tongue, just anterior to the oral-pharyngeal
border. Taste papillae house multicellular chemoreceptor organs called taste buds
(Figure 3), which are innervated by three cranial nerves (VII, IX and X), that
project to hindbrain gustatory centers. Taste buds arise from early signals within
the pharyngeal endoderm (Parker et al. 2004), which drive some cells to later
differentiate into taste buds; a process found to be independent of innervation
(Barlow et al., 1996; Barlow and Northcutt, 1997; Hall et al., 2003; Mbiene and
Roberts, 2003; Nosrat et al., 2001).
11


Development of rodent lingual taste buds begins when taste papillae form
in a characteristic spatial and temporal pattern in the embryonic tongue (Figure 4).
Taste development can be divided into 3 main stages; placode formation, papillae
morphogenesis and taste bud differentiation. Thickening of the prepapillary
epithelium, placode formation, occurs from El 1.5-El2.5. At El 1.5 the tongue
emerges as two lateral lingual swellings on the dorsal aspect of the lower jaw. As
the embryo progresses to El2.5, the lateral lingual swellings grow and fuse at the
midline, the tongue then lengthens and separates at its ventral surface from the
lower jaw. The taste placodes begin to thicken and are evident in parasagittal
rows, indicating the location of future taste buds. Papillae become distinguishable
from the surrounding epithelium during papillae morphogenesis, during which,
the placode epithelium grows into a raised structure with a mesenchymal core;
this occurs from El 3.5-El 7.0. During later papilla morphogenesis, nerves invade
the papillary mesenchymal core and contact the epithelium. At E17.0, taste
papillae are fully formed, and immature taste buds are evident. However, taste
buds are not fully differentiated until several days after birth (Mistretta, 1991).
The presence of taste buds can be detected using antiserum against a taste specific
G-protein, gustducin (Lindemann, 2001). In this thesis, I investigate the earliest
phase of taste development, placode formation and papillary patterning.
Because both amphibian taste buds and rodent taste papillae develop
independently of innervation (Barlow et al., 1996; Hall et al., 2003; Mbiene and
12


Roberts, 2003; Nosrat et al., 2001), this implies that development of taste organs
is instead dependent on mechanisms intrinsic to the tongue. It has been
previously noted in the axolotl that cell-cell contacts within the pharyngeal
endoderm control taste bud patterning; if these contacts are disrupted during a
critical period an increase in taste buds ensue (Parker et al., 2004). One signaling
pathway that has been implicated in mouse taste papillae patterning is the Sonic
Hedgehog (Shh) pathway. Shh is a member of the Hedgehog (Hh) protein family
of signaling molecules. Hh was originally identified as a Drosophila segment
polarity gene required for embryonic patterning (Nusslein-Volhard and
Wieschaus, 1980), and is highly conserved among vertebrate species including
human, rat, chicken, Xenopus, axolotl and zebrafish (Hammerschmidt et al.,
1997). Three mammalian homologues of Hh have been identified: Indian
hedgehog (Ihh), Desert hedgehog (Dhh) and Sonic hedgehog (Shh). Previous
studies have linked Shh signaling to roles in cell proliferation and differentiation,
embryonic pattern formation and adult tissue homeostasis. Shh has also been
linked to cancer with pathological roles in tumor initiation and growth (Matise
and Joyner, 1999; Lum and Beachy, 2004).
The Shh pathway is activated when Shh, a secreted ligand, interacts with a
transmembrane receptor, Patched (Ptc) (Figure 5). In the absence of Shh, Ptc
suppresses the activity of the seven transmembrane protein Smoothened (Smo).
When Shh binds Ptc the suppression of Smo is removed, allowing transcription of
13


downstream target genes via the cubitus interruptus (ci) transcription factor, in
Drosophila, whose mammalian homologue are the Gli transcription factors. The
Gli family of zinc finger transcription factors (Dominguez et al., 1997; Hepker et
al., 1997) contains the mouse homologues Glil, Gli2 and Gli3 (Hui et al., 1994).
The three Gli transcription factors have individual roles with respect to
their interaction with Shh, as well as with each other. The roles of Gli genes in
development show that at early stages, all three Gli genes are often expressed
broadly, becoming restricted to specific cell types and spatial domains later in
development (Platt et al., 1997). Using the Drosophila Ci protein processing as a
model, the Gli proteins have been tested for separate functional domains (Matise
and Joyner, 1999). While Gli2 and Gli3 have been found to be required for
development and for Shh signaling, mice lacking the Glil allele do not appear to
have defects in development or viability (Bai et al., 2002). Glil does not appear
to possess an N-terminal repressor domain and therefore only functions as an
activator of transcription (Dai et al., 1999; Park et al., 2000). In contrast, Gli2 and
Gli3 contain both repressor and activator domains on their N- and C termini,
respectively (Dai et al., 1999; Sasaki et al., 1999). Previous studies have shown
that loss of Gli2 function results in defective Shh signaling in the floor plate of the
neural tube and other tissues (Mo et al., 1997; Ding et al., 1998; Matise et al.,
1998). In contrast, loss of Gli3 results in dorsal brain defects and limb
polydactyly, which are associated with ectopic activation of the Shh pathway and
14


therefore suggests that Gli3 acts primarily as a repressor in the Shh pathway (Hui
and Joyner, 1993; Masuya et al., 1997; Buscher et al., 1997). However, upon
evaluation of their effects with in vitro assays, Gli2 has been shown to act
primarily as an Hh-dependent activator, while Gli3 acts predominantly as a
repressor (Masuya et ah, 1997; Bai et al., 2004). Although Glis 1,2,3 have been
characterized in the palatal tongue mesenchyme at E13-E14.5 (Rice et al., 2005),
as well as in many developmental systems and processes, the role of the Gli
transcription factors within taste development is not understood.
Shh has been thought to be involved in the initial establishment of taste
development including: specifying cell fate and papillary patterning, mediating
epithelial-mesenchymal interactions and directing papillary growth (Hall et ah,
1999, 2003; Mistretta et al., 2003; Liu et ah, 2004). In mice, Shh expression
begins diffusely throughout the lingual epithelium at El 1.5, becoming focal in the
taste placodes at E12.5 (Hall et ah, 1999). When evaluating the role of the Shh
signaling pathway in papillary development, previous researchers have inhibited
Shh signaling in vitro with 5E1, an anti-Shh function blocking antibody. Shh
inhibition results in more papillae that are larger, as well as the formation of
papillae in the interpapillary epithelium (Hall et ah, 2003; Mistretta et ah, 2003;
Liu et ah, 2004). One of the Shh signaling pathway transcription factors, Glil,
has also been implicated in taste papillae development. Glil is expressed broadly
throughout the early tongue primordium at El2 and is localized progressively to
15


taste papillae at E14.5 (Hall et al., 1999). The other transcription factors involved
in Shh signaling, Gli2 and Gli3, have not been investigated in the taste system
therefore, their potential role in papillae patterning also has yet to be elucidated.
Taste buds are maintained by a continual turnover of cells, even in
adulthood. Cell maintenance via proliferation and apoptosis has been investigated
in postnatal taste buds. Adult taste buds contain 50-100 cells, which have an
average life span of 10 days and are continuously differentiated from epithelial
precursor cells (Beidler and Smallman, 1965). The epithelial cells surrounding
taste buds are proposed to include taste bud progenitors for the supply and
proliferation of new cells (Beidler and Smallman, 1965). The vallate taste cells of
adult mice have a life span of 12.5 days (Ganchrow et al., 1991) and only a few
taste buds with apoptotic nuclei are seen in normal taste buds (Takeda et al.,
1996). However, the details of proliferation and apoptosis during embryonic
development of taste organs are not at all defined. While robust levels of
proliferation have been seen in the developing tongue mesenchyme at El 2-El 4
(Nie, 2005), previous studies have indicated no proliferation occurring in taste
papillae during normal embryogenesis (Miura et al., 2003; Mbiene and Roberts,
2003; Farbman and Mbiene, 1991). Upon initial investigation, we have identified
proliferating cells.in the epithelium and mesenchyme of the tongue at El 1.5, as
well as within the papillary epithelium of the developing tongue between E12.5-
E13.5. In contrast, previous studies have found negligible levels of apoptosis at
16


early stages of tongue development (El 1-El 5) increasing to low levels at late
stages of tongue development, El 6-El 8, isolated to the upper epithelial layers
(Nie, 2005).
Thus, while we know that Shh inhibition in cultured tongues results in
more papillae that are larger and closer together, the cellular mechanisms that
may be involved in re-patterning the taste papillae is not understood. Therefore, I
tested the linked hypothesis that in response to Shh inhibition this morphological
change in papillae is due to either increased levels of proliferation and/or
decreased levels of apoptosis.
17


CHAPTER 2
MATERIALS AND METHODS
' Animals
The mice used in this study were homozygous and hemizygous GliliacZ
mice, where the Glil coding region was replaced with the gene, LacZ, creating a
null allele for Glil (Bai et al., 2002). p-galactosidase expressing cells, when
exposed to an X-gal reagent, allows visualization of Glil-LacZ expressing cells in
the heterozygote and homozygote null mice, that display a normal phenotype
(Denkers, Liggins and Barlow, unpublished observations). Litters containing
wild-type mice, Glil LacZ heterozygote and homozygote null mice were used for
cultures, in situ hybridization and cellular kinetic analysis. Mice were paired in
the evening, and noon on the following day when a visible plug was evident, was
considered E0.5.
Embryo Tongue Collection
Pregnant females were euthanized via cervical dislocation at embryonic
day (E)l 1.5-E13.5. Sterile forceps and scissors were used to remove the entire
uterus, containing embryos within their placental sacs, which were then placed in
a cold Tyrodes solution (119.8mM NaCl, 5.4mM KC1,1.8mM CaC^fbO,
18


1.05mM MgCl2*6H20, 0.42mM NaH2P04,22.6mM NaHC03) in 30mm culture
dishes, on ice. The outer uterus was peeled away, and embryos dissected free
from the extra-embryonic tissues. Embryos were then transferred with a plastic
transfer pipette to cold Tyrodes in individual wells in a 24-well plate on ice.
Embryos were first staged according to The Atlas of Mouse Development
(Kaufman, 1882) via limb morphology and eye pigmentation, and designated on a
scale from embryonic day 11.0-13.5. Heads were then severed from the torsos
and placed back in Tyrodes, while the remaining torsos were placed in an X-gal
solution in order to determine their genotype, i.e. Gli 1LacZ hemizygous/null. Glil-
LacZ expressing tissue turns blue vs wild type (no blue reaction). Each head was
then bisected along the jaw line with micro-scissors, retaining the lower jaw with
the tongue rudiment. In order to determine Shh mRNA expression, tongues were
fixed in 4% paraformaldehyde in 0.1 M phosphate buffer for 2 hours at room
temperature, rinsed 2x5 min in phosphate buffer + 0.1% Tween-20 (PBT),
dehydrated through ascending methanol/PBT (25%, 50%, 75%, 100%)
concentrations, and stored in 100% methanol at -20C. El 1.5-E13.5 tongues were
then processed by in situ hybridization with a probe directed towards Shh, as
described fully below.
Tongue Explant Cultures
To determine the effects of Shh inhibition in vitro on papillary
development and cell cycle kinetics, the tongues were removed from embryos at
19


El 1.5 as above. The lower jaw was then trimmed laterally, anteriorly and
posteriorly using a microblade (Continental Lab Products), so that the remaining
explants consisted only of tongue rudiments. Finally, removal of the ventral
epithelium of the explant resulted in an explant ventral surface comprised only
mesenchyme. The dissected tongue rudiment was placed in 2ml DMEM media
(Gibco) containing 1% Penicillin/Streptomycin (Sigma) andlO% Stripped Fetal
Bovine Serum (Sigma) and subsequently transferred to a 13mm diameter, 8.0 pm
pore size Nucleopore filter (Whatmann), immersed in a small drop of DMEM and
placed in a 30mm culture dish. The tongue was positioned with the ventral
surface down and the tip of the tongue oriented towards a cut in the filter. The
filters were then floated on 2ml of DMEM culture medium containing 50ug/ml
5E1 anti-Shh monoclonal antibody (Developmental Studies Hybridoma Bank) or
DMEM culture medium alone as a control. The cultures were secured in an
airtight chamber (donated by Sarah Gebb), moved to a 37C incubator, and the
chamber gas equilibrated with 3% O2, 5% CO2 and balanced N2 for 20 minutes.
After 20 min the chamber was sealed and moved to a large CO2 37C incubator.
The culture medium was replaced at 24hour intervals over the 3 day
culture period. For medium changes, a 2 ml aliquot of DMEM media per dish
was placed at 37C to warm for 1 hour. The old media was removed from the
tongue culture dishes under sterile conditions, discarded and replaced with the
new, warm media. The culture plates were again secured in an airtight chamber
20


and moved to the 37C incubator with 3% O2, 5% CO2 and balanced N2 for 20
min for equilibration. After 20 min the chamber was resealed and moved back to
a large 37C incubator.
Shh In Situ Hybridization
Pretreatments and Hybridization.
El 1.5-E13.5 fixed and dehydrated tongues were rehydrated through a
series of Methanol/PBS solutions; 75%, 50%, 25%, for 5 minutes at room
temperature with gentle rocking. Tongues were then washed 2x5 min with
Phosphate Buffered Saline solution with 0.1% Tween (PBT) at'room temperature
with rocking. To remove the tongue from the filter, the filter was placed on a
glass slide, covered with PBT to remain moist, and a curved wire was slid
between the tongue and the filter until the tongue became detached. A pasteur
pipette was then used to return the tongue to PBT. The tongues were treated with
lOmg/ml Proteinase K in PBT for 15 minutes at room temperature, without
rocking. The proteinase K was removed and the tongues rinsed briefly with PBT.
The tongues were then re-fixed in 4% PFA for 30 minutes at room temperature,
without rocking, followed by 3x10 min rinses in PBT. The tongues were rinsed
once with a 1:1 mix of PBT/prehybridization mix that had been prewarmed to
65 C for 3 minutes, followed by a quick rinse in prewarmed prehybridization mix
and a 1 hour wash with new prewarmed prehybridization mix in a 65 C incubator.
The prehybridization mix was replaced with new mix containing 0.5 pg/ml Shh
21


anti-sense riboprobe and the tongues incubate overnight at 65 C while gently
rocking in a hybridization oven.
Post-Hybridization Washes.
On Day 2, the tongues were rinsed twice with prehybridization mix
prewarmed to 65C, washed twice for 30 minutes in prewarmed prehybridization
mix and washed once for 20 minutes in a 1:1 mixture of prewarmed
prehybridization mix and MABT. The tongues were placed at room temperature
and allowed to cool for 10 minutes. They were then rinsed 3x in Maleic Acid
Buffer with 0.1% Tween (MABT), followed by 2x30 min washes in MABT. A 1
hour wash at room temperature, rocking, with MABT + 2% Boehringer Blocking
Reagent (BBR) (Roche) was followed by another 1 hour wash with MABT + 2%
BBR + 20% Sheep serum, at room temperature, rocking. The tongues were then
incubated overnight at 4C with fresh MABT + 2% BBR + 20% Sheep serum +
Alkaline Phosphatase Conjugate (AP) -anti-digoxigenin antibody diluted at
1:1000.
Post-Antibody Washes and Histochemistry.
On day 3, tongues were washed with 3x1 hour with MABT at room
temperature with gentle rocking. The tongues were then washed 2x10 min in
NTMT (lOOmM NaCl, lOOmM Tris-HCI pH 9.5, 50 mM MgCI2, 0.1 % Tween-20) at
room temperature with rocking. In order to detect the Shh riboprobe signal, the
tongues were then incubated with 1-2 ml NTMT + 5pl/ml Nitroblue Tetrazolium
22


(NBT) (Roche) + 3.5 pl/ml BCIP (5-bromo-4-chloro-3-indolyl phosphate)
(Roche) in the dark for 2-4 hours. When developed, the tongues were rinsed once
and washed once for 5 minutes with PBT, at room temperature with rocking. The
tongues were then refixed in 4% PFA and stored at 4C until visualization.
Anti-Shh Immunofluorescence
To visualize Shh protein, 0.5 ml LI5 media with 30pg/ml 5E1 (anti-Shh
mouse monoclonal antibody, DSHB) per explant, was placed at 37C to warm for
1 hour. Cultured tongue explants were placed in individual wells of a 24-well
dish in prewarmed L15 + 30pg/ml 5E1 media and placed in a CO2 incubator at
37C for 3 hours. The tongues were then rinsed 2x3 min with .2M PB followed
by fixation in 4% P.FA for 2 hours at 4C. After fixation, the tongues were rinsed
in PBS, 3x10 minutes. Tongues were placed in a blocking solution, PBS + 1%
normal goat serum + 2mg/ml BSA + 0.3% Triton X-100, for 90 minutes at room
temperature. The tongues were then incubated overnight at 4C in the blocking
solution with an Alexa 488-conjugated goat anti-mouse secondary (Molecular
Probes) diluted 1:1000. Tongues were rinsed 3 times for 10 minutes in PBS and
stored at 4C until sectioning (see below).
Phosphorylated Histone 3 / Activated Caspase 3
Immunofluorescence
After tongues were processed for anti-Shh Immunofluoresence, they were
visualized in whole mount to assess the overall pattern of Shh protein expression.
23


Following, Shh-immunoreacted tongues were sunk overnight at 4C in 20%
sucrose in 0.1M PB and embedded in OCT and frozen. Tissue was cryosectioned
at 12jam and collected on Superfrost Plus slides (Fisher). Slides were dried
overnight at -20C before processing. On Day 1 the slides were removed from -
20C and allowed to thaw at room temperature for 5-10 minutes. The tissue
sections were circled with a Pap Pen (Electron Microscopy Sciences), which was
allowed to dry before proceeding. The slides were rinsed in 0.1 M PB and placed
on a hot plate maintained at 40C until the sections appeared dry, about 5
minutes, in order to help adhere the tissue to the slide. The slides were then
returned to 0.1 M PB until all slides had been dried. The slides were then washed
once for 10 minutes in 0.1M PB and twice for 10 minutes in 0.1 M PBS. Antigen
retrieval was performed for Phosphorylated Histone 3 (Upstate Antibodies), but
not Activated Caspase 3 (Cell Signal), using lOmM sodium citrate. The sodium
citrate was heated by a conventional microwave oven until boiling. The slides
were then placed in a slide holder and submerged in the boiling Sodium Citrate,
they were returned to the microwave for 1 minute at 40% power. The slides were
then cooled for 20 minutes at room temperature and rinsed three times for 10
minutes in PBS. The tissue was blocked using a blocking solution containing 2%
normal goat serum (NGS) for 2 hours at room temperature, in a humidified
chamber. Slides were then incubated in 200pl of either an antibody directed
24


towards Phosphorylated Histone 3 diluted 1:1000 in fresh blocking solution + 2%
NGS, or Activated Caspase 3 diluted 1:100 in blocking solution + 2% NGS. The
slides were incubated in primary antibody in a humidified chamber, overnight at
4C. On Day 2 the slides were removed from the chamber and drained, followed
by 3x10 min washes in PBS. The goat anti-Rabbit Alexa 546 secondary
(Molecular Probes) was diluted 1:1000 in the blocking solution and 200 pi placed
on each slide. The slides were again incubated in a humidified chamber for 2
hours at room temperature, in the dark in order to preserve the Alexa 546
fluorescence. After 2 hours, the slides were drained and washed once for 10
minutes in PBS and twice for 10 minutes in 0.1M PB. Hoescht (Molecular
Probes) was used as a counterstain, diluted 1:5000, and placed on the slide for 1
minute. The slides were rinsed 3 times 10 minutes in 0.1 M PB and coverslipped
using an antifade mounting media.
Glil, 2, 3 RT-PCR
To determine the presence of the Gli transcription factors in the
developing tongue, RT-PCR was performed using primers directed against
specific portions of the Glil, Gli2 and Gli3 genes, on mRNA purified from El 1.5,
E12.5, E13.5 tongues, and E13.5 whole embryos. G1 sense:
TTGAATGGGGAATACAGGGGCTTAC; G1 antisense:
CCAGTTTCTGAGATGAGGGTTAGAGGC; G2 antisense:
CTGGCCATAGTAGTATAGCG; G2 sense: TTCATGGAGTCCCAGCAGAA;
25


G3 antisense: TGAAGCATCTGTGGAGATGG; G3 sense:
AAGTGACCTGTCAGGTGTAG Titanium One-Step RT-PCR kit (clontech) was
used and PCR was carried out in a Mastercycler PCR machine (Eppendorf).
Samples were run out on a 1 % Acrylamide gel for positive band detection.
Image Acquisition
Digital images were obtained with a Zeiss Axiocam cooled color CCD
(charge-coupled-device) camera mounted on a Zeiss Axioplan fluorescence
microscope using Axiovision software. Confocal images were obtained from a
chilled CCD camera mounted on an Olympus Spinning Disk confocal
microscope.
Data Acquisition
Tongues cultured for 3 days in 50pg/ml 5E1 or control medium were
evaluated for papillae number, as well as papillary volume. Shh expressing
papillae were counted in 12 pm serial sections of tongues or tongue explants,
taking care to identify papillae that spanned multiple sections. Papillae width was
then measured digitally with Axiovision software. Average papillary height was
determined to be 20 pm, the average width of the papillary epithelial layer.
Papillary volume was then determined by multiplying the measured area by 12pm
(average section thickness), and summing the volumes of all sections spanned by
each papillae. Individual papillary volume of treated tongues were compared to
those incubated in control medium. Cultured tongues were also evaluated to
26


determine levels of apoptosis and proliferation in 3 distinct regions; 1. cells co-
expressing activated Caspase 3, or Phosphorylated Histone 3, and Shh protein
within the papillary epithelium (express Shh protein), 2. cells in the peripapillary
epithelium, defined as one papillae diameter distance on each side of a Shh-
expressing papilla, 3. cells in the papillary mesenchyme below the papillary
epithelium, again one papillae diameter below the epithelium. Levels of
proliferation and apoptosis were compared between 5E1 treated and control
cultured tongues using a two-tailed T test, and a p value < 0.05 was considered
significant.
Peripapillary
Epithelium
Papillary
epithelium
Subpapillary
Mesenchyme
Q Shh expressing cell
Figure 1. Characterization of cells surrounding papillae.
27


CHAPTER 3
RESULTS
Spatiotemporal Expression of
Shh in Developing Taste Papillae
To determine normal Shh papillary expression in vivo, during the earliest
phase of papillae development, tongues were harvested from embryos at 12 hour
intervals between and including E11.5-E13.5, and reacted for Shh in situ
hybridization (Figure 6). At El 1.5, Shh message is diffuse throughout the
epithelium and mesenchyme in the lateral lingual swellings, which have met but
not yet fused at the midline. At this stage no papillae are yet evident as placodes,
likewise Shh expression has not yet resolved into a punctate pattern. Tongues at
El2.0 still do not have a resolved pattern, although Shh expression begins to
appear more spotty in the tongue epithelium. At E12.5 the pattern of Shh
becomes focal in the fungiform placode epithelium, but persists somewhat in the
surrounding epithelium, finally localizing specifically to papillae at E13.0.
We also evaluated Shh protein expression utilizing an anti-Shh antibody
(Figure 7). Shh protein expression is very similar to the expression seen with in
situ hybridization, diffuse throughout the lingual epithelium at El 1.5 and
beginning to focalize at E12.0. At E12.5, Shh protein localizes to the papillary
28


placode epithelium and finally resolves to parasagittal rows of papillae on the
anterior two-thirds of the tongue at E13.5. This Shh papillary expression in the
developing taste system is likely tracking fungiform papillary development, such
that we can use Shh as a marker of papillary development.
Shh Inhibition on Tongue Explants In Vitro Results in
More Papillae that are Larger and Closer Together
Previous studies have implicated the role for Shh in taste papilla
development. In vitro Shh inhibition results in more papillae that are larger and
closer together (Hall et al., 2003; Mistretta et al., 2003; Liu et al., 2004). To
confirm the effects of Shh inhibition on taste papillae development, tongues were
removed at El 1.5, before placodes form, and cultured for three days with an anti-
Shh function-blocking antibody or in control culture medium (Figure 8). After
three days in culture, the tongues develop papillae in a characteristic pattern.
Typically after 3 days in vitro, these explants have a papilla pattern which
resembles that of El 3.0 tongues from intact embryos. However, tongues that
have been treated with a Shh antibody display a characteristic change in the
papillae formation. We confirmed that in the presence of 5E1, the tongues
develop more papillae that are larger and appear closer together (Hall et al., 2003;
Mistretta et al., 2003; Liu et al., 2004) (Figure 8). Tongues evaluated for papillae
formation, via Shh protein expression in our cultures, show an average of 34 (+/-
6.8) papillae in 4 control tongues with a mean papillae volume of 11089.58pm
29


(+/- 546.1). In contrast, 5 tongues treated for 3 days with 50pg/ml Shh function
blocking antibody display an average of 44.8 (+/- 5.6) papillae with a mean
papillae volume of 11550.29pm (+/- 405.8). The papillae develop in an abnormal
pattern compared to control tongues: papillae form in the posterior 2/3 of the
tongue, as well as down the midline, the latter a phenotype not present with the
control tongues. The tongue also develops abnormally, as reported by others.
The mid-tongue is mediolaterally narrow while the tip of the tongue grows in a
pointed manner, again not seen in the control tongues. Control tongues develop
normally, with fungiform papillae formation on the anterior 2/3 of the tongue in
parasagittal rows, with a clearing in the posterior and midline aspects of the
tongue (Figure 12). Our observations, together with previous analyses of the
effect of Shh inhibition, is interesting in that inhibiting Shh results in an increase
in Shh expression in the tongue. This cannot be due to a direct action, and
therefore implicates other factors involved in this developmental process.
Control Levels of Proliferation In Vivo
In order to determine levels of proliferation in vivo, embryonic tongues
processed with an anti-Shh, 5E1 antibody to visualize papillae, were sectioned
and further processed to determine the extent of cell division with respect to
developing papillae from E11.5-E13.5 (Figure 10). At El 1.5, sectioned tongues
show Shh protein diffusely expressed throughout the epithelium and
mesenchyme. A few proliferating cells are revealed, via immunoreactivity for
30


phosphorylated Histone 3, a marker of cells in M phase (Mahadevan et al., 1999),
in the embryonic tongue at El 1.5. As Shh expression becomes focalized to the
papillary epithelium at E12.5, proliferating cells are detected within the papillary
epithelium, as well as the epithelium and mesenchyme surrounding papillae. At
El3.5, again there are Shh expressing papillae throughout the epithelium that are
colocalized with phosphorylated Histone 3 expressing cells. There are also
proliferating cells within the epithelium and mesenchyme surrounding the
papillae.
Control Levels of Apoptosis In Vivo
To determine the levels of active cell death occurring in the developing
taste papillae, tongues were evaluated from El 1.5-E13.5. Tongues were removed
from El 1.5-E13.5 embryos and processed with the 5E1 antibody to visualize taste
papillae expressing Shh protein. Tongues were then reacted with and antiserum
against Activated Caspase 3 to mark cells undergoing early programmed cell
death, prior to our ability to visualize cells with a TUNEL assay (Figure 11).
Apoptotic cells are very sparse throughout the epithelium and mesenchyme at
Ell.5. AtE12.5, there were no apoptotic cells in either the epithelium or
mesenchyme of the tongues. This trend continued into E13.5 where again there
were no apoptotic cells in the epithelium nor in the mesenchyme.
31


Effects on Proliferation of Shh Inhibition In Vitro
Embryonic tongues cultured for 3 days in the Shh function blocking
antibody, have more papillae that are larger and closer together (Hall et al., 2003;
Mistretta et al., 2003; Liu et al., 2004) (Figure 8). To address whether these
morphological changes are due to an increase in cell proliferation with respect to
taste papillae, sections from 3 day 5E1 treated and control medium treated
tongues were immunoreacted with an antibody against phosphorylated Histone 3
(anti -H3; Figure 12), as well as processed for Shh immunofluorescence to
visualize taste papillae. Cultured tongues exposed to 50pg/ml 5E1 displayed an
increased number of proliferating cells; these included Histone 3-immunoreactive
cells in the papillary epithelium (which were also Shh immunopositive), and
Histone 3-immunopositive cells in the peripapillary epithelium, surrounding Shh
positive expressing papillae (Figure 13). There was also an increase in the
number of proliferating cells in the subepithelial mesenchyme of the papillae.
Tongues incubated for 3 days in control media had an average of 0.0199 (+/-
0.008) dividing cells per papilla, while tongues treated with 50pg/ml 5E1 for 3
days had an average 0.0680 (+/- 0.014) H3-immunopositive cells per papilla.
Histone 3-immunoreactive cells in the peripapillary epithelium also increased
when comparing control cultured tongues to those treated with 50pg/ml 5E1 for 3
days. Tongues incubated with control media had 0.2500 (+/- 0.092)
phosphorylated Histone 3 positive cells per papillae, as compared to 5E1 treated
32


tongues, which had 0.3438 (+/- 0.109) cells per papillae. A final area of
comparison is within the papillary mesenchyme; tongues incubated in control
media had 0.1146 (+/- 0.056) dividing cells per papillae. Tongues treated with
5E1 had 0.1883 (+/-0.067) proliferating cells per papillae. However, the increase
in proliferating cells within the papilla epithelium is the only increase that is
statistically significant.
Effects of Apoptosis from Shh Inhibition In Vitro
Cultured tongues that exhibited increased papillae in response to Shh
inhibition may be related to an increase in apoptotic cells associated with Shh
expressing papillae. To determine the effects of Shh inhibition on apoptosis in
embryonic tongues, cultured tongues were immunoreacted with an Activated
Caspase 3 antibody, marking cells undergoing programmed cell death (Figure 14).
Tongues cultured in a control medium, as well as tongues treated for 3 days with
Anti-Shh, were sectioned and immunoreacted with an antibody directed towards
Activated Caspase 3 and processed for Shh immunofluorescence to visualize
papillae. Cultured tongues exposed to 50pg/ml 5E1 exhibited no difference in the
number of apoptotic cells across treatments. However, cells were actively dying
in cultured tongues, in contrast to negligible levels of apoptosis seen in intact
embryos during development (compare Figures 11, 14). Activated Caspase 3-
immunoreactive cells were evaluated, with respect to Shh-expressing papillae, as
well as to peripapillary epithelium and subepithelial mesenchyme adjacent to Shh
33


positive papillae (Figure 15). Four tongues incubated for 3 days in control media
had a total of 15 Shh-expressing papillae with one or more activated Caspase 3-
immunopositive cells; an average of 0.1322 (+/- 0.008) per papillae. Three
tongues treated with 50pg/ml 5E1 for 3 days displayed a total of 16 papillary
epithelial cells, or 0.1296 (+/- 0.0002) apoptotic cells per papilla. Apoptotic cells
in the peripapillary epithelium displayed a slight decrease in Activated Caspase 3-
immunoreactive cells when comparing control tongues to those treated with
50pg/ml 5E1. Tongues incubated with control media contained 20 apoptotic cells
in the peripapillary epithelium or 0.1487 (+/- 0.025) Activated Caspase 3-
immunoreactive cells per papilla, as compared to 5E1 treated tongues, which
contained 27 dying cells in the peripapillary epithelium or 0.3078 (+/- 0.036)
apoptotic cells per papilla. A final area of comparison is within the papillary
mesenchyme; tongues incubated in control media as well as tongues treated with
5E1 had no apoptotic, Activated Caspase 3-immunoreactivity, in the papillary
mesenchyme below the papillae.
Confirmation of Gli Transcription
Factors via RT-PCR
To determine how Shh inhibition may re-pattern taste papillae, we
investigated the presence of the three Gli transcription factors at several crucial
developmental time points between El 1.5-E13.5. Using RT-PCR we found that
34


transcripts for Glil, Gli2 and Gli3, are all present in the developing tongue at
El 1.5,12.5 and 13.5 (Figure 16).
35


CHAPTER 4
DISCUSSION
Shh as a Tool to Visualize
Papillary Development
Previous studies have examined Shh expression by immunohistochemistry
and in situ hybridization in developing rodent tongues. In mouse Shh is expressed
in the anterior lateral swellings at El 2-El 3, and then focalizes to the papillae at
E14 (Hall et al., 1999). However, we wished to understand the pattern of Shh
expression during this time window as it is between E11.5-E13.5 that taste
patterning occurs. Thus, the findings described here depict a tighter time series
for Shh expression, via in situ hybridization, as well as immunofluorescence, in
the developing mouse tongue. Broad lingual expression of Shh protein and
message begins in the embryonic tongue at El 1.5, evident throughout the
epithelium and mesenchyme. At E12.0 Shh appears diffuse throughout the
epithelium, beginning to focalize in the papillary placodes and absent from the
mesenchyme. Shh expression is finally confined to the papillae at E12.5. The
placodal cells of developing taste papillae likely act as signaling centers for
papillary development, producing multiple extracellular signaling molecules. The
placodal cells are morphologically distinct from the surrounding epithelium: they
are taller (Farbman and Mbiene, 1993) and express cytokeratin 8 (Mbiene and
36


Roberts, 2003), and BMP4 (Hall et al., 1999; Jung et al., 1999). This expression
continues through tongue development and has become established in a papillary
pattern by El3.5. These developmental stages of Shh expression are crucial in
that they exhibit a patterning that mirrors papillary development in the mice.
Papillae begin to develop at E12-E12.5 as epithelial placodes and form raised
structures with a mesenchymal core by E13.5. As the expression of Shh is similar
to fungiform development and patterning, we can use Shh expression to visualize
early papillary morphogenesis.
Inhibition of Shh Results in Altered Tongue
Morphology and Papillary Pattern
Using an embryonic tongue culture system, in which tongues and papillae
undergo morphogenesis and retain molecular signatures characteristic of embryos
in vivo (Mbiene et al., 1997; Nosrat et al., 2001), allows evaluation of the effects
of Shh inhibition on papillary morphogenesis and tongue development. Tongue
cultures permit the isolation of disruptive effects on tongue development while
excluding other mitigating factors. In contrast, the Shh knockout mouse has
major craniofacial defects that include cyclopia, and importantly, the complete
absence of the lower jaw and tongue (Chiang et al., 1996; Incardona and Roelink,
2000), making analysis of papillary development in this model impossible. In
vitro manipulations of the developing tongue thus provides a method of
determining molecular pathways and cellular mechanisms that control tongue and
37


papillary development that otherwise are too disruptive to normal development of
intact embryos.
In order to assess the role of Shh on papillary and tongue development, as
well as the effects on cellular mechanisms intrinsic to the tongue, we examined
cultures in which Shh function was inhibited by a function blocking monoclonal
antibody, 5E1. Previous studies have evaluated Shh function using the 5E1
antibody or a plant steroidal alkaloid, cyclopamine to determine the role of Shh in
papillary formation. The 5E1 antibody specifically binds Shh protein and
prevents it from binding its receptor, Ptc (Incardona et al., 2000; Pepinsky et ah,
2000). In previous studies, Shh has been shown to be a major morphogen in the
formation of rodent tongues, as well as directing fungiform papilla formation and
anterior tongue patterning of papillae in rows (Hall et ah, 2003; Mistretta et ah,
2003; Liu et al., 2004). Our data confirm previous reports that inhibition of Shh
in developing rodent tongues results in larger papillae that are more numerous and
appear closer together (Hall et ah, 2003; Mistretta et ah, 2003; Liu et ah, 2004).
As others have reported tongue formation disruption resulting from Shh inhibition
with cyclopamine in rodents (Liu et ah, 2004), we too have found that inhibition
of Shh on mouse tongues using the 5E1 function blocking antibody results in a
pointed tongue with a loss of the median furrow by papillary overgrowth.
Although we have a clear understanding of the effects of Shh inhibition on
38


papillary morphogenesis, we wished to understand how this inhibition resulted in
more and larger papillae.
Shh Inhibition Increases the Rate of Proliferation Within
the Cells Associated with Developing Papillae
Previous reports have shown that placodal cells are mitotically quiescent
as compared to the surrounding epithelium (Farbman and Mbiene, 1991; Mbeine
and Roberts, 2003). In contrast, outside of developing papillae, proliferation is
very vigorous at the early stage of tongue development and continues to be active
throughout embryogenesis (Nie, 2005). Here we have shown, in contrast to
previous reports, that there are mitotically active cells in the papillary epithelium,
as well as in the epithelium surrounding papillae and in subpapillary
mesenchyme. At El 1.5, we found actively dividing cells in the epithelial and
mesenchymal layers of the tongue. As papillary development proceeds,
Phosphorylated Histone 3-immunoreactive cells are associated with papillae, as
well as the epithelium and mesenchyme surrounding the papillae atE12.5, 13.5,
the levels are low but still detectable.
To determine the effects of Shh inhibition on mitosis with respect to
papillae in vitro, tongue explants were treated with Shh function blocking
antibody and then were evaluated for levels of proliferating cells compared to
controls. Papillae areas considered were the papillary epithelium, peripapillary
epithelium and subpapillary mesenchyme. Each area was evaluated
39


independently for proliferating cells and the 5E1 treated tongues and control
tongues were compared. We observed a significant increase in proliferating cells
within the papillary epithelium. We also observed an increase in proliferating
cells in the peripapillary epithelium and subpapillary mesenchyme however, these
increases were not significant. This increase in mitotic activity could explain the
increased papillary number and size we see with Shh inhibition, in that an
increase in proliferating cells associated with papillae would allow a greater
number of cells to express Shh and take on a papillary morphology.
Shh Inhibition has no Effects on Programmed
Cell Death in Cells Associated
with Developing Papillae
Recent studies have found a constant rate of cell death in the upper layers
of the tongue during the late stages of development, as well as continual
proliferation in the basal layers of the tongue (Nie, 2005). This constant renewal
allows for rapid cell turnover in the epithelium. However, the rate of apoptosis in
the mesenchyme is rarely detected versus extremely vigorous proliferation during
the early stages of tongues development, responsible for the rapid enlargement of
the tongue during embryogenesis (Nie, 2005; Nagata and Yamane, 2004; Shuler
and Dalrymple, 2001). Previous studies have found that apoptosis is a very late
event in embryogenesis in the tongue and is restricted to the upper layer of the
epithelium (Nie, 2005). We evaluated the presence of apoptotic cells in vivo after
removing tongues atE11.5-E13.5. Activated Caspase 3-immunoreactive cells
40


were only evident at El 1.5, subsequently absent at E12.5-E13.5. After tongues
had been cultured for 3 days in either the Shh inhibitor or control media, apoptotic
cells were visible. This increase in apoptotic cells within the cultured tongues
was likely due to the culture conditions, or to the residual effects of dissection, as
both 5E1 treated and control tongues displayed comparable rates of cell death.
Thus tissue culture conditions, when compared to those in vivo, likely results in a
subtle increase in apoptosis. Overall, we saw low levels of apoptosis within the
Shh expressing papillae cells, as well as in the peripapillary epithelium.
However, we saw no apoptotic cells in the mesenchyme surrounding papillae.
In summary, we demonstrated that Shh is implicated in tongue structure,
papillary development and papillary patterning, confirming published results. We
also examined the behavior of the cells within and associated with papillae. Shh
inhibition increases proliferating cells in papillae epithelium, versus no significant
effect on apoptosis. Shh inhibition results in larger papillae that are more
numerous and closer together (Hall et al., 2003; Mistretta et al., 2003; Liu et al.,
2004). We proposed two hypotheses to explain the morphological changes seen
when tongues are exposed to a Shh inhibitor; increased papillary proliferation,
and/or decreased papillary apoptosis. Our data suggest that the increase in size
and number of papillae may be the result of the papillary epithelial mitosis,
papillary mesenchyme and peripapillary epithelial proliferation increasing cell
division in cells associated with papillae. In contrast, we found that apoptosis is
41


likely not a factor explaining this change in phenotype. A third possible
explanation for the effect of Shh inhibition is that epithelial cells are transformed
into papillae. However, this mechanism is difficult to ascertain since to date, we
have no genetic marker for cells destined to acquire an epithelial fate. Since Shh
inhibition results in more Shh expressing cells, we are looking into the repressor
functions of the Gli transcription factors. Perhaps, Shh upregulation is due to an
increase or decrease in one of the Gli transcription factors that can act as both an
inhibitor and an activator of Shh signaling in embryogenesis. However,
understanding what is occurring at a cellular kinetic level allows for further
questions to be asked as to the role of Shh in taste papillae development.
42


Circumvallate Papilla
Fungiform
Liu et al., 2004
Foliate
Figure 2. SEM of adult rodent tongue displaying lingual papillae.
The three distinct types of taste papillae are pictured here. A single circumvallate
papilla forms at the extreme posterior aspect of the tongue on the midline. Foliate
papillae appear on the posterior lateral aspect of the tongue in vertical folds.
Fungiform papillae form in parasagittal rows on the anterior two-thirds of the
tongue.
43


Circumvallate Papilla
Figure 3. Taste papillae house taste buds.
A pictorial displaying circumvallate and fungiform taste papillae containing taste
buds embedded within the epithelial layer of the oral tongue.
44


Placode Formation Papillae Morphogenesis
Tastebud Differentiation
* mesenchyme
epithelium
4^ taste buds
Mbieneet al.. 1999;Liu et al., 2004
Figure 4. Development of rodent lingual taste buds.
Taste papillae formation occurs in a characteristic spatial and temporal pattern
from El 1.5-P4.0. Placode formation occurs from El 1.5-E12.5 and results in
epithelial thickenings that will eventually house taste buds. Papillae
morphogenesis occurs from El 3.5-El 7.0 and results in papillae formation as an
epithelial thickening with a mesenchymal core, nerve innervation is introduced
into the subepithelial mesenchyme. Taste bud differentiation occurs from P0-P4
and taste buds are formed in the papillary epithelium. At 4 days after birth, the
mouse has a fully functioning taste system.
45


Figure 5. Shh signaling pathway
A simple schematic of Shh signaling shows the secreted ligand, Shh, binding to
the transmembrane Ptc receptor. In the absence of Shh, the transmembrane
protein, Smo, represses Ptc and terminates this signaling pathway. When Shh is
bound to Ptc, Smo inhibition is released and the three downstream Gli
transcription factors are activated (picture modified from Callahan and Oro,
2001).
46


E13 5
Figure 6: Shh Spatiotemporal Expression via In Situ Hybridization.
Photomicrographs illustrating Shh spatiotemporal expression during crucial
embryonic stages El 1.5 El3.5. In Situ Hybridization performed, with probes
directed towards Shh. exhibits diffuse expression through the epithelium and
mesenchyme at El 1.5-E12.0 (A, B). Focal expression begins at E12.5 (C) and
continues through El3.5 (E) becoming punctate and localized to the fungiform
papillae on the anterior aspect of the tongue, as well as in the circumvallate
papilla.
47


A.
100um E11 5
B.
100um E12.0
c.
100um E12.5
Figure 7. Shh Spatiotemporal Expression via Shh Immunofluorescence
Photomicrographs of Shh spatiotemporal expression during crucial embryonic
stages El 1.5-El3.5. Immunofluorescence with an anti-Shh. 5E1, antibody shows
Shh expression diffuse through the epithelium and mesenchyme at El 1.5 (A) and
throughout the epithelium at E12.0. Expression becomes punctuate at El2.5 (C)
and resolves to the papillary epithelium by El 3.5 (D).
48


Control
3 days 50 |jg/ml 5E1
Figure 8. Shh inhibition in vitro results in more papillae that are larger.
Photomicrographs of whole mount and 12pm sectioned tongue cultures; control
(A, B) and treated with 50pg/ml 5E1 for 3 days (C, D) demonstrating a narrowed
tip morphology in treated tongues, as well as more papillae that are larger.
Tongues are reacted with an Anti-Shh, 5E1, antibody to visualize papillary
location. Scale bars: 100pm.
49


Mean number papillae
50


Figure 9. Effects of Shh inhibition on the number and size of papillae.
Graphs comparing 50ug/ml 5E1 treated tongues to culture medium controls shows
an increase in number of papillae associated with Shh inhibition, as well as an
increase in average papillary volume associated with Shh inhibition.
51


E13.5 E12.5 E11.5
Figure 10. Control levels of Proliferation in vivo.
Photomicrographs of proliferative activity in 12pm tongue cryosections. Red is
phosphorylated Histone 3 expression from El 1.5-El3.5 and green indicates Shh
expression. At El 1.5 proliferating cells are seen diffusely throughout the
mesenchyme and epithelium. At this stage of development there are no raised
papillae, thus no Shh expressing papillae in the epithelium. Instead there is Shh
activity throughout the epithelium and mesenchyme, confirming what is seen in
whole mount tongues. In the overlay, there are a few proliferating cells
associated with Shh expressing cells. At E12.5 proliferation is robust in the
epithelium and mesenchyme and specifically within the epithelium associated
with Shh positive papillae. At El 3.5, phosphorylated Histone 3 continues to be
expressed throughout the mesenchyme and epithelium, Shh expression is confined
to the papillary epithelium, proliferating cells can be seen within papillae.
52


E13.5 E12.5 E11.5
Shh
Double
Figure 11. Control levels of Apoptosis in vivo.
Photomicrographs of apoptotic activity in 12pm tongue cryosections. Red is
Activated Caspase 3 expression during El 1.5-El3.5 and green indicates Shh
expression. At El 1.5 apoptotic cells are seen sparsely throughout the epithelial
and mesenchymal cell layers. Apoptotic cells are no longer visible after El 1.5,
tissue sections evaluated at El2.5 and El 3.5 show no apoptotic activity.
However, Shh expressing cells are still visible during these later stages.
53


Figure 12. The effects of Shh inhibition on proliferation in vitro.
Confocal micrographs of proliferative activity in 12pm tongue cryosections
cultured for 3 days in either control media or 50pg/ml Anti-Shh. 5E1 function
blocking antibody. Red is phosphorylated Histone 3, green is Shh expression and
blue is a nuclear counterstain Hoescht. Proliferating cells are seen within the
epithelium and mesenchyme of control and treated tongues. Proliferation was
evaluated within the papillary epithelium, the peripapillary epithelium and the
papillary mesenchyme. There is an increase in proliferating cells in each area,
with a significant increase within the papillary epithelium.
54


Figure 13. The effects of Shh inhibition on proliferating cells associated with
papillae.
The chart shows a significant increase in proliferating cells within papillae after
Shh inhibition. There is also an increase in proliferating cells within the
peripapillary epithelium and papillary mesenchyme, with Shh inhibition.
55


Control Anti-Shh
Peripapillary
apoptosing cells
Apoptosing cells
within papillae
Figure 14. The effects of Shh inhibition on dying cells in vitro.
Confocal micrographs of apoptotic activity in 12pm tongue cryosections cultured
for 3 days in either control media or 50pg/ml Anti-Shh, 5E1 function blocking
antibody. Red is Activated Caspase 3, green is Shh expression and blue is a
nuclear counterstain Hoescht. Apoptotic cells are restricted to the epithelium of
the control and treated tongues. Dying cells are seen within the papillae, as well
as the peripapillary epithelium. There is no significant difference between the
treated and control tongues. However, there is a distinct difference between
cultured and non-cultured tongues, as there are no apoptotic cells visible in vivo at
E12.5.
56


Figure 15. Effects of Shh inhibition on apoptotic cells associated with
papillae.
The chart shows no significant increase in apoptotic cells within the papillae after
Shh inhibition. There is also no significant increase in the number of apoptotic
cells in the peripapillary region. There were no apoptotic cells measured in the
papillary mesenchyme.


Figure 16. Gli transcription factors RT-PCR in embryonic tissue.
RT-PCR of mouse embryonic tissue shows the presence of all 3 Gli transcription
factors. Glil, 2, 3 are present in El 1.5-El3.5 isolated tongue RNA. El 1.5, E13.5
whole embryo RNA was used as a positive control for the presence of the Gli
transcription factors.
58


References
Bai, C.B., Auerbach, W., Lee, J.S., Stephen, D. and Joyner, A.L. (2002). Gli2, but
not Glil, is required for initial Shh signaling and ectopic activation of the Shh
pathway. Development 129,4753-4761.
Bai, C.B., Stephen, D. and Joyner, A.L. (2004). All mouse ventral spinal cord
patterning by hedgehog is Gli dependent and involves an activator function of
Gli3. Developmental Cell 6,103-115.
Barlow, L.A., Chien, C.B., and Northcutt, R.G. (1996). Embryonic taste buds
develop in the absence of innervation. Development 122,1103-1111.
Beidler, L.M. and Smallman, R.L. (1965). Renewal of cells within taste buds.
Journal of Cell Biology 27, 263-72.
Buscher, D., Bosse, B., Heymer, J. and Ruther, U. (1997). Evidence for genetic
control of Sonic hedgehog by Gli3 in mouse limb development. Mechanisms of
Development 62,175-82.
Callahan, C.A. and Oro, A.E. (2001). Monstrous attempts at adnexogenesis:
regulating hair follicle progenitors through Sonic hedgehog signaling. Current
Opinion in Genetics & Development 11, 541-546.
Chiang, C., Litingtung, Y., Lee, E., Young, K.E., Corden, J.L., Westphal, H. and
Beachy, P.A. (1996). Cyclopia and defective axial patterning in mice lacking
Sonic Hedgehog gene function. Nature 383, 407-13.
Dai, P., Akimaru, H., Tanaka, Y., Maekawa, T., Nakafuku, M. and Ishii, S.
(1999). Sonic Hedgehog-induced activation of the Glil promoter is mediated by
Gli3. Journal of Biological Chemistry 274, 8143-52.
Dominguez, M. and Hafen, E. (1997). Hedgehog directly controls initiation and
propagation of retinal differentiation in the Drosophila eye. Genes Dev. 11, 3254-
64.
59


Farbman, A.I. and Mbiene, J.P. (1991). Early development and innervation of
taste bud-bearing papillae on the rat tongue. Journal of Comparative Neurology
304,172-86.
Ganchrow, D., Ganchrow, J.R. and Goldstein, R.S. (1991). Ultrastructure of
palate taste buds in the perihatching chick. American Journal of Anatomy 192, 69-
78.
Hall, J.M., Hooper, J.E. and Finger, T.E. (1999). Expression of Sonic hedgehog,
Patched, and Glil in developing taste papillae of the mouse. Journal of
Comparative Neurology 406,143-155.
Hall, J.M.H., Bell, M.L., Finger, T.E. (2003). Disruption of Sonic hedgehog
signaling alters growth and patterning of lingual taste papillae. Developmental
Biology 255, 263-277.
Hammerschmidt, M., Brook, A. and McMahon, A.P. (1997). The world according
to hedgehog. Trends Genet. 13,14-21.
Hepker, J., Wang, Q.T., Motzny, C.K., Holmgren, R. and Orenic, T.Y. (1997).
Drosophila cubitus interruptus forms a negative feedback loop with patched and
regulates expression of Hedgehog target genes. Development 124, 549-58.
Hui, C.C. and Joyner, A.L. (1993). A mouse model of greig
cephalopolysyndactyly syndrome: the extra-toesJ mutation contains an intragenic
deletion of the Gli3 gene. Nature Genetics 3, 241-6.
Hui, C.C., Slusarski, D., Platt, K.A., Holmgren, R. and Joyner, A.L. (1994).
Expression of three mouse homologs of the Drosophila segment polarity gene
cubitus interruptus, Gli, Gli-2, and Gli-3, in ectoderm- and mesoderm-derived
tissues suggests multiple roles during postimplantation development.
Developmental Biology 162, 402-13.
Incardona, J.P., Gaffield, W., Lange, Y., Cooney, A., Pentchev, P.G., Liu, S.,
Watson, J.A., Kapur, R.P. and Roelink, H. (2000). Cyclopamine inhibition of
Sonic hedgehog signal transduction is not mediated through effects on cholesterol
transport. Developmental Biology 224,440-52.
Lindemann, Bemd. (2001). Receptors and transduction in taste. Nature 413, 219-
225.
60


Liu, H-X., MacCallum, D.K., Edwards, C., Gaffield, W. and Mistretta, C.M.
(2004). Sonic hedgehog exerts distinct, stage-specific effects on tongue and taste
papilla development. Developmental Biology 276, 280-300.
Lum, L. and Beachy, P.A. (2004). The Hedgehog response network: sensors,
switches, and routers. Science 304,1755-9.
Mahadevan, L.C., Willis, A.C., Barratt, M.J. (1991). Rapid histone H3
phosphorylation in response to growth factors, phorbol esters, okadaic acid, and
protein synthesis inhibitors. Cell 65(5), 775-83.
Masuya, H., Sagai, T., Moriwaki, K. and Shiroishi, T. (1997). Multigenic control
of the localization of the zone of polarizing activity in limb morphogenesis in the
mouse. Developmental Biology 182,42-51.
Matise, M.P., Epstein, D.J., Park, H.L., Platt, K.A. and Joyner, A.L. (1998). Gli2
is required for induction of floor plate and adjacent cells, but not most ventral
neurons in the mouse central nervous system. Development 125,2759-2770.
Matise, M.P. and Joyner, A.L. (1999). Gli genes in development and cancer.
Oncogene 18, 7852-7859.
Mbiene, J.P., Maccallum D.K., and Mistretta, C.M. (1997). Organ cultures of
embryonic rat tongue support tongue and gustatory papilla morphogenesis in vitro
without intact sensory ganglia. Journal of Comparative Neurology 377,324-40.
Mbiene, J.P. and Roberts, J.D. (2003). Distribution of keratin 8-containing cell
clusters in Mouse Embryonic tongue: evidence for a prepattem for taste bud
development. Journal of Comparative Neurology 457,111-122.
Mistretta, C.M. (1991). Developmental neurobiology of the taste system. In Taste
and Smell in Health and Disease T.V. Getchell, Ed. New York, Raven Press: 35-
64.
Mistretta, C.M., Liu, H-X., Gaffield, W. and MacCallum, D.K. (2003).
Cyclopamine and jervine in embryonic rat tongue cultures demonstrate a role for
Shh signaling in taste papilla development and patterning: fungiform papillae
double in number and form in novel locations in dorsal lingual epithelium.
Developmental Biology 254,1-18.
61


Miura, H., Kusakabe, Y., Sugiyama, C., Kawamatsu, M., Ninomiya, Y.,
Motoyama, J. and Hino, A. (2001). Shh and Ptc are associated with taste bud
maintenance in the adult mouse. Mechanisms of Development 106,143-145.
Nagata, J. and Yamane, A. (2004). Progress of cell proliferation in striated muscle
tissues during development of the mouse tongue. Journal Dent Res 83, 926-9.
Nie, Xuguang. (2005). Apoptosis, proliferation and gene expression patterns in
mouse developing tongue. Anatomical Embryology 210, 125-132.
Nosrat, C.A., MacCallum, D.K. and Mistretta, C.M. (2001). Distinctive
spatiotemporal expression patterns for neurotrophins develop in gustatory papillae
and lingual tissues in embryonic tongue organ cultures. Cell Tissue Research 303,
35-45.
Nusslein-Volhard, C. and Weischaus, E. (1980). Mutations affecting segment
number and polarity in drosophila. Nature 287, 795-801.
Park, H.L., Bai, C., Platt, K.A., Matise, M.P., Beeghly, A., Hui, C.C., Nakashima,
M. and Joyner, A.L. (2000). Mouse Glil mutants are viable but have defects in
SHH signaling in combination with a Gli2 mutation. Development 127, 1593-605.
Pepinsky, R.B., Rayhom, P., Day, E.S., Dergay, A., Williams, K.P., Galdes, A.,
Taylor, F.R., Boriack-Sjodin, P.A. and Garber, E.A. (2000). Mapping sonic
hedgehog-receptor interactions by steric interference. Journal of Biol Chem 275,
10995-1001.
Platt, K.A., Michaud, J. and Joyner, A.L. (1997). Expression of the mouse Gli and
Ptc genes are adjacent to embryonic sources of hedgehog signals suggesting a
conservation of pathways between flies and mice. Mechanisms of Development
62, 121-35.
Rice, R., Conner, E., and Rice, D.P.C. (2005). Expression patterns of Hedgehog
signaling pathway members during mouse palate development. Gene Expression
Patterns 1-7.
Sasaki, H., Nishizaki, Y., Hui, C., Nakafuku, M. and Kondoh, H. (1999).
Regulation of Gli2 and Gli3 activities by an amino-terminal repression domain:
implication of Gli2 and Gli3 as primary mediators of Shh signaling. Development
126, 3915-24.
62


Shuler, C.F. and Dalrymple, K.R. (2001). Molecular regulation of tongue and
craniofacial muscle differentiation. Critical Reviews in Oral Biological Medicine
12,3-17.
Takeda, M., Suzuki, Y., Obara, N. and Nagai, Y. (1996). Apoptosis in mouse taste
buds after denervation. Cell Tissue Res. 286, 55-62.
63