Citation
Distinct cellular assembly stoichiometry of polycomb complexes in chromatin revealed by single molecule chromatin immunoprecipitation imaging

Material Information

Title:
Distinct cellular assembly stoichiometry of polycomb complexes in chromatin revealed by single molecule chromatin immunoprecipitation imaging
Creator:
Tatavosian, Roubina ( author )
Language:
English
Physical Description:
1 electronic file (76 pages). : ;

Subjects

Subjects / Keywords:
Chromatin ( lcsh )
Epigenetics ( lcsh )
Chromatin ( fast )
Epigenetics ( fast )
Genre:
non-fiction ( marcgt )

Notes

Review:
The polycomb group (PcG) repressive complex (PRC) 1 and 2 are epigenetic transcriptional regulatory proteins that play an essential role in gene silencing by regulation of chromatin structure during development and cancer. However, the detailed molecular mechanism of their in vivo cellular assembly on chromatin is poorly understood. Here, we developed a novel and sensitive approach termed single-molecule chromatin immunoprecipitation imaging (Sm-ChIPi) to enable investigating the in vivo cellular assembly stoichiometry of epigenetic complexes on chromatin at a molecular level. Sm-ChIPi approach combines genetic engineering, chromatin biochemistry and single-molecule fluorescence imaging. Using Sm-ChIPi, we show that within mouse embryonic stem (mES) cells, one polycomb repressive complex (PRC) 1 associates with multiple nucleosomes, whereas two PRC2s bind to one nucleosome. Nucleoplasmic PRC1 is a monomer while PRC2 dimerizes in the nucleoplasm. Further, we demonstrated that the differentiation of ES-cells induces selective alteration of the assembly stoichiometry of Cbx2 on chromatin, but not other PRC1 components. Moreover, we obtained direct physical evidence that the assembly stoichiometry of PRC1 on chromatin is not affected by PRC2-mediated trimethylation of H3K27. Taken together, our results reveal the distinct in vivo cellular assembly mechanism of PRC1 and PRC2 on chromatin. Moreover, the novel Sm-ChIPi approach could be utilized to demonstrate single-molecule assembly mechanism of other epigenetic complexes.
Thesis:
Thesis (M.S.)--University of Colorado Denver.
Bibliography:
Includes bibliographic references.
System Details:
System requirements: Internet connectivity.
Statement of Responsibility:
by Roubina Tatavosian.

Record Information

Source Institution:
University of Florida
Rights Management:
All applicable rights reserved by the source institution and holding location.
Resource Identifier:
957591627 ( OCLC )
ocn957591627

Downloads

This item has the following downloads:


Full Text
DISTINCT CELLULAR ASSEMBLY STOICHIOMETRY OF POLYCOMB COMPLEXES
ON CHROMATIN REVEALED BY SINGLE-MOLECULE CHROMATIN
IMMUNOPRECIPITATION IMAGING
by
ROUBINA TATAVOSIAN
B.S., California State University Los Angeles, Los Angeles, 2009
A thesis submitted to the
faculty of the Graduate School of the
University of Colorado in partial fulfillment
of the requirements for the degree of
Master of Science
Chemistry Program
2016


2016
ROUBINA TATAVOSIAN
ALL RIGHTS RESERVED
ii


This thesis for the Master of Science degree
by
Roubina Tatavosian
has been approved for the
Chemistry Program
by
Xiaojun Ren, Chair
Christopher Phiel
Jefferson Knight
April 18, 2016
in


Roubina Tatavosian (M.S., Chemistry)
Distinct Cellular Assembly Stoichiometry of Poly comb Complexes on Chromatin Revealed by
Single-Molecule Chromatin Immunoprecipitation Imaging
Thesis directed by Assistant Professor Xiaojun Ren
ABSTRACT
The polycomb group (PcG) repressive complex (PRC) 1 and 2 are epigenetic transcriptional
regulatory proteins that play an essential role in gene silencing by regulation of chromatin
structure during development and cancer. However, the detailed molecular mechanism of their in
vivo cellular assembly on chromatin is poorly understood. Here, we developed a novel and
sensitive approach termed single-molecule chromatin immunoprecipitation imaging (Sm-ChIPi)
to enable investigating the in vivo cellular assembly stoichiometry of epigenetic complexes on
chromatin at a molecular level. Sm-ChIPi approach combines genetic engineering, chromatin
biochemistry and single-molecule fluorescence imaging. Using Sm-ChIPi, we show that within
mouse embryonic stem (mES) cells, one polycomb repressive complex (PRC) 1 associates with
multiple nucleosomes, whereas two PRC2s bind to one nucleosome. Nucleoplasmic PRC1 is a
monomer while PRC2 dimerizes in the nucleoplasm. Further, we demonstrated that the
differentiation of ES-cells induces selective alteration of the assembly stoichiometry of Cbx2 on
chromatin, but not other PRC1 components.
Moreover, we obtained direct physical evidence that the assembly stoichiometry of PRC 1 on
chromatin is not affected by PRC2-mediated trimethylation of H3K27. Taken together, our
results reveal the distinct in vivo cellular assembly mechanism of PRC 1 and PRC2 on chromatin.
Moreover, the novel Sm-ChIPi approach could be utilized to demonstrate single-molecule
assembly mechanism of other epigenetic complexes.
IV


The form and content of this abstract are approved. I recommended its publication
Approved: Xiaojun Ren
v


DEDICATION
I dedicate this work to my beloved parents Roben and Aida, my lovely husband Rajdeh and my
very dear friend Micky for their unconditional love and support.
VI


ACKNOWLEDGMENTS
I wish to express my deepest gratitude to my advisor Dr. Xiaojun Ren for his
unconditional support, expert guidance, understanding and encouragement throughout my study
and research. Without his incredible patient I would not have been able to complete this thesis.
His support was essential to my success.
My sincere thanks to the Dr. Christopher Phiel, and Dr. Jefferson Knight for serving on
my committee. They generously gave their time to offer me valuable insight and very
constructive criticism toward improving my thesis.
I am very grateful to the collaborators, Dr. Aaron Johnson, and Maggie M, Balas for
providing the reconstituted nucleosomal arrays.
I thank Dr. Haruhiko Koseki for providing the Cbx2"", Ringlbfl/fl; Rosa26::CreERT2,
BmiT "/Mel 18" and Eed" mES cell lines, Dr. Julian Sale for providing H3.3 ""/H3.3-EGFP DT40
cell line, and Dr. Stuart Orkin and Dr. Xiaohua Shen for providing Ezh2" mES cell line.
The assistance and cooperation of the fellow Ren members were essential for the
completion of this research. I would like to thank all of the Dr. Ren laboratory members for all of
their time and help.
Finally, I would like to thank to my parents, Roben and Aida and my sister Aden and her
family for showing faith in me and giving me liberty to choose what I desired. I appreciate you
for all of the unconditional love, care, pain and sacrifice you did to shape my life.
Also I owe a very special thanks to my husband, Rajdeh for his continued and unfailing
love, support and understanding during my pursuit of M.S. degree that made the completion of
research possible. You were always around at times I thought that it is impossible to continue,
you helped me to keep things in perspective. I wish to express my thanks to my parents-in-law
VII


Jray and Rima for their unfailing emotional support through out of my academic years. Lastly, I
thank to my very lovely cat Micky for his pleasant companionship.


AUTHOR CONTRIBUTIONS
Xiaojun Ren conceived and designed the study, supervised the experiments and wrote the paper.
Roubina Tatavosian constructed plasmids, established transgenic mES cell lines, performed ChIP
assays and produced data of single-molecule imaging. Chao Zhen performed western-blotting,
immunoprecipitation, immunofluorescence and fluorescence correlation spectroscopy. Huy Due
constructed plasmids and performed transfection. Aaron Johnson, and Maggie M, Balas provided
reconstituted nucleosomal arrays.
Some of the data in this thesis are also presented in the below published paper.
Roubina Tatavosian, Chao Yu Zhen, Huy Nguyen Due, Maggie M. Balas, Aaron M. Johnson and
Xiaojun Ren. (2015) Distinct Cellular Assembly Stoichiometry of Polycomb Complexes on
Chromatin Revealed by Single-Molecule Chromatin Immunoprecipitation Imaging. J. Biol.
Chem. 2015, 290: 28055.
IX


TABLE OF CONTENTS
CHAPTER
I. INTRODUCTION...........................................1
II. EXPERIMENTAL PROCEDURES.............................. 10
III. RESULTS...............................................22
IV. DISCUSSION............................................50
REFERENCES...................................................56
x


LIST OF FIGURES
Figure
A Representative scheme of histone posttransitional modification on tails of histones of a
nucleosome........................................................................3
B Schematic representation of mammalian core PRC2 proteins.........................4
C Schematic representation of mammalian canonical PRC1 (cPRCl).....................5
D Schematic representation of mammalian variant PRC 1 (vPRC 1).....................6
1 Schematic representation of single-molecule chromatin immunoprecipitation imaging
(Sm-ChIPi) approach..............................................................24
2 Validation of the Sm-ChIPi approach by using chromatin complexes with known
stoichiometry....................................................................27
3 The cellular assembly stoichiometry of YFP-PRC1 proteins on a mononucleosome....31
4 The fusion proteins function as of their endogenous counterparts.................34
5 The cellular assembly stoichiometry of YFP-PRC1 proteins on a polynucleosomal
array............................................................................38
6 ES-cell differentiation selectively alters the assembly stoichiometry of YFP-Cbx2 protein
on chromatin.....................................................................42
7 The cellular assembly stoichiometry is not affected by the depletion of PRC2 subunit
Eed..............................................................................44
8 Nucleoplasmic PRC1 is monomeric..................................................46
9 PRC2 is a mixture of monomer and dimer, and binds to mononucleosome in a 1:1 or 2:1
stoichiometry....................................................................48
10 Purposed models for the PRC1 and PRC2 association with chromatin fibers..........55
XI


CHAPTER I
INTRODUCTION
In the nucleus, genome organization is shaped by nucleosomes (1). A nucleosome is the building
block of chromatin, consists of-147 bp of DNA wrapped around an octamer histone core
containing of two copies of H2A, H2B, H3, H4 proteins (2). Amino acids on N-terminal tail of
histones are subject to a variety of posttranslational modifications. These modifications include
acetylation of many different lysine residues, methylation of arginine and lysine residues,
phosphorylation of serine and threonine, ubiquitination of lysine, etc. by epigenetic regulatory
complexes (3-5) that directly alter chromatin structure or recruit effectors that influence genome
organization (1,4,6,7). However, detail in vivo molecular mechanism of assembly of epigenetic
complexes on chromatin are poorly understood. (Fig. A)
The polycomb group (PcG) proteins are a long-standing paradigm of studying the
epigenetic inheritance of transcription states and are essential for the establishment and
maintenance of gene transcription profile during normal development and in cancer (8,9). PcG
complexes are categorized in two major groups; Polycomb Repressive Complex (PRC) 1 and 2.
PRC2 is a methyltransferase that catalyzes di- and trimethylation of lysine 27 on histone H3
(H3K27me2/3) (8). The mammalian core PRC2 is composed of Ezh2, Eed, Suzl2 and RbAp48
(Fig. B). Ezh2 is the catalytic subunit and the SET domain is the catalytic core (8), and Eed is
involved in recognition of the H3K27me3 mark (10).
PRC1 is an ubiquitin ligase that catalyzes ubiquitylation of lysine 119 on histone H2A
(H2AK119Ub) (11). In mammals, there are two major form of PRCls have been identified;
canonical PRC1 (cPRCl) (Fig. C) and variant PRC1 (vPRCl) (Fig. D), where both complexes
possess RING1A/RING1B subunits along with a one of the six PCGF family proteins (12). The
1


cPRCl core complex is composed of RinglA/lB, BMI1, PHI, and one of the CBX family
proteins (12) (Figure 3b). vPRCl consists of KDM2 and/or RYBP subunits in association with
RinglA/lB and one of the PCGFx proteins (lacking CBX proteins). CBX and RYBP/YAF2
subunits are mutually exclusive (12) (Fig. D).
Previous studies have suggested several mechanisms for the PcG-mediated gene silencing
such as histone H3K27 trimethylation (13), histone H2A monoubiquitination (11), chromatin
compaction (14), and organization of higher order chromatin structure have been proposed (15).
However, understanding the detail molecular assembly of PcG complexes on chromatin within
cells is not yet clear and remains to be investigated.
2


N
1
N
Figure A. Representative Scheme of histone posttransitional modification on tails of
histones of a nucleosome.
A nucleosome forms by wrapping about 147 bp of DNA around a histone octamer core
consisting of two copies of histones H2A, H2B, H3, and H4. The N-terminus of histones are
subject to the posttranscriptional modifications such as methylation, acetylation,
phosphorylation, and ubiquitination.
3


Figure B. Schematic representation of mammalian core PRC2 proteins.
In mammals PRC2 compose of four core subunits; EZH1/2, EED, SUZ12, and RbAp48. Ezh2 is
the catalytic subunit of PRC2 and it modulates its activity via the SET domain. Eed involves in
recognition of the lysine 27 of histone H3 tail.
4


Mammalian Canonical (cPRCl)
Figure C. Schematic representation of mammalian canonical PRC1 (cPRCl).
Mammalian cPRCl consists of 4 core subunits; RinglA/lB, BMI1 (PCGF), PHI, and one of the
Cbx family proteins.
5


Mammalian Variant (vPRCl)
RYBP/
YAF2
Figure D. Schematic representation of mammalian variant PRC1 (vPRCl).
Mammalian vPRCl consists of RYBP and/or YAF2 subunits association with RinglA/lB and
PCGFx proteins. CBX and RYBP/YAF2 subunits are mutually exclusive.
6


There have been many studies done on the interaction domains and the protein identities
within PRC1 complexes, however, there is not much known about their molecular architecture
on chromatin within cells. Several studies have shown that the PRC1 subunits and their isolated
domains self-associate in vitro (16-20). Obviously, the validity of the in vitro data need to be
confirmed in vivo. In contrast with the observation made for individual PRC1 subunits, the
reconstituted Drosophila PRClis a monomer having one copy of each subunit (14). Studies of
the assembly stoichiometry of PRC 1 on chromatin reached varying views on how PRC1 interacts
with chromatin. The reconstituted Drosophila PRC1 compacts nucleosomal arrays with a
stoichiometry of one PRC1 per tetranucleosome (14). The reconstituted Drosophila PSC
(homolog of Pcgfs) alone bridges nucleosomes with a stoichiometry of one PSC per
mononucleosome (21). A recent crystal structure indicated that one PRC1 ubiquitylation module
binds to each disk surface of a nucleosome (22). These discrepancies could be due to the
compositions of subunits used in the reconstitution reactions or the methods used to perform the
experiments. Therefore, it is significant to resolve these inconsistencies and to determine the in
vivo assembly stoichiometry of PRC 1 complexes on chromatin.
Moreover, observations of the oligomerization status of PRC2 have shown varying views
(23-27). The in vitro reconstituted PRC2 has been characterized as monomer, dimer, or oligomer
(23-25). By using size exclusion chromatography, the endogenous PRC2 complex from both
human and Drosophila was found to have a wide range of molecular weights, ranging from 300
kDa to 1 mDa or higher (26,27). Whereas gel filtration of native complexes cannot exclude the
possibilities that PRC2 may has extended structures or that non-PRC2 proteins associated.
Therefore, the exact molecular stoichiometry of PRC2 within cells remains unknown. By
utilizing electron microscopy (EM) the previous studies suggested that PRC2 exists in
7


monomeric form and may bind to a dinucleosome (25); however, whether the in vitro model
recaptures the in vivo situation remains elusive.
Up to date, few approaches have been developed to quantify the stoichiometry of
epigenetic modifications on histones of nucleosomes (28,29) or in an entire proteome (30), but
addressing the in vivo assembly stoichiometry of epigenetic complexes on chromatin has so far
been hindered by the absence of suitable approach. Chromatin immunoprecipitation (ChIP)
followed by high-throughput sequencing (ChIP-Seq) maps global patterns of histone
modifications and chromatin-binding proteins. However, ChIP-Seq cannot directly reveal
molecular stoichiometry. Sequential ChIP performed on native and purified nucleosomes can
reveal the co-occurrence of epigenetic proteins on chromatin, but it will be a challenge to
establish absolute stoichiometry. Moreover, the other known techniques such as sedimentation
velocity analytical ultracentrifugation and gel filtration chromatography that are often used to
determine the actual molecular sizes of native protein complexes, cannot exclude the influence of
uncharacterized proteins and heterogeneous conformations.
Single-molecule fluorescence microscopy is a sensitive and powerful technique to
quantify the stoichiometry of subunits of macromolecular protein complex (31-33). The
quantification is based on the photobleaching behaviors of fluorophores (32,33) or the ratios of
the fluorescent intensities of fluorophores to the reference fluorophores (31,34,35). Single-
molecule techniques have been widely used to study chromatin biology and it can provided an
intuitive information on nucleosome structure and their dynamics (36-41).
Here, we developed a novel and sensitive approach termed Sm-ChIPi by utilizing genetic
engineering, chromatin biochemistry and single-molecule fluorescence to overcome the existing
8


limitations and to enable directly assessing the assembly stoichiometry of PcG complexes on
chromatin in vivo.
By using Sm-ChIPi, for the first time, we presented the in vivo assembly stoichiometry
of PcG complexes PRC1 and PRC2 on chromatin. We have found that PRC1 and PRC2 employ
distinct mechanisms by which they assemble on chromatin, reflecting their distinct roles in
establishing and maintaining repressive polycomb domains. These results contribute significantly
to our quantitative understanding the cellular architecture of PcG complexes, allowing us to
suggest possible molecular mechanisms for the PcG-mediated epigenetic silencing. Sm-ChIPi is
a direct and sensitive technique and could be applied to many other studies of epigenetic
complex assembly on native chromatin.
9


CHAPTER II
EXPERIMENTAL PROCEDURES
Cell lines and plasmids
The Cbx2~f~ (42), Cbx7~f~ (43), Ring I bfifi; Rosa26: :CreERT2 (44), Bmi C Mel IR (Bmil
and Mell8 double knockout) (45), Eed (44), Ezh2~f~ (46) and PGK12.1 (47) mES cell lines
were maintained in mES medium (DMEM (D5796; Sigma-Aldrich Inc, St Louis, MO)
supplemented with 15% FBS (SH30071.03, Hyclone), 2 mM glutamine (G7513; Life
Technologies, Carlsbad, CA), 100 units/ml penicillin-streptomycin (15140-122; Life
Technologies, Carlsbad, CA), 55 pM P-mercaptoethanol (21985-023; Life Technologies,
Carlsbad, CA), 103 units/ml leukemia inhibitor factor (LIF) and 0.1 mM non-essential amino
acids (11140050; Life Technologies, Carlsbad, CA)) at 37 C and humidity-saturated 5% CO2.
Medium was changed every day unless otherwise indicated. To deplete Ringlb alleles, 4-
hydroxytamoxifen (OHT; H7904; Sigma-Aldrich Inc, St Louis, MO) was administrated for three
days under the concentration of 1.0 pM. HEK293T cells were maintained in DMEM
supplemented with 10% FBS, 2 mM glutamine and 100 units/ml penicillin-streptomycin at 37 C
and humidity-saturated 5% CO2.
The plasmids pTRIPZ(M)-YFP-Cbx2, pTRIPZ(M)-YFP-Cbx4, pTRIPZ(M)-YFP-Cbx7,
pTRIPZ(M)-YFP-Cbx8, pTRIPZ(M)-YFP-Ringlb and pTRIPZ(M)-YFP-Mell8 have been
described previously (48). The sequences encoding Eed (Addgene) and Ezh2 (Addgene) were
amplified by PCR and inserted downstream of the coding sequence of fluorescence protein in
pTRIPZ(M) vector (48). The sequence encoding YFP was amplified by PCR and inserted into
pGEX-6P-l vector (GE Healthcare, Pittsburgh, PA) to generate pGEX-6P-l-YFP (monomeric
10


YFP) and pGEX-6P-l-YFP-YFP (dimeric YFP). The sequences encoding fusion proteins have
been verified by DNA sequencing.
Establishing transgenic mES cell lines
The transgenic mES cell lines have been established stably and inducibly using lentiviral
vector from human immunodeficiency virus (HIV), transferring the gene of interest into murine
embryonic stem cells. HEKT293 cells were cultured 24 hours prior to infection on 100 cm
uncoated tissue culture dish to the confluency of 80% and incubated at 37C and humidity-
saturated 5% CO2. Pseudo-viruses were packaged in HEK293T cells by co-transfecting with 21
pg pTRIPZ(M) containing the fusion gene, 21 pg psPAX2 and 10.5 pg pMD2.G, 2.0 M CaCh,
and 2XHBSS (50mM HEPES pH 7.1, 280 mM NaCl, 1.5 mM sodium phosphate). The mixture
was added to the HEK293T cells drop-wise and incubated at 37C and humidity-saturated 5%
CO2 for 12-16 hours. Cells were fed with fresh 10ml media for 48 hours to produce viruses.
48 hours after packing, medium was collected and used for transducing mES cells.
Hexadimethrine bromide (polybrene; H9268; Sigma-Aldrich Inc, St Louis, MO) was added at
the concentration of 8 pg/ml and cells were seeded at -15% confluence on gelatin-coated plates
or mitotically inactivated MEF cells. 64 hours after infection, infected cells were selected by
using 1.0-2.0 pg/ml puromycin (P8833; Sigma-Aldrich Inc, St Louis, MO). The expression of
transgenes was induced by doxycycline (Dox; D9891, Sigma-Aldrich Inc, St Louis, MO).
Preparation of YFP proteins
The plasmid pGEX-6p-l-YFP and pGEX-6p-l-YFP-YFP were constructed by insertion
of YFP sequence into N-terminus of pGEX-6p-l expression vector (GE Healthcare) once to
produce monomeric YFP and inserted twice sequentially to yield dimeric YFP. YFP sequence
11


was amplified with the following forward and reverse primers ordered from IDT (Integrated and
Technologies);
Amp-YFP-F 5 '-CCCGGAA TTCA TGGTGAGCAA GGGCGA GGA GC TGT-3'
Amp-YFP-R 5' -CCGCTCGAGCTTAGTACAGCTCGTCCATGCCGAGAGTGAT-3'
The amplified YFP gene was fused into N-terminus of pGEX-6P-l expression vectors (GE
Healthcare) with GST-tagged recombinant proteins by double digestion of the YFP insert and the
vector with EcoRI (R31001S, Bio Lab) and Xhol (R0146S, Bio Lab) digestive enzymes,
respectively. The digested products were isolated by 1% agarose gel and they ligated accordingly
to produce pGEX-6p-l-YFP and pGEX-6p-l-YFP-YFPm plasmids. To verify the newly cloned
plasmids, the both plasmids were transformed into DH5a E-coli competent cells (18265-017,
Invitrogen) and plasmid purification performed using AxyPrep plasmid mini-prep kit (AP-MN-
P-50, Axygen). Plasmid sequences were verified by sequencing company (Eton Bio-Science)
using Seq-pGEX-1 YFP primer; 5 -GGCTGGCAAGCCACGTTTGGTGGT-3'.
The plasmids pGEX-6p-l-YFP and pGEX-6p-l-YFP-YFP were transformed into the
BL21 competent cells, respectively. The protein expression was induced by isopropyl-beta-D-
thiogalactopyranoside (AC 121; Omega Bio-Tek, Norcross, GA) for 5 hours at 37 C. Cell pellets
were collected, resuspended in PBS containing 0.1 mM phenylmethanesulfonyl fluoride (PMSF;
93482; Sigma-Aldrich Inc, St Louis, MO) and protease inhibitor cocktail (P8340; Sigma-Aldrich
Inc, St Louis, MO), and sonicated using Vibra-CellTM sonicator (VCX130; Newtown, CT)
under following conditions; 45% amplification, 15 second on, 45 second off for 6 minutes.
To the mixture 1% Triton X-100 was added. After centrifugation, to the supernatant prewashed
GSH-Sepharose 4B beads (17-0756-01; GE Healthcare, Pittsburgh, PA) were added. The
mixture was incubated for 30 min at 4 C. For protein purification, the mixture were transferred
12


to Poly-Prep Chromatography Columns (7311550, BioRad). After 4 x times washing with PBS
containing 1.0% Triton X-100, the YFP proteins were eluted by 5 mM reduced glutathione
(G4251; Sigma-Aldrich Inc, St Louis, MO) at pH 8.0. The purified proteins were concentrated
with Amicon Ultra Centrifugal 3K filter (UFC900308, Millipore) using PBS buffer.
The purity and identity of YFP proteins were assessed by 4-12% SDS-PAGE (NP0322, Novex)
gel electrophoresis and their concentrations were quantified by Coomassie Protein Bradford
Assay (1856209, Thermo Scientific) using manufacturers instructions.
Preparation of nucleosomes from mES cells
Approximately 5 UO8 cells were harvested by citrate saline solution (135 mM potassium
chloride and 15 mM sodium citrate), cross-linked with 2.0% paraformaldehyde for 10 min at 4
C, and quenched with glycine. Cells were collected by centrifuging at 300 g for 5 min at 4 C
and packed cell volume (PCV) was estimated. Pellets were resuspended in 2.5 x PCV of buffer
A (10 mM HEPES pH 7.9, 10 mM KC1, 1.5 mM MgCh, 340 mM sucrose, 10% glycerol, 50
pg/ml BSA, 1.0 mM NasVCL, protease inhibitor cocktail and 0.1 mM PMSF). 2.5 x PCV of
buffer B (buffer A plus 0.2% Triton X-100) was added and the mixture was incubated at 4 C for
10 min. Pellets were collected by centrifuging at 1,300 g for 5 min at 4 C and resuspended with
6 x PCV of buffer A. The mixture was loaded to the top layer of pre-chilled sucrose cushion
(buffer A + 30% sucrose) and centrifuged at 1,300 g for 12 min at 4 C. Chromatin pellets were
resuspended in buffer A containing 1.0 mM CaCh at the DNA concentration of 2.0 pg/ml. To
generate mononucleosomes, chromatin was digested with 1.4 U/ml micrococcal nuclease
(MNase; N5386; Sigma-Aldrich Inc, St Louis, MO; the enzyme activity was defined as Sigma
unit) for 8 minutes at 37 C. To produce polynucleosomes, chromatin was digested with 0.7
U/ml for 8 minutes at 37 C. The reaction was stopped by 4.0 mM EGTA (pH 8.0). To purify
13


mononucleosomes, 5-30% linear sucrose gradient was used. To purify polynucleosomes, 15-40%
linear sucrose gradient was used. Linear sucrose gradients were prepared by dissolving sucrose
in the buffer M (10 mM HEPES pH 7.9, 50 pg/ml BSA, 10 mM KC1, 1.5mM EDTA, 1.0 mM
Na3VC>4, 0.2 mM DTT and 0.5 mM PMSF). Approximately 300-400 pg of DNAs in 0.5 ml were
loaded on the top layer of the gradient and samples were fractioned for 18-20 hours at 200,000 g
using TH-641 Swinging Bucket Rotor and Sorvall WX Ultracentrifuge (Thermo Fisher
Scientific, Waltham, MA). 0.5 ml per fraction was collected. The DNA fragment size of each
fraction was analyzed by 2% agarose gel electrophoresis.
Preparation of nucleosomes from differentiated cells
mES cells were used to induced to differentiate as described previously (49). Briefly,
mES cell lines, Cbx2~/VY-Cbx2, Cbx7" Y-Chx7, Ring I /r/?/? Y-Ring I b and Bmil'/'Mell8'/'/Y-
Mell8, were cultured to reach 80-90% confluency. Approximately 6 x 106 cells were
resuspended in 10 ml DMEM supplemented with 10% FBS, 2 mM glutamine and 100 units/ml
penicillin-streptomycin, and plated in 10-cm polystyrene stackable petri dish (8609-0010; USA
Scientific, Ocala, FL). Medium was changed every 48 hours. On day 4, a final concentration of
500 pM of retinoic acid (R2625; Sigma-Aldrich Inc, St Louis, MO) was administrated. On day 8,
cells were changed with medium containing 2 pg/ml of Dox or Dox with OHT for Ringlbf^/Y-
Ringlb. On day 10, chromatin was isolated and nucleosomes were prepared as described above.
Preparation of tetranucleosomal arrays and their interaction with PRC1
Tetranucleosome reconstitution was performed as described previously by salt dialysis
(50,51). Briefly, recombinant human histone octamer (H2A, H2B, H3.1, and H4), assembled
from E. coli-expressed individual histones as described (50), was added to DNA in
approximately a 1:1 molar ratio in 10 mM Tris-HCl pH 7.6, 2 M NaCl, 1 mM EDTA, 0.5 mg/ml
14


BSA, 0.05% NP-40 and 5 mM P-mercaptoethanol. Salt dialysis was performed at 4 C for
approximately 20 hours from 2 M NaCl buffer to 50 mM NaCl and a final dialysis step for 1
hour at 50 mM NaCl. Samples were incubated at 37 C for 1 hour before storage on ice up to 4
weeks. Extent of chromatinization was assessed by limited MNase digestion. The DNA
template used was an 863 bp PCR fragment amplified from a plasmid construct (M. Balas and A.
Johnson, unpublished data) containing two 601 nucleosome-positioning sequences (52)
flanking five Gal4 binding sites and an adenoviral E4 promoter. The PCR product was amplified
with one 5'-biotin-triethyleneglycol (TEG) primer.
Preparation of nuclear extract from Ring 1 b'VY-Ring 1 bmES cells
Ringl//? /? Y-Ringlh mES cells were cultured in the presence of 0.5 pg/ml doxycycline
and 1.0 pM OHT for three days. Nuclei were purified from 5 x 107 cells and lysed in 1.0 ml
buffer containing 20 mM Tris-HCl pH7.4, 0.5% NP-40, 350 mM NaCl, 0.25 mM EDTA, 10%
glycerol, 0.1 mMNa3V04, protein inhibitor cocktail and 0.1 mMPMSF. 120 pi of biotinylated
tetranucleosomal arrays (18nM) was incubated with 380 pi of nuclear extract at 4 C overnight.
The 0.5 ml of mixture was loaded into 15-40% sucrose gradient and fractioned as described
above. 0.5 ml per fraction was collected and fixed with 0.2% of paraformaldehyde. DNAs was
extracted and analyzed by agarose gel electrophoresis.
Construction and passivation offlow chamber
Flow chambers were constructed as described previously with modifications (32). Two
0.75-mm holes cross from each other were drilled in a quartz slide (12-550-15; Fischer scientific,
Waltham, MA). The slides and coverslips (48366-249; VWR, Radnor, PA) were sonicated with
Milli-Q water for 30 min and incubated with methanol overnight. The coverslips were treated
with 1.0 M KOH for 40 min, dried and burned for 1-2 second with propane torch. Then, the
15


coverslips were incubated with methanol supplemented with 1% aminosilane (N-2-Aminoethyl-
3-Aminopropyltrimethoxysilane (A21541; Pfaltz & Bauer, Waterbury, CT)) and 5% acetic acid
for 20 minutes in the dark at room temperature. After washing with methanol and water, the
coverslips were dried with nitrogen gas and placed in a humidified box in the dark. To each
coverslip 70 pi of the passivated solution (10 mM sodium bicarbonate pH 8.5,16 mg of mPEG-
SVA (MPEG-SVA-5000; Laysan Bio, Arab, AL)), and 0.3 mg of Biotin PEG-SVA (256-586-
9004, Laysan Bio, Arab, AL) was added and incubated in a humidified box for 3-4 hours in the
dark. After washing with Milli-Q water, the coverslips were assembled on the quartz slide by
sandwich a piece of double sided tape between the slide and the coverslip in the way that it
creates approximately 6.0 mm channel where the inlet/outlet holes were located. The edges of
the flow chambers were sealed with epoxy glue (14250; Devcon, Danvers, MA) and stored at -20
C under nitrogen gas.
Imaging by single-molecule total internal reflection fluorescence (TIRF) microscopy
Fractions intended for the Sm-ChIPi analysis were incubated with biotinylated
antibodies, anti-GFP (ab6658; Abeam, Cambridge, England), anti-histone H2B (60R-1215;
Fitzgerald Industries, Acton, MA) and anti-histone H3 (5748; Cell Signaling Technology,
Boston, MA), at 4 C overnight. Flow chamber was loaded with 0.2 pg/ml NeutrAvidin (31000;
Thermo Fisher Scientific, Waltham, MA) and washed with T50 buffer. After cross-linked with
0.5% paraformaldehyde for 15 min at 4 C, 100 pi of the samples were loaded into the flow
chamber. After washing with T50 buffer, images were acquired by using Zeiss Axio Observer
D1 Manual Microscope (Zeiss, Germany) equipped with an Alpha Plan-Apochromatic 100x
/1.46 NA Oil Objective (Zeiss, Germany) and an Evolve 512 x 512 EMCCD camera
(Photometries, Tucson, AZ). The fluorescent intensity of time traces was generated by ImageJ
16


and background intensity was subtracted from area surrounding the spot of interest. The
photobleaching steps were detected by Chang-Kennedy filtering (53). Histogram was
constructed using data from three biological replicates with each measurement of over 100
individual spots analyzed.
Fluorescence correlation spectroscopy (FCS)
FCS measurements were performed at 37 C on a Zeiss LSM780 using a C-Apochromat
infinity color-corrected (ICS) 1.2 NA 40x water objective. Cells were seeded on glass dishes the
day before the experiment. Excitation of YFP was performed with the 488 nm line of a 20mW
argon laser. For intracellular measurements, the desired recording position was chosen in the
LSM image. Autocorrelation curves were derived from fluorescence fluctuation analysis using
the ConfoCor 3 software. Autocorrelation curves were fit to one component models of free
diffusion in 3D with triplet function of the below equation 1 (54):
G(x)
1
1+N
1 +
F e_T/Tt
1 -F
/ \
1
( T )V2
\(1 + ' )
(1)
where xD1 is diffusion time, N is the number of molecules in the confocal volume. The size of
the confocal volume Veff was calibrated using a series dilution of Rhodamine green dye in PBS.
The concentration of YFP-Ringlb was determined by the equation 2:
YFp-Ringlb(FCS)= 602.1^.Veff (2)
The concentration of endogenous Ringlb was determined by the equation 3:
17


Endogenous Ringlb = YFP Ringlb (FCS)
0.90
(3)
where 0.90 is the ratio of endogenous Ringlb to YFP-Ringlb, which was determined by western
blotting. The number of YFP-Ringlb molecules in single mES cell nucleus was calculated by the
equation 4:
where a = b = 5 gm, and c = 2.5 gm. CRinglb is the concentration of endogenous Ringlb
protein.
Chromatin immunoprecipitation (ChIP)
ChIP was performed as described previously (49). Briefly, mES cells were cross-linked
with 1.2% formaldehyde (28908; Thermo Fisher Scientific, Waltham, MA) for 10 min at room
temperature and quenched by 125 mM glycine. Cells were washed sequentially with LBI buffer
(50 mM HEPES pH 7.9, 140 mM NaCl, 1.0 mM EDTA, 10% Glycerol, 0.5% NP-40 and 0.25%
Triton X-100), LBII buffer (10 mM Tris-HCl pH 8.0, 200 mM NaCl and 15 mM EDTA) and
LB III buffer (10 mM Tris-HCl, 100 mM NaCl, 1.5 mM EDTA, 0.1% Na-deoxycholate and 0.5%
N-lauroylsarcosine). Chromatin was fragmented to the size of 200-500 bp by Vibra-CellTM
sonicator (VCX130; Sonics, Newtown, CT) for 60 cycles alternating 20 sec ON, 30 sec OFF
with amplitude of 25%. To verify the size of sonicated chromatin fragments, DNA were
extracted by phenol chloroform (pH 6.6/7.9) (Ambion, AM9730) extraction method. Then, the
DNA fragments were analyzed by 2% agarose gel electrophoresis. To the lysate 1% Triton X-
100 was added and the supernatants were collected at 20000xg for 10 min. Two set of rec-
Protein G beads (101241, Life Technologies, Carlsbad, CA) were pre-washed sequentially with
buffer LBI, LB2, and LB3, respectively, and pelleted each time at 500xg for 3min at 4C.). To
18


the pre cleaned lysates, a fraction of prewashed beads were added to each lysate with lmg/ml
BSA (A7906, Sigma) and 0.25mg/ml salmon DNA sperm (15632-011, Invitrogen) and incubated
at 4C for 2 hours. Clarified soluble chromatins were collected by centrifugation. The rest of the
pre-washed beads were blocked by addition of 2.5mg/ml BSA and 0.25mg/ml salmon DNA
sperm and incubated on the rocker at 4C over night. The pre-clean lysates were incubated with
antibodies, anti-Cbx7 (sc-70232; Santa Cruz Biotechnology, Santa Cruz, CA), anti-Cbx2
(ab80044; Abeam, Cambridge, MA), anti-Mell8 (sc-10744; Santa Cruz Biotechnology, Santa
Cruz, CA), anti-Ringlb (D139-1; MBL, Woburn, MA) and mouse IgG (15381; Sigma-Aldrich
Inc, St Louis, MO), respectively. Prewashed-pre blocked beads were added to the immuno-
complex incubated for 3 hours. The recovered beads were washed multiple times with RIPA
buffer (50mM HEPES pH 7.9, 500mM Li Cl, l.OmM EDTA pH 8.0, 1% NP-40, and 0.7%
sodium deoxycholate). Chromatin-protein complexes were eluted at 65C by addition of 210pl
of room temperature elution buffer (50mM Tris-HCl pH 8.0, lOmM EDTA pH8.0, and 1%
SDS). The immuno-precipitated complexes were separated from the beads and de-crosslinked at
65C over night. The samples were treated with 1.5pl of 20mg/ml RNase A and 2.0pl of 20
mg/ml Proteinase K and incubated at 55C for 2hours for digestion and isolation of DNA
fragments. The DNA fragments were extracted with phenol chloroform (pH 6.6/7.9) procedure.
The immunoprecipitated DNAs were quantified using LightCycler 4800 SYBR green I master
mix (04707516001; Roche, Nutley, NJ) with AB Applied Biosystem. Triplicate PCR reactions
were carried out for each sample. The efficiencies of ChIP were quantified relative to a standard
curve prepared using input chromatin. The sequences of the primers used for qPCR are as
follow;
Gapdh Forward ATCCTGTAGGCCAGGTGATG
19


Gapdh Reverse AGGCTCAAGGGCTTTTAAGG
Neurodl (-2kb) Forward CAAGAAAGTCCGAGGGTTGA
Neurodl (-2kb) Reverse GTCCCAGCCCACTACCAAT
Bdnf (+1.3kb) Forward TTTTTAACCTTTTCCTCCTCCTG
Bdnf (+1.3kb) Reverse TGTCCAAGGTGCTGAATGG
Cdh2 (+2 kb) Forward AGT GGGAGGCC C AGA AGT
Cdh2 (+2 kb) Reverse CGGTGCTGCATAGTGTGG
Hand2 Forward TCCTCAAAAGCAAGACAGGAG
Hand2 Reverse AGCTT GC AACTTCGAAGGAA
Immunoprecipitation (IP)
IP was performed as described previously (49). Briefly, nuclei were purified from 3 x 108
cells and lysed using buffer containing 20 mM Tris-HCl, pH 7.4, 0.1% NP-40, 350 mM NaCl,
0.25 mM EDTA, 20% glycerol, 0.1 mM Na3VC>4, 0.1 mM PMSF and protein inhibitor cocktail.
After pre-cleaned with protein G beads, the lysate was incubated with anti-GFP mAb-agarose
beads (D153-8; MBL, Woburn, MA). The beads were washed using buffer containing 20 mM
Tris-HCl, pH 8.0, 1% NP-40, 200 mM KC1, 0.2 mM EDTA and 0.1 mM PMSF. The proteins
were resolved using NuPAGE 4-12% Bis-Tris Gel (NP0321BOX; Life Technologies, Grand
Island, NY) and were transferred to 0.45-pm Immobilon-FL polyvinylidene fluoride membrane
(Millipore, Darmstadt, Germany). Specific proteins were probed with anti-Phcl (6-1-3; Active
Motif, Carlsbad, CA) and anti-Ringlb (D139-3; MBL, Woburn, MA), and detected with ECL
Plus (GE Healthcare, Pittsburgh, PA). Membranes were imaged using a ChemiDoc XRS system
(Bio-Rad, Hercules, CA).
20


Immunofluorescence (IF)
IF was performed as described previously (49). Wild-type, Ezh2'/~, Eedf\ Ezh2'/'/Y-Ezh2
and Eed'/Y-Eed mES cells were plated on coverslips and cultured for 24 h. Cells were fixed
using 2.0% paraformaldehyde for 10 min. Cells were washed with PBS and incubated with 0.2%
Triton X-100 for 10 min. After washing with basic blocking buffer (10 mM PBS, pH 7.2, 0.1%
Triton X-100 and 0.05% Tween 20), cells were incubated with blocking buffer (basic blocking
buffer plus 3% goat serum and 3% bovine serum albumin) for 1 h. Anti-H3K27me3 antibody
(07-449, Millipore, Billerica, Massachusetts) diluted in blocking buffer was incubated with cells
for 2 h at room temperature. After washing with basic blocking buffer, Alexa 488-labeled goat
anti-rabbit antibody (A-11008, Life Technologies, Carlsbad, CA) diluted in blocking buffer was
incubated with cells for 1 h. Cells were rinsed with PBS and washed with basic blocking buffer.
After incubating with O.lpg/ml hoechst, cells were washed and mounted on slides with ProLong
Antifade reagents (P7481; Life Technologies, Carlsbad, CA). The images were taken and
processed as described previously (48).
21


CHAPTER III
RESULTS
Development of a novel approach to investigate the in vivo assembly stoichiometry of PcG
complexes on chromatin
To investigate the in vivo assembly stoichiometry of PcG complexes on chromatin, we
developed a novel Sm-ChIPi approach (Fig. 1), which is based on single molecule fluorescence
microscopy. To eliminate the possibility of interference of existing endogenous counterpart
proteins with fusion proteins in the cell, all the YFP-PcG fusion genes were stably and inducibly
expressed in their corresponding knock out mES cells. To preserve association of PcG complex
with chromatin during purification, cells were crossed linked with paraformaldehyde prior to cell
lysis. The extracted PcG-chromatin was subjected to MNase digestion to produce mono-, di-, and
poly-nucleosome fractions. The PcG-nucleosome complexes further separated by sucrose
gradient ultracentrifugation.
The isolated fractions planned to analyze were incubated with biotinylated antibodies
against either YFP or histone. The resulting complexes were immobilized on a quartz slide that
had been passivated and functionalized with NeutrAvidin via biotin-NeutrAvidin interaction.
TIRF microscopy was used to acquire image stacks with laser excitation to excite fluorescent
proteins associated with protein complex. Image stacks allow to identify surface bound
molecules as distinct spots. Each discrete spot is a representation of a single YFP-PcG-
nucleosome complexes. ImageJ was used to create the time traces of fluorescent intensity from
the acquired image stacks. Chung-Kennedy filtering (53) was used to identify the
photobleaching steps of fluorophores which correspond to the number of YFP fluorophore
associated with protein. For example, if one YFP-PcG protein present in the complex, thus, one
22


photobleaching step in the time trace of fluorescent intensity would be observed. If there are five
YFP-PcG present in the complex, they will bleach in the sequential order, therefore, five
photobleaching steps would be detected.
To certify the Sm-ChIPi approach, we generated monomeric and dimeric YFPs. The YFP
proteins were immobilized on the passivated NeutrAvidin coated coverslip via biotinylated anti-
GFP antibody (Fig. lb-c). TIRF microscopy was used to detect the discrete points on the surface,
indicating individual YFP proteins. The functionalized coverslip prevents non-specific binding
of YFP proteins to the surface. Analysis of fluorescence trajectories of monomeric YFPs
indicated that 97% of spots are one-step photobleaching while 3% are two-step photobleaching,
which accounts for random colocalization (Fig. lb). For dimeric YFPs, 70% were two-step
photobleaching (Fig. lc), which is consistent with the previous report of a probability of p = 0.80
for an individual YFP protein to be fluorescent (55). The 3% and 70% values were used to
predict the assembly stoichiometry of PcG complexes on chromatin, which was reported in the
text unless otherwise indicated.
23


a
b
Monomeric YFP
PcG gene KO mES cells
I YFP-PcG fusion
I gene transduction
I Chromatin extraction
I MNase digestion
Sucrose gradient
^ ultracentrifugation
I Immoblization
I by antibody

0-----YFP
NeutrAvidin -
Nucleosome
----Antibody
Ji ^.Biotin
----PEG
Quartz
slide
Single-molecule TIRF microscope
c
Dimeric YFP
Time
Steps
Figure 1.
24


Figure 1. Schematic representation of single-molecule chromatin immunoprecipitation
imaging (Sm-ChIPi) approach. KO mES cells stably expressing YFP-PcG fusion proteins were
generated using lentiviral transduction. Chromatins are extracted from these cell lines and
subjected to MNase digestion. PcG-nucleosome complexes are further purified with sucrose
gradient centrifugation. The isolated nucleosomes are immobilized by biotinylated antibody
against either YFP or histone on a quartz slide that has been passivated and functionalized with
NeutrAvidin. Singe-molecule TIRF microscopy is used to acquire image stacks to assess the
cellular stoichiometry of PcG complex on chromatin, (b-c) Photobleaching behavior of
monomeric (b) and dimeric (c) YFPs. The YFP proteins are immobilized on the passivated
NeutrAvidin coated coverslip by biotinylated anti-GFP antibody. Images stacks are acquired
with TIRF microscopy and fluorescent intensity of time trace (black lines) were analyzed by
Image J. The photobleaching steps were identified by Chung-Kennedy filter (red lines). Three
biological replicates are analyzed with each measurement containing over 100 individual spots
and results are mean SD. Scale bar, 5 pm.
25


Validation of Sm-ChIPi approach by using known stoichiometry protein complexes
To further verify the accuracy of the Sm-ChIPi approach, we counted the number of
H3.3-EGFP within a nucleosome (Fig. 2a-e). Mononucleosomes were prepared from H3.3~ ~
/H3.3-EGFP DT40 cells where both H3F3A and H3F3B have been depleted (48). The H3.3-
EGFP-mononucleosomes were immobilized on the passivated NeutrAvidin coated coverslip by
biotinylated anti-H2B antibody. Analysis of fluorescence trajectories indicated that (75 2)% of
spots are two-step photobleaching. If the probability of an individual EGFP to be fluorescent was
taken into account, 100% of EGFP-H3.3-nucleosome had a dimeric EGFP-H3.3.
To examine whether the Sm-ChIPi approach can detect oligomers of protein on a
nucleosome, we analyzed oligomerization of EGFP-KAPlon a nucleosome (Fig. 2f-j) since
KAP1 forms trimer in solution (61). EGFP-KAP1 was transiently expressed in HEK293T cells.
The presence of endogenous KAP1 protein prevents quantifying the exact stoichiometry of
KAP1 on nucleosome, while overexpression allows assessing its oligomerization status.
Mononucleosomes were prepared from EGFP-KAP1 -transfected HEK293T cells and
immobilized on the passivated NeutrAvidin coated coverslip by biotinylated anti-H2B antibody.
Analysis of fluorescence trajectories indicated that 4%, 16%, 25%, 20%, 17%, and 18% of spots
are one-, two-, three-, four-, five-, and six-step photobleaching, respectively. Our data suggest
that one nucleosome can associate with up to six KAP1 proteins. In summary, the Sm-ChIPi
approach is a direct and sensitive technique to quantitatively assess assembly stoichiometry of
epigenetic complex on chromatin.
26


M
fi)
Fluorescence (a.u.)
o
adder
Ladder

Nudeosomal
DNA
Nudeosomal
DNA
dJ03-££H/+££H


Figure 2. Validation of the Sm-ChIPi approach by using chromatin complexes with known
stoichiometry, (a-e) H3.3~~/H3.3-EGFP DT40 cells contain dimer of H3.3-EGFP within a
nucleosome. Agarose gel electrophoresis analysis of DNAs extracted from nucleosomes
prepared from H3.3~~/H3.3-EGFP DT40 cells (a). Nucleosomes were immobilized on the
passivated NeutrAvidin coated coverslip surface by biotinylated anti-H2B antibody (b). A
sample single image of the acquired sequence by TIRF microscopy is shown (c). A
representative of distribution of two-step photobleaching of fluorescence trajectory (black line)
detected by Chung-Kennedy filter (red line) is shown (d). The percentage of photobleaching
steps of H3.3-EGFP within a nucleosome (e). (f-j) EGFP-KAP1 expressed in HEK293T cells
oligomerizes on a nucleosome. Agarose gel electrophoresis analysis of DNAs extracted from
nucleosomes prepared from HEK293T/EGFP-KAP1 cells (f). Nucleosomes were immobilized
on the passivated NeutrAvidin coated coverslip by biotinylated anti-H2B antibody (g). The
arrowheads imply that EGFP-KAP1 oligomerizes stepwise on a nucleosome. A representative
single molecule image of the acquired sequence is shown (h). Samples of fluorescence
trajectories (black line) and photobleaching steps detected by Chung-Kennedy filter (red line) are
shown (i). The percentage of photobleaching steps of EGFP-KAP1 on a nucleosome. Results are
means SD. The a.u. denotes arbitrary unit. Scale bar, 5 pm.
28


The cellular assembly stoichiometry of YFP-PRC1 proteins on a mononucleosome in vivo
To quantify the stoichiometry of PRC 1 complex to mononucleosome in vivo, we
introduce the YFP-PRC1 fusion genes, Y-Cbx2, Y-Chx7, Y-Mell8 and Y-Ringlb, into knock out
mES cells, respectively. Cbx2, Cbx7 and Mel 18 are the core subunits of canonical PRC1
(cPRCl) complexes and all of the other PRC1 complexes contain Ringlb in the core subunit (8).
The expression of the fusion proteins were induced by 0.5pg/ml Dox unless otherwise indicated.
Ring I //7/; Rosa26::CreERT2 cells were incubated with l.OpM OHT for 3 days to deplete Ringlb
locus (hereafter Ringlb' '). The YFP-PRCl-nucleosome complexes were isolated from cells and
fractionized by ultracentrifugation. Agarose gel electrophoresis was used to analyze the
distribution of nucleosomal DNAs extracted from ultracentrifugation fractions (Fig. 3a). Fraction
18, the peak of mononucleosomes, was selected for the Sm-ChIPi analysis. The YFP-PRC1-
mononucleosome complexes were immobilized on the passivated NeutrAvidin coated coverslip
by biotinylated anti-H3 antibody (Fig. 3b). The Sm-ChIPi analysis indicated that 98.6%, 97.2%,
97.2% and 97.2% of individual fluorescent spots had one molecule of YFP-Cbx2, YFP-Cbx7,
YFP-Mell8 and YFP-Ringlb, respectively (Fig. 3b). These data suggest an assembly
stoichiometry of 1:1 for PRC1 to mononucleosome.
To rule out issues of histone epitope accessibility, we immobilized the YFP-PRC1-
mononuclesome complexes by biotinylated anti-H2B antibody as well (Fig. 3c). The same
results were obtained by utilizing ani-H2B antibody instead of anti-H3 antibody to immobilize
the YFP-PRCl-mononuclesome complexes. In addition, we also immobilized the YFP-PRC 1-
mononucleosome complexes by biotinylated anti-GFP antibody (Fig. 3d). The immobilization
produced the same results as the immobilization by antibodies against histones. To investigate
whether the expression level of protein influence the assembly stoichiometry, we prepared
29


mononucleosomes from Cbx2~/'7Y-Cbx2 mES cells in the presence of varying Dox
concentrations. The assembly stoichiometry of YFP-Cbx2 to a mononucleosome was not
affected by its protein expression level (Fig. 3e). Since sucrose gradient ultracentrifugation is
based on the volume and mass of particles, it is possible that the assembly stoichiometry may be
different among fractions. The Sm-ChIPi analysis showed that fractions 22 and 23 have the same
assembly stoichiometry as fractionl8 (Fig. 3f).
To seek out independent evidence for the assembly stoichiometry, we performed a single
molecule colocalization assay (Fig. 3g), both YFP-Cbx2 and mCherry-Cbx2 fusion proteins were
co-expressed in the Cbx2~/~ mES cells. The cross-linked mononucleosome fractions were
prepared as above. The single-molecule colocalization analysis showed that 2.3% of YFP-Cbx2
and mCherry-Cbx2 overlap, which accounts for random colocalization. The same analysis
displayed 1.4% of YFP-Cbx7 and mCherry-Cbx7 colocalize. Moreover, both YFP-Cbx2 and
mCherry-Cbx7 fusion proteins were co-expressed in Cbx7~f~ mES cells. Analysis as above
showed that 2.3% of YFP-Cbx2 and mCherry-Cbx7 colocalize. Thus, these data suggest that one
PRC1 binds one mononucleosome in vivo.
30


^ Top 5-30% sucrose gradient Bottom
JC10 11 12 13 14 15 16 17 18 19 20 21 22 23
100-
---5
Cbx2'-!Y-Cbx2 Cbx7'-!Y-Cbx7 Ringlb'IY-Ringlb Mel18'/Y-Mel18
100-. 100-. 100-| 100-,
'iL'dL'iL tL
1 2
Steps
1 2
Steps
1 2
Steps
1 2
Steps
Cbx2r/- !Y-Cbx2 Cbx7'IY-Cbx7 Ringlb'IY-Ringlb Mel18-'IY-Mel18
11 100100-, 100-t
'iL'iL'iL :1L
1 2
Steps
1 2
Steps
1 2
Steps
1 2
Steps
Cbx2'/Y-Cbx2 Cbx7-/-IY-Cbx7 Ringl bJ-IY-Ring1 b Mel18'/Y-Mel18
100-, 100-1 100-. 100-,
iL'JLJL iL
e Cbx2'/Y-Cbx2
100-1
50-
1 2
Steps
0 pg/ml Dox
0.5 pg/ml Dox
2.0 pg/ml Dox
1 2
Steps
1 2
Steps
1 2
Steps
9 YFP-Cbx2 mCherry-Cbx2 Overlay
YFP-Cbx7 mCherry-Cbx7 Overlay
Steps
f Cbx2'YY-Cbx2
100n
150-
Fraction 22
Fraction 23
YFP-Cbx2 mCherry-Cbx7 Overlay
Steps
Figure 3.
31


Figure 3. The cellular assembly stoichiometry of YFP-PRC1 proteins on a
mononucleosome. (a) Agarose gel electrophoresis analysis of nucleosomal DNAs extracted
from fractions of 5-30% sucrose gradient. Nucleosomes were extracted from Cbx2~//Y-Cbx2,
Cbx7~~ Y-Cbx7, Ring lb~~/Y-Ring lb and Me lIX ~ Y-Me 118 mES cells. A sample image of agarose
gel is shown. Fraction 18 indicated by arrowhead below the gel was used for single-molecule
TIRF imaging, (b-d) The percentage of fluorescence photobleaching steps of YFP-Cbx2, YFP-
Cbx7, YFP-Ringlb and YFP-Mell8 on a mononucleosome from fraction 18. The YFP-PRC1-
nucleosome complexes were immobilized on the passivated NeutrAvidin coated coverslip by
biotinylated antibodies directed against H3 (b), H2B (c) and GFP (d). Results are means SD.
(e) The percentage of fluorescence photobleaching steps of YFP-Cbx2 on a mononucleosome
prepared from Cbx2~/VY-Cbx2 cells in the presence of Dox concentrations of Opg/ml (black bar),
0.5pg/ml (red bar), or 2.Opg/ml (green bar). The YFP-Cbx2-nucleosome complexes were
immobilized on the passivated NeutrAvidin coated coverslip by biotinylated anti-H3 antibody.
Results are means SD. (f) The percentage of fluorescence photobleaching steps of YFP-Cbx2
on a mononucleosome from fractions 22 and 23. The YFP-Cbx2-nucleosome complexes were
immobilized on the passivated NeutrAvidin coated coverslip by biotinylated anti-H3 antibody.
Results are means SD. (g) Single-molecule colocalization analysis. YFP-Cbx2 and mCherry-
Cbx2 were stably coexpressed in Cbx2~/~ mES cells (top). YFP-Cbx7 and mCherry-Cbx7 were
stably coexpressed in Cbx7'/~ mES cells (middle). YFP-Cbx2 and mCherry-Cbx7 were stably
coexpressed in Cbx7~f~ mES cells (bottom). The PRCl-nucleosome complexes from fraction 18
were immobilized by biotinylated anti-H3 antibody. YFP (left) and mCherry (center) were
imaged. Overlay of the two images (right) shows 2-3% colocalization. Scale bar, 5 pm.
32


The fusion proteins interact with subunits of PRC1 and they occupy endogenous target genes
To assess whether the YFP-PRC1 fusion proteins behave as their endogenous
counterparts, we performed biochemical assays. To compare the level of the fusion proteins to
their endogenous counterparts, we performed western-blotting experiments. The analyzed data
indicated that the levels of YFP-Cbx7 and YFP-Ringlb are similar to that of their endogenous
counterparts at 0.5pg/ml of Dox while the background expression level of YFP-Cbx2 is similar
to that of its endogenous counterpart (Fig. 4a).
To test whether the fusion proteins form PcG complexes, we performed co-
immunoprecipitation (Co-IP) experiments. The Co-IP data indicated that YFP-Cbx2, YFP-Cbx7
and YFP-Mell8 precipitate endogenous Ringlb and Phcl while YFP-Ringlb precipitates
endogenous Phcl (Fig. 4b). In addition, to investigate whether PRC1 fusion proteins occupy
promoters of endogenous genes, we performed chromatin immunoprecipitation (ChIP) assay.
The ChIP data analysis indicated that YFP-Cbx2, YFP-Cbx7, YFP-Ringlb and YFP-Mell8 are
enriched at the promoters of known PRC1 target genes (Fig. 4c). Thus, these data indicate that
the YFP fusion proteins functions as their endogenous counterparts.
To quantify the exact number and the concentration of PRC1 complexes in mES cells, we
performed Fluorescence Correlation Spectroscopy (FCS) experiments (Fig. 4d). The
concentration and the number of Ringlb were estimated to be 0,12pM assuming that the
approximate ES cell nucleus size is 10 x 10 x 5 pm ellipsoid. The quantified Ringlb protein in
live cells was approximately 18,000 molecules. Furthermore, the number of polycomb domains
has been estimated to be about 16,000 (6). Thus, the number of PRC 1 complexes roughly equals
to the number of polycomb domains.
33


UJ
-P>
s
era
c
Ponceau S
staining
m m -c 73
3 3 TUI
o. a tj a
73-

o o
CO CO
CD CD
o o
o o
c c
CO c/)
Z ZJ 'ti
o' o' O ;
co CQ C/)v
t O O O ~0
^ ^ ^ CD o'
05 IO W 0(0
H- I
o,
o ;_
0^0
3 *
^
CD 2
O
c_
CD
w
G(t)
Ponceau S
staining
o
-ft
o
0)
o §
I
I
Ponceau S
staining
< Q
o
i
o
-v|
* Q
O x
5 N
Zl
0
1
H a
_ 3'
O (Q
tr
$
73
3'
* 3
30 ='
§! ChIP (% Input)
Hand2
ChIP (% Input)
Gapdh
Neurodl
Bdnf
Cdh2
Hand2
1
L
ChIP (% Input)
o
3 5?
*
O
ChIP (% Input)
IO
0) 3 1 Gapdh
Neurodl
i 2 CD Bdnf
a
CO 5L Cdh2
00 Hand2
O
Cr
X
2
*
O
o-
X
Nl
7C
73
-f. a
It
S. 3
&-^a
ct> r*
s'?
f. o 'x
8 ?
^7: o
r\ o-
Anti-GFP Anti-Phc1 Anti-Ring1b
Input


Figure 4. The fusion proteins function as of their endogenous counterparts, (a) Western-
blot analysis of protein levels using antibodies directed against endogenous proteins. Ponceau S
staining was used for the loading control. indicates nonspecific bands, (b) IP analysis of the
interaction of endogenous Ringlb and Phcl with YFP-PRC1 fusion proteins. Extracts were
precipitated by anti-GFP antibody. The precipitates were analyzed by immunoblotting using
antibodies directed against Ringlb and Phcl. The input contained 5% of the extract. WT denotes
PGK12.1 mES cells. indicates nonspecific bands, (c) ChIP analysis of the binding YFP-PRC1
fusion proteins to endogenous target gene promoters. The fragmented chromatins isolated from
Cbx2~/VY-Cbx2, Cbx7~/~/Y-Cbx7, Ringlb'YY-Ringlb and Me!1H~~ Y-Me/I8 mES cells were
precipitated using antibodies directed against Cbx2, Cbx7, Ringlb and Mel 18, respectively.
Results are means SD. (d) Quantification of the number and the concentration of Ringlb-PRCl
complexes in mES cells. The autocorrelation curves (black dot line) were fitted with one
component model of free diffusion in 3D with triplet function (red line). The table shows the
ratio of endogenous to YFP-tagged Ringlb protein (En/Ex) detected by western-blotting, the
concentration of endogenous Ringlb and YFP-Ringlb fusion, and the number of endogenous
Ringlb protein.
35


The cellular assembly stoichiometry of YFP-PRC1 proteins on a polynucleosomal array
Although fraction 23 of the sucrose gradients typically contains both mononucleosomes
and dinucleosomes, 97.2% of individual fluorescent spots have one YFP-Cbx2 molecule, which
suggests that at least a dinucleosome can associate with one PRC1 (Fig. 3a and Fig. 3f).
To further investigate the assembly stoichiometry of YFP-PRC1 to polynucleosomes, we
isolated nucleosomes containing mono-, di-, tri-, and polynucleosomes by a different MNase
digestion condition (Fig. 5a). Fraction 19 used for the Sm-ChIPi analysis contained (48 2)%,
(31 5)% and (20 6)% of mononucleosomes, dinucleosomes and trinucleosomes, respectively.
The mixture of nucleosomes was immobilized by biotinylated anti-H3 antibody on the passivated
NeutrAvidin coated coverslip (Fig. 5c). The Sm-ChIPi analysis indicated that 94.3%, 94.3%,
95.8% and 94.7% of individual fluorescent spots had one molecule of YFP-Cbx2, YFP-Cbx7,
YFP-Mell8 and YFP-Ringlb, respectively (Fig. 5d). Thus, these data indicate that one PRC1
can associate with a trinucleosomes.
To further investigate the assembly stoichiometry of PRC 1 complex, we generated a
mixture of nucleosomes containing nucleosomal arrays larger than trinucleosomes (Fig. 5b).
Fraction 22 contained (16 9)% and (10 5)% of pentanucleosomes and hexanucleosomes,
respectively. The Sm-ChIPi analysis of fraction 22 showed that 7.1%, 8.6%, 7.1% and 5.7% of
individual fluorescent spots had two molecules of YFP-Cbx2, YFP-Cbx7, YFP-Mell8 and YFP-
Ringlb, respectively (Fig. 5d), indicating that one PRC1 complex can associate with multiple
nucleosomes. Fraction 23 contained (17 6)% and (12 5)% of hexanucleosomes and
heptanucleosomes, respectively. The Sm-ChIPi analysis of fraction 23 showed that 20%, 18.6%,
22.9% and 18.6% of individual fluorescent spots had two molecules of YFP-Cbx2, YFP-Cbx7,
36


YFP-Mell8 and YFP-Ringlb, respectively (Fig. 5d). Together, these data suggest that one PRC1
can associate with multiple nucleosomes.
Investigation of assembly stoichiometry of YFP-PRC1 at reconstitutedpolynucleosomes
To provide additional evidence of the PRC1 association with multiple nucleosomes, we
reconstituted tetranucleosomal and 15-mer polynucleosomal arrays from recombinant histone
octamers with biotin at one end (Fig. 5e-g). The biotin-nucleosomal arrays were incubated with
nuclear extract from Ring I b~ Y-Ring I b mES cells (Fig. 5e). The mixture was subject to sucrose
gradient ultracentrifugation and fractions containing the nucleosomal arrays (fractions 22 and 23)
were analyzed. The YFP-Ringlb-PRCl-polynucleosome complexes were immobilized by biotin
on the passivated NeutrAvidin coated coverslip. Analysis of fluorescence trajectories indicated
that 4.2% and 5.7% of individual fluorescent spots have two molecules of YFP-Ringlb on a
tetranucleosome for fractions 22 and 23, respectively (Fig. 5f), and 30% of individual fluorescent
spots has two molecules of YFP-Ringlb on a 15-mer polynucleosome. Interestingly, there were
no three molecules of YFP-Ringlb on a 15-mer polynucleosome. Thus, these data suggest that
one PRC1 can potentially associate with 7 nucleosomes.
37


a
£ _g- 15-40% sucrose gradient
a o Top Bottom
2 o -------------------------------
C-13 14 15 16 17 18 19 20 21
t
b
S _§- 15-40% sucrose gradient
o o Top Bottom
5 C. 15 16 17 18 19 20 21 22 23
100
t t
Cbx2/IY-Cbx2
Cbx7vIY-Cbx7
100
100
50
Steps
100
sS 50
Ring 1 b~A IY-Ring1b
Steps
Steps
Mel18'IY-Mel18
100
Steps
Nuclear extact +
Biotin-tetranucleosome
I
Sucrose gradient
by ultracentrifugation
I
o: 15-40% sucrose gradient
2 o Top Bottom
--------------
19 20 21 22 23
100
50
Fraction 22
Fraction 23
Immbolization and imaging
Steps
Figure 5.
38


Figure 5. The cellular assembly stoichiometry of YFP-PRC1 proteins on a polynucleosomal
array, (a-b) Agarose gel electrophoresis analysis of nucleosomal DNAs extracted from fractions
of 15-40% sucrose gradient. Nucleosomes were prepared from Cbx2 Y-Cbx2 ChxT- Y-Cbx7
Ring lb~~/Y-Ring lb and Me 11S~~ Y-Me118 mES cells. Representative images of agarose gel are
shown. Fractions 19, 22 and 23 indicated by color-coded bars below the gels were used for
single-molecule TIRF imaging, (c) Schematic demonstration of the immobilization of YFP-
PRCl-nucleosome complex on the surface by biotinylated anti-H3 antibody, (d) The percentage
of fluorescence photobleaching steps of YFP-Cbx2, YFP-Cbx7, YFP-Ringlb and YFP-Mell8 on
a polynucleosomal array. The color-coded bars are described in (Fig. 5a-b). The black bar
indicates the percentage of photobleaching steps of YFP-PRC1 proteins on a mononucleosome,
which is replicated from (Fig. 3b). Results are means SD. (e) A flow diagram describes the
approach used for analyzing the assembly stoichiometry of YFP-Ringlb-PRCl complex on a
reconstituted tetranucleosomal array (f) and a 15-mer polynucleosomal array (g). (f-g) Agarose
gel electrophoresis analysis of nucleosomal DNAs extracted from the fractions indicated above
the gel (left). Representative single images of the acquired sequences are shown (middle). The
percentage of fluorescence photobleaching steps for samples from fractions indicated is shown.
Results are means SD. Scale bar, 5 pm.
39


ES-cell differentiation selectively alters the assembly stoichiometry of YFP-Cbx2 protein on
chromatin
Pluripotent and differentiated cells have distinct features of chromatin (62, 63). To further
investigate whether the ES-cell differentiation can influence assembly stoichiometry of PRC1 -
nucleosome complex, KO mES cells complemented with the YFP-PRC1 fusion gene were
induced to differentiation by forming embryoid bodies (EBs). After 10-day differentiation, the
YFP-PRCl-mononucleosome complexes were prepared and immobilized (Fig. 6a-c). The Sm-
ChlPi analysis of the mononucleosome fraction 15 indicated a 1:1 assembly stoichiometry of
PRC1 to mononucleosome (Fig. 6d), which is the same as undifferentiated mES cells. The Sm-
ChlPi analysis of fraction 20 indicated that 17.1%, 7.1%, 6.6% and 8.6% of individual
fluorescent spots have two molecules of YFP-Cbx2, YFP-Cbx7, YFP-Mell8 and YFP-Ringlb,
respectively (Fig. 6d), indicating that a two-fold larger fraction of the Cbx2-containing PRO
complex associates with dinucleosomes. These data suggest that a dinucleosome can associate
with two molecules of Cbx2 that is in contrast with undifferentiated mES cells.
To further investigate whether ES cell differentiation selectively alters the stoichiometry
of Cbx2 to polynucleosome, we performed a limited digestion of chromatin by reducing MNase
concentration (Fig. 6b). Fraction 22 and 23 contained nucleosomal array larger than
trinucleosome (Fig. 6b). The Sm-ChIPi analysis of fraction 22 indicated that 31.0%, 12.9%,
11.4% and 10.0% of individual fluorescent spots have two molecules of YFP-Cbx2, YFP-Cbx7,
YFP-Mell8 and YFP-Ringlb, respectively (Fig. 6d). The Sm-ChIPi analysis of fraction 23
indicated that 52.8%, 25.7%, 27% and 31% of individual fluorescent spots have two molecules
of YFP-Cbx2, YFP-Cbx7, YFP-Mell8 and YFP-Ringlb, respectively (Fig. 6d). Therefore, these
data further indicated that a two-fold larger fraction of the Cbx2-containing PRC1 complexes
40


associates with nucleosomes that have a second PRC1 complex bound. In sum, these
observations suggest that ES-cell differentiation selectively alters the assembly stoichiometry of
YFP-Cbx2 protein on chromatin.
41


.S' 15-40% sucrose gradient 53 S' 15-40% sucrose gradient
5 o Top____________________________Bottom ;g 0 Top__________________________________Bottom
23 C. 15 16 17 18 19 20 21 22 23
23 C. 13 14 15 16 17 18 19 20 21

100- ^
f JilMllHi
t t t
Cbx2'IY-Cbx2
Cbx7'!Y-Cbx7
Ring 1b'l Y-Ring 1 b
100-. 100-. _ 100-. 100-. _
Li IL. IL. IL.
Steps
Steps
Steps
Steps
Figure 6.
Figure 6. ES-cell differentiation selectively alters the assembly stoichiometry of YFP-Cbx2
protein on chromatin, (a-b) Agarose gel electrophoresis analysis of nucleosomal DNAs
extracted from fractions of 15-40% sucrose gradient. Nucleosomes were prepared from Cbx2~/~
/Y-Cbx2, Cbx7~f~/Y-Cbx7, Ringlb~ ~/Y-Ringlb and Me/1Y-Me//8 differentiated mES cells.
Representative images of agarose gel are shown. Fractions 15, 20, 22 and 23 indicated by color-
coded bars below the gels were used for single-molecule TIRF imaging, (c) Schematic
representation of the immobilization of YFP-PRCl-nucleosome complex on the surface by
biotinylated anti-H3 antibody, (d) The percentage of fluorescence photobleaching steps of YFP-
Cbx2, YFP-Cbx7, YFP-Ringlb and YFP-Mell8 on a nucleosome prepared from the
differentiated mES cells. The color-coded bars are described in (Fig. 6a-b). Results are means
SD.
42


The assembly stoichiometry is not affected by the depletion of PRC2 subunit Eed
Previous studies have shown that the histone tails of the nucleosome are not required for
compacting nucleosomal arrays by PRC1 (14). To test the effects of PRC2 on the native PRC1-
nucleosome stoichiometry, we took advantage of the fact that Cbx4 and Cbx8 are not expressed
in mES cells (64). YFP-Cbx4 and YFP-Cbx8 fusion proteins were expressed in lied KO mES
cells, respectively. Nucleosomes were prepared and immobilized on the passivated NeutrAvidin
coated coverslip by anti-H3 antibody (Fig. 7a and 7c). The Sm-ChIPi analysis of the
mononucleosome fraction 15 showed that 97.0% and 97.4% of individual fluorescent spots have
one molecule of YFP-Cbx4 and YFP-Cbx8, respectively (Fig. 7d). The Sm-ChIPi analysis of the
polynucleosome fraction 23 indicated that 26.9% and 26.3% of fluorescent spots have two
molecules of YFP-Cbx4 and YFP-Cbx8, respectively (Fig. 7d).
For a control, we established wild-type mES cells that stably express YFP-Cbx4 and
YFP-Cbx8, respectively. Nucleosomes were prepared on the passivated NeutrAvidin coated
coverslip and immobilized by anti-H3 antibody as above (Fig. 7b and 7c). The Sm-ChIPi
analysis of the mononucleosome fraction 15 indicated that 97.1% of individual fluorescent spots
have one molecule of both YFP-Cbx4 and YFP-Cbx8, respectively (Fig.7e). The Sm-ChIPi
analysis of the polynucleosome fraction 23 showed that 25.4% and 27.8% of individual
fluorescent spots have two molecules of YFP-Cbx4 and YFP-Cbx8, respectively (Fig. 7e). Thus,
these data indicate that the PRC2 Eed protein does not affect the cellular assembly stoichiometry
of YFP-Cbx4 and YFP-Cbx8 on chromatin.
43


Ee&'/Y-Cbx4 or Eed'/Y-Cbx8
as .a 15-40% sucrose gradient
2 o Top Bottom
ro ----------------------------------
> ^ 15 16 17 18 19 20 21 22 23
Eed*/*!Y-Cbx4 or Eed+/+IY-Cbx8
100
ill
III
Eed-//Y-Cbx4
Ee&'IY-Cbx8
Eed*'* IY-Cbx4
Eed*'*IY-Cbx8
100
100
Steps
100
Steps
100
Steps
Steps
Figure 7.
Figure 7. The cellular assembly stoichiometry is not affected by the depletion of PRC2
subunit Eed. (a-b) Agarose gel electrophoresis analysis of nucleosomal DNAs extracted from
fractions of 15-40% sucrose gradient. Nucleosomes were prepared from Eed-/-/Y-Cbx4 and Eedf~
IY-Cbx8 (left), and Eed+/+!Y-Cbx4 and Eed+/+/Y-Cbx8 (right). Representative images of agarose
gel are shown. Fractions 15 and 23 indicated by color-coded bars below the gels were used for
single-molecule TIRF imaging, (c) Schematic depiction of the immobilization of YFP-PRC1-
nucleosome complex on surface by biotinylated anti-H3 antibody, (d-e) The percentage of
fluorescence photobleaching steps of YFP-Cbx4 and YFP-Cbx8 on a nucleosome isolated from
Eed/~IY-Cbx4 and Eed !Y-Chx8 (d) and from Eed+/+IY-Cbx4 and Eed+/+IY-Cbx8 (e) is shown.
The color-coded bars are described in (Fig. 7a-b). Results are means SD.
44


The individual subunits of PRC1 within the nucleoplasm are monomers.
To investigate the stoichiometry of individual subunits of PRC1 within the nucleoplasm
of ES cells, we employed a recently developed single-molecule immunoprecipitation approach
(32). Nucleoplasmic PRC1 proteins were extracted from mES cells and cross-linked with
paraformaldehyde. YFP-PRC1 was immobilized on the passivated NeutrAvidin coated coverslip
by biotinylated anti-GFP antibody (Fig. 8a). Single-molecule image stacks were acquired using
TIRF microscopy. Analysis of the numbers of YFP-PRC1 fusion proteins showed that 98.9%,
97.9%, 99.0% and 97.7% of individual fluorescent spots are one molecule of YFP-Cbx2, YFP-
Cbx7, YFP-Mell8 and YFP-Ringlb (Fig. 8b), respectively, indicating a stoichiometry of 1:1:1:1
molecule for YFP-Cbx2, YFP-Cbx7, YFP-Mell8, YFP-Ringlb and one copy of each subunit of
PRC1.
45


Cbx2-'IY-Cbx2
Cbx7'- IY-Cbx7
100
100
o' 50
100
Ring 1 bv- / Y-Ring 1 b Mell&IY-MelW
o' 50
100
o' 50
1 2
Steps
1 2
Steps
1 2
Steps
1 2
Steps
Figure 8.
Figure 8. Nucleoplasmic PRC1 is monomeric, (a) Schematic illustration of the immobilization
of YFP-PRC1 proteins on the passivated NeutrAvidin coated coverslip by biotinylated anti-GFP
antibody. The YFP-PRC1 complexes extracted from Cbx2~~ Y-Chx2, Cbx7~~ Y-Chx7,RingHi ~ Y-
Ringlb and Me 118 ^ Y-Me118 mES cells were pulled down by biotinylated anti-GFP antibody via
interaction with NeutrAvidin. (b) The percentage of fluorescence photobleaching steps of YFP-
Cbx2, YFP-Cbx7, YFP-Ringlb and YFP-Mell8 is shown. Results are means SD.
46


PRC2 is a mixture of monomer and dimer, and binds to nucleosome in a 1:1 or 2:1
stoichiometry
To investigate whether PRC2 self-interacts within cells, YFP-PRC2 fusion genes, Y-Eed
and Y-Ezh2, were stably expressed in Eedf~ and Ezh2~/~ mES cells, respectively. Introduction of
Y-Eed and Y-Ezh2 fusions into their respective KO mES cells restored H3K27me3 level as
demonstrated by IF (Fig. 9a). The IF data indicate that the two fusion proteins function as their
endogenous counterparts. The residual H3K27me3 in Ezh2'/~ mES cells may be generated by
Ezhl. YFP-PRC2 from the nucleoplasm was immobilized on the passivated NeutrAvidin coated
coverslip by anti-GFP antibody (Fig. 9b). Single-molecule immunoprecipitation analysis showed
that 18.6% and 15.7% of individual fluorescent spots have two molecules of YFP-Eed and YFP-
Ezh2, indicating a mixture of monomeric and dimeric PRC2.
To investigate the assembly stoichiometry of PRC2 on chromatin, the YFP-PRC2-
mononucleosome complexes were prepared and immobilized on the passivated NeutrAvidin
coated coverslip by biotinylated anti-H3 antibody (Fig. 9c). The Sm-ChIPi analysis showed that
19.5% and 19.2% of fluorescent spots have two molecules of Y-Eed and Y-Ezh2, indicating that
two PRC2 complexes can bind to a nucleosome. The Y-Eed-mononucleosome complexes were
also immobilized by biotinylated anti-H2B (Fig. 9d) or anti-GFP antibodies (Fig. 9e). The Sm-
ChlPi analysis gave similar results among these antibodies. Together, these data indicate that
PRC2 binds to nucleosome in a 1:1 or 2:1 stoichiometry.
47


Ee&'/Y-Eed Eed'- Eed+/+
a
anti-H3K27me3 DNA Overlay
anti-H3K27me3 DNA Overlay
b
Eed'IY-Eed:
nucleoplasmic Y-Eed
1 Steps 2
Eed-'-/Y-Eed:
Y-Eed-mononucleosome
1 Steps 2
Ezh2r'- IY-Ezh2:
2
Steps
Ezh2r'- IY-Ezh2:
Y-Ezh2-mononucleosome
Steps
I
3
CD
o
-c
T1
T)
Figure 9.
48
YFP-Ezh2


Figure 9. PRC2 is a mixture of monomer and dimer, and binds to mononucleosome in a 1:1
or 2:1 stoichiometry, (a) Immunostaining of H3K27me3 in Ezh2+/+, Eed+/+, Ezh2~/~ Eed ", Ezh2~
/'/Y-Ezh2 and Eed'/Y-Eed mES cells by using antibody directed against H3K27me3 (green).
DNAs were stained with Hoechst (blue). Overlay images are shown. Scale bar is 5pm. (b)
Nucleoplasmic YFP-Eed and YFP-Ezh2 are a mixture of monomer and dimer. The YFP-PRC2
complexes extracted from Ezh2~/~/Y-Ezh2 and Eed'/Y-Eed mES cells were pulled down by
biotinylated anti-GFP antibody via interaction with NeutrAvidin (left). The percentage of
fluorescence photobleaching steps of YFP-Eed and YFP-Ezh2 is shown as black bar (right). For
a comparison, the red bar for the monomeric YFP is replicated from (Fig. lb). Results are means
SD. (c) PRC2 binds to mononucleosome in a 1:1 or 2:1 stoichiometry. The YFP-PRC2-
mononucleosome complexes from Ezh2~/~/Y-Ezh2 and Eed'/Y-Eed mES cells were immobilized
by biotinylated antibodies directed against H3 (left). The percentage of fluorescence
photobleaching steps of YFP-Eed and YFP-Ezh2 on a mononucleosome is shown as black bar
(right). Results are means SD. For a comparison, the red bar for the monomeric YFP is
replicated from (Fig. lb), (d-e) The percentage of fluorescence photobleaching steps of YFP-Eed
on a mononucleosome. The YFP-Eed-PRC2-mononucleosome complexes were immobilized by
biotinylated antibodies directed against H2B (d) and GFP (e). For a comparison, the red bar for
the monomeric YFP is replicated from the (Fig. lb). Results are means SD.
49


CHPTERIV
DISCUSSION
In this study, we developed a novel approach to assess the cellular assembly stoichiometry
of epigenetic complexes on chromatin and provided evidence that the PcG complexes PRC1 and
PRC2 employ distinct mechanisms by which they assemble on chromatin. The cellular assembly
stoichiometry reflects the mechanism by which the PcG complexes initiate, establish and maintain
repressive polycomb domains. Molecular counting based on single-molecule fluorescence
microscopy is a powerful approach to quantitatively assess the number of molecules within a
macromolecular protein complex. By analyzing fluorescence photobleaching steps, the Isacoff
group counted subunit composition of membrane-bound proteins expressed in Xenopus laevis
oocytes (33). By developing and applying single-molecule fluorescence two-color coincidence
detection, the Klenerman group and the Balasubramanian group characterized subunit composition
within a reconstituted telomerase complex (31). By combining immunoprecipitation and single-
molecule imaging, the Ha group developed single-molecule pull-down (SiMPull) to probe how
many proteins and of which kinds are present in individual cellular protein complexes (32).
Here, by combining genetic engineering, chromatin immunoprecipitation and single-
molecule imaging, we developed Sm-ChIPi to quantify cellular assembly stoichiometry of
epigenetic complexes on chromatin. Both SiMPull and Sm-ChIPi are based on
immunoprecipitation; however Sm-ChIPi has been specifically developed and optimized for
proteins associating with chromatin in vivo.
The biological significance of the cellular assembly stoichiometry of PRC1 on chromatin
Although a nucleosome has twofold symmetry of histone organization, histone tails have
been shown to be asymmetrically modified (28). The H3K27me3 mark has been suggested to be
50


a dock site for the canonical PRC1 via interaction with the Cbx proteins (65). In biochemical
principle, we should detect a mixture of nucleosomes bound with one or two Cbx-PRCl
complexes. However, our Sm-ChIPi analysis indicated that one PRC1 can potentially associate
with 7 nucleosomes, suggesting that the PRC1 complex has multiple binding sites for
nucleosomes or that the nuclear environment directs the PRC1 complex assembly on multiple
nucleosomes. These data also imply that the binding of a PRC1 to one disk surface of a
nucleosome prevents association of the second nucleosomal disk surface with additional PRC1.
In mammalian cells, only a few large polycomb domains cover multiple neighboring
genes, whereas the vast majority of polycomb domains cover individual promoter regions (6).
Considering the polycomb peaks of ChIP-Seq at promoters is less than 10 kb on average (6), we
predict that only a small number of PRC Is reside at the promoter of each gene. To assess the
stoichiometric relationship between PRC1 and polycomb domains, we measured the number of
PRC1 in mES cells by FCS and found that the numbers of Ringlb in mES cells roughly equals
the number of polycomb domains. These data imply that only a small number of PRC 1
complexes are decorated on chromatin to repress one gene.
The reconstituted Drosophila PRC1 packs nucleosomal arrays where histone tails have
been depleted (14). The in vitro observations are consistent with the cellular assembly
stoichiometry of PRC 1 on chromatin where the depletion of the PRC2 Eed has no effect on the
PRC1 assembly stoichiometry. The mechanism by which PRC1 mediates compaction of
chromatin may be distinct from HP1 and L3MBTL1 proteins since both require histone lysine
methylation in vitro (66,67).
Previous studies have shown that the features of chromatin are distinct between
pluripotent and differentiated cells and reflect the importance of establishing and maintaining
51


lineage-specific gene transcription profile (62,63). Our observations that the assembly
stoichiometry of Cbx2 on chromatin is distinct between mES and differentiated cells suggest that
the Cbx proteins diversify their functions during cell differentiation. Recent studies have shown
that Cbx2 possesses unique characteristics during development and cell-cycle progression
(49,68). In a mouse zygote, Cbx2 targets PRC1 to constitutive heterochromatin in a parent-of-
origin-dependent manner (68). In mES cells, Cbx2 targets PRC1 to mitotic chromosomes in a
PRC2-independent manner and binds stably to mitotic chromosomes without dissociation (49).
Cbx2 is the active subunit of mammalian PRC1 for both inhibition of remodeling and
compaction of chromatin in vitro via a stretch of charged amino acids (69). The charged domain
has been proposed to interact with a nucleosome and to create more interactions with other
nucleosomes. We propose that ES-cell differentiation induces more Cbx2 proteins to be loaded
onto chromatin, which may facilitate further chromatin compacting to establish and maintain
stable epigenetic silencing. Further studies are needed to explore the mechanisms and functional
roles of the unique Cbx2 protein.
Our single-molecule immunoprecipitation analysis indicated that the nucleoplasmic
PRC1 proteins do not self-interact within cells under their expression levels similar to
endogenous counterparts. However, several studies of the individual PRC1 subunits showed that
they can self-associate in vitro (16-19), suggesting that the complex formation may prevent the
self-association of individual subunits or that the in vitro observations do not reflect the
physiological conditions. Recent studies showed that both Drosophila Ph and mammalian
homolog Phc2 form oligomers (70,71) and the oligomerization can be prevented by O-
GlcNAcylation (71). Such oligomerization of Ph/Phc2 may play an architectural role in the long-
range organization of large polycomb domains that cover multiple neighboring genes, such as the
52


Hox gene clusters and the inactive X chromosome in female cells. However, since the vast
majority of polycomb domains are relatively small and usually overlap with promoter regions,
the Ph/Phc2 oligomerization may not be required for genes with small polycomb domains. This
hypothesis is consistent with the depletion of Ph/Phc2 mainly affecting expression of genes with
larger polycomb domains (70,71). Clearly, it will be important to test how the oligomerization of
Ph/Phc regulates long-range organization of chromatin structure in vivo.
The role of a dimeric PRC2 in the formation of a repressive polycomb domain
Here, we provide direct evidence that nucleoplasmic PRC2 is a mixture of monomer and
dimer. Previous studies of the reconstituted PRC2 reached divergent views about states of PRC2
oligomerization (23-25). The reconstituted PRC2 with five core subunits has been identified as a
dimer (23). The reconstituted PRC2 with four subunits has been shown to be monomeric by
electron microscopy (25). The reconstituted PRC2 with three subunits has been found to a
mixture of monomers, dimers, trimers and higher order oligomers (24). These variations could be
due to the numbers of PRC2 subunits used in the reconstituted assay or the methods used to
characterize the oligomerization states. Gel filtration fractionation of nuclear extracts from both
mammals and Drosophila suggested that the apparent molecular weight of PRC2 is consistent
with a mixture of monomer, dimer and oligomer (26,27). However the gel filtration could not
exclude non-PRC2 proteins or an extended structure of PRC2. Our observations by using ultra-
sensitive single-molecule immunoprecipitation resolved these disparities.
We found that PRC2 binds to a nucleosome in a 1:1 or 2:1 stoichiometry in vivo. We
suggest that a monomeric PRC2 might play a role in the initial establishment stage of polycomb
domain formation and that the subsequent assembly and spreading of PRC2 proteins along
chromatin may require dimeric PRC2. In this model, the initial recruitment of PRC2 to specific
53


loci by noncoding RNAs or sequence-specific DNA binding factors would promote
trimethylation of H3K27 on an adjacent nucleosome (46,72-75). This would lead to binding a
dimeric PRC2 to the nucleosome via Eed interaction with H3K27me3 modification, which then
facilitates methylation of an adjacent nucleosome or within a nucleosome and repeats the cycle
(Fig. 10). This model is analogous to the formation of heterochromatin by the SIR proteins (76).
This model can explain the previous discoveries that PRC2 favors di- and oligo-nucleosome
substrates over mononucleosomes (77,78). In a dimeric PRC2, one Eed binding to a nucleosome
would position the second PRC2 to methylate the histone tail of H3 within the second
nucleosome.
In summary, we developed a novel approach of ChIP-coupled single-molecule
fluorescence imaging to assess the cellular assembly stoichiometry of epigenetic complexes on
chromatin. Sm-ChIPi could provide insights to other epigenetic complexes. The cellular
assembly stoichiometry of the PcG complexes PRC1 and PRC2 on chromatin presented here
provides us with the first assembly stoichiometry of these two complexes on chromatin within
cells and offers invaluable in vivo data to understand previous in vitro biochemical data. The in
vivo data of the PcG interaction with chromatin leads to novel insights and testable hypotheses
that should inspire further studies of both PRC1 and PRC2 in the establishment and maintenance
of repressive polycomb domains.
54


a
Monomeric PRC1
b
Dimeric PRC2
Figure 10.
Figure 10. Purposed models for the PRC1 and PRC2 association with chromatin fibers, (a)
PRC1 compacts chromatin with a minimum ratio of 1:7 within cells, (b) Dimeric PRC2
facilitates trimethylation of H3K27 within a nucleosome or an adjacent nucleosome in a way that
one PRC1 binding to a nucleosome would position the second PRC2 to methylate the histone tail
of H3 within the second nucleosome.
55


REFERENCES
1. Misteli, T. (2007) Beyond the sequence: cellular organization of genome function. Cell 128,
787-800
2. Luger, K., Dechassa, M. L., and Tremethick, D. J. (2012) New insights into nucleosome and
chromatin structure: an ordered state or a disordered affair? Nat Rev Mol Cell Biol 13, 436-447
3. Oliver, S. S., and Denu, J. M. (2011) Dynamic Interplay between Histone H3 Modifications
and Protein Interpreters: Emerging Evidence for a "Histone Language". Chembiochem 12, 299-
307
4. Zentner, G. E., and Henikoff, S. (2013) Regulation of nucleosome dynamics by histone
modifications. Nat Struct Mol Biol 20, 259-266
5. Musselman, C. A., Lalonde, M. E., Cote, J., and Kutateladze, T. G. (2012) Perceiving the
epigenetic landscape through histone readers. Nat Struct Mol Biol 19, 1218-1227
6. Bickmore, W. A., and van Steensel, B. (2013) Genome architecture: domain organization of
interphase chromosomes. Cell 152, 1270-1284
7. Bowman, G. D., and Poirier, M. G. (2015) Post-Translational Modifications of Histones That
Influence Nucleosome Dynamics. Chemical Reviews 115, 2274-2295
8. Simon, J. A., and Kingston, R. E. (2013) Occupying chromatin: Polycomb mechanisms for
getting to genomic targets, stopping transcriptional traffic, and staying put. Mol Cell 49, 808-824
9. Chan, K. M., Fang, D., Gan, H., Hashizume, R., Yu, C., Schroeder, M., Gupta, N., Mueller, S.,
James, C. D., Jenkins, R., Sarkaria, J., and Zhang, Z. (2013) The histone H3.3K27M mutation in
pediatric glioma reprograms H3K27 methylation and gene expression. Genes Dev 27, 985-990
10. Margueron, R., Justin, N., Ohno, K., Sharpe, M. L., Son, J., Drury, W. J., 3rd, Voigt, P.,
Martin, S. R., Taylor, W. R., De Marco, V., Pirrotta, V., Reinberg, D., and Gamblin, S. J. (2009)
56


Role of the polycomb protein EED in the propagation of repressive histone marks. Nature 461,
762-767
11. Wang, H. B., Wang, L. J., Erdjument-Bromage, EL, Vidal, M., Tempst, P., Jones, R. S., and
Zhang, Y. (2004) Role of histone H2A ubiquitination in polycomb silencing. Nature 431, 873-
878
12. Gao, Z., Zhang, J., Bonasio, R., Strino, F., Sawai, A., Parisi, F., Kluger, Y., and Reinberg, D.
(2012) PCGF Homologs, CBX Proteins, and RYBP Define Functionally Distinct PRC1 Family
Complexes. Mol Cell 45, 344-356
13. Cao, R., Wang, L., Wang, H., Xia, L., Erdjument-Bromage, H., Tempst, P., Jones, R. S., and
Zhang, Y. (2002) Role of histone H3 lysine 27 methylation in Polycomb-group silencing.
Science 298, 1039-1043
14. Francis, N. J., Kingston, R. E., and Woodcock, C. L. (2004) Chromatin compaction by a
polycomb group protein complex. Science 306, 1574-1577
15. Eskeland, R., Leeb, M., Grimes, G. R., Kress, C., Boyle, S., Sproul, D., Gilbert, N., Fan, Y.,
Skoultchi, A. I., Wutz, A., and Bickmore, W. A. (2010) RinglB compacts chromatin structure
and represses gene expression independent of histone ubiquitination. Mol Cell 38, 452-464
16. Cowell, I. G., and Austin, C. A. (1997) Self-association of chromo domain peptides. Biochim
Biophys Acta 1337, 198-206
17. Fujisaki, S., Ninomiya, Y., Ishihara, H., Miyazaki, M., Kanno, R., Asahara, T., and Kanno,
M. (2003) Dimerization of the Polycomb-group protein Mel-18 is regulated by PKC
phosphorylation. Biochem Biophys Res Commun 300, 135-140
57


18. Lo, S. M., and Francis, N. J. (2010) Inhibition of chromatin remodeling by polycomb group
protein posterior sex combs is mechanistically distinct from nucleosome binding. Biochemistry
49, 9438-9448
19. Czypionka, A., de los Panos, O. R., Mateu, M. G., Barrera, F. N., Hurtado-Gomez, E.,
Gomez, J., Vidal, M., andNeira, J. L. (2007) The isolated C-terminal domain of RinglB is a
dimer made of stable, well-structured monomers. Biochemistry 46, 12764-12776
20. Kim, C. A., Gingery, M., Pilpa, R. M., and Bowie, J. U. (2002) The SAM domain of
polyhomeotic forms a helical polymer. Nat Struct Biol 9, 453-457
21. Lo, S. M., McElroy, K. A., and Francis, N. J. (2012) Chromatin modification by PSC occurs
at one PSC per nucleosome and does not require the acidic patch of histone H2A. PLoS One 7,
e47162
22. McGinty, R. K., Henrici, R. C., and Tan, S. (2014) Crystal structure of the PRC1
ubiquitylation module bound to the nucleosome. Nature 514, 591-596
23. Davidovich, C., Goodrich, K. J., Gooding, A. R., and Cech, T. R. (2014) A dimeric state for
PRC2. Nucleic Acids Res 42, 9236-9248
24. Wu, L., Murat, P., Matak-Vinkovic, D., Murrell, A., and Balasubramanian, S. (2013) Binding
interactions between long noncoding RNA HOTAIR and PRC2 proteins. Biochemistry 52, 9519-
9527
25. Ciferri, C., Lander, G. C., Maiolica, A., Herzog, F., Aebersold, R., and Nogales, E. (2012)
Molecular architecture of human polycomb repressive complex 2. Elife 1, e00005
26. Cao, R., and Zhang, Y. (2004) SUZ12 is required for both the histone methyltransferase
activity and the silencing function of the EED-EZH2 complex. Mol Cell 15, 57-67
58


27. Tie, F., Prasad-Sinha, J., Birve, A., Rasmuson-Lestander, A., and Harte, P. J. (2003) A 1-
megadalton ESC/E(Z) complex from Drosophila that contains polycomblike and RPD3. Mol Cell
Biol 23, 3352-3362
28. Voigt, P., LeRoy, G., Drury, W. J., 3rd, Zee, B. M., Son, J., Beck, D. B., Young, N. L.,
Garcia, B. A., and Reinberg, D. (2012) Asymmetrically modified nucleosomes. Cell 151, 181-
193
29. Murphy, P. J., Cipriany, B. R., Wallin, C. B., Ju, C. Y., Szeto, K., Hagarman, J. A., Benitez,
J. J., Craighead, H. G., and Soloway, P. D. (2013) Single-molecule analysis of combinatorial
epigenomic states in normal and tumor cells. Proc Natl Acad Sci USA 110, 7772-7777
30. Baeza, J., Dowell, J. A., Smallegan, M. J., Fan, J., Amador-Noguez, D., Khan, Z., and Denu,
J. M. (2014) Stoichiometry of site-specific lysine acetylation in an entire proteome. J Biol Chem
289, 21326-21338
31. Alves, D., Li, FL, Codrington, R., Orte, A., Ren, X., Klenerman, D., and Balasubramanian, S.
(2008) Single-molecule analysis of human telomerase monomer. Nat Chem Biol 4, 287-289
32. Jain, A., Liu, R., Ramani, B., Arauz, E., Ishitsuka, Y., Ragunathan, K., Park, J., Chen, J.,
Xiang, Y. K., and Ha, T. (2011) Probing cellular protein complexes using single-molecule pull-
down. Nature 473, 484-488
33. Ulbrich, M. H., and Isacoff, E. Y. (2007) Subunit counting in membrane-bound proteins. Nat
Methods 4, 319-321
34. Ren, X., Gavory, G., Li, H., Ying, L., Klenerman, D., and Balasubramanian, S. (2003)
Identification of a new RNA.RNA interaction site for human telomerase RNA (hTR): structural
implications for hTR accumulation and a dyskeratosis congenita point mutation. Nucleic Acids
Res 31, 6509-6515
59


35. Ren, X., Li, H., Clarke, R. W., Alves, D. A., Ying, L., Klenerman, D., and Balasubramanian,
S. (2006) Analysis of human telomerase activity and function by two color single molecule
coincidence fluorescence spectroscopy. J Am Chem Soc 128, 4992-5000
36. Ngo, T. T., Zhang, Q., Zhou, R., Yodh, J. G., and Ha, T. (2015) Asymmetric unwrapping of
nucleosomes under tension directed by DNA local flexibility. Cell 160, 1135-1144
37. Lee, J. Y., Lee, J., Yue, H., and Lee, T. H. (2015) Dynamics of nucleosome assembly and
effects of DNA methylation. J Biol Chem 290, 4291-4303
38. Deindl, S., Hwang, W. L., Hota, S. K., Blosser, T. R., Prasad, P., Bartholomew, B., and
Zhuang, X. (2013) ISWI remodelers slide nucleosomes with coordinated multi-base-pair entry
steps and single-base-pair exit steps. Cell 152, 442-452
39. Li, M., Hada, A., Sen, P., Olufemi, L., Hall, M. A., Smith, B. Y., Forth, S., McKnight, J. N.,
Patel, A., Bowman, G. D., Bartholomew, B., and Wang, M. D. (2015) Dynamic regulation of
transcription factors by nucleosome remodeling. Elife 4
40. Simon, M., North, J. A., Shimko, J. C., Forties, R. A., Ferdinand, M. B., Manohar, M.,
Zhang, M., Fishel, R., Ottesen, J. J., and Poirier, M. G. (2011) Histone fold modifications control
nucleosome unwrapping and disassembly. Proc Natl Acad Sci USA 108, 12711-12716
41. Luo, Y., North, J. A., Rose, S. D., and Poirier, M. G. (2014) Nucleosomes accelerate
transcription factor dissociation. Nucleic Acids Res 42, 3017-3027
42. Katoh-Fukui, Y., Tsuchiya, R., Shiroishi, T., Nakahara, Y., Hashimoto, N., Noguchi, K., and
Higashinakagawa, T. (1998) Male-to-female sex reversal in M33 mutant mice. Nature 393, 688-
692
60


43. Cheng, B., Ren, X., and Kerppola, T. K. (2014) KAP1 represses differentiation-inducible
genes in embryonic stem cells through cooperative binding with PRC1 and derepresses
pluripotency-associated genes. Mol Cell Biol 34, 2075-2091
44. Endoh, M., Endo, T. A., Endoh, T., Fujimura, Y. I., Ohara, O., Toyoda, T., Otte, A. P.,
Okano, M., Brockdorff, N., Vidal, M., and Koseki, H. (2008) Polycomb group proteins
RinglA/B are functionally linked to the core transcriptional regulatory circuitry to maintain ES
cell identity. Development 135, 1513-1524
45. Elderkin, S., Maertens, G. N., Endoh, M., Mallery, D. L., Morrice, N., Koseki, EL, Peters, G.,
Brockdorff, N., and Hiom, K. (2007) A phosphorylated form of Mel-18 targets the RinglB
histone H2A ubiquitin ligase to chromatin. Mol Cell 28, 107-120
46. Shen, X., Kim, W., Fujiwara, Y., Simon, M. D., Liu, Y., Mysliwiec, M. R., Yuan, G. C., Lee,
Y., and Orkin, S. H. (2009) Jumonji modulates polycomb activity and self-renewal versus
differentiation of stem cells. Cell 139, 1303-1314
47. Penny, G. D., Kay, G. F., Sheardown, S. A., Rastan, S., and Brockdorff, N. (1996)
Requirement for Xist in X chromosome inactivation. Nature 379, 131-137
48. Frey, A., Listovsky, T., Guilbaud, G., Sarkies, P., and Sale, J. E. (2014) Histone H3.3 Is
Required to Maintain Replication Fork Progression after UV Damage. Current Biology 24, 2195-
2201
49. Zhen, C. Y., Due, H. N., Kokotovic, M., Phiel, C. J., and Ren, X. (2014) Cbx2 stably
associates with mitotic chromosomes via a PRC2- or PRC 1-independent mechanism and is
needed for recruiting PRC1 complex to mitotic chromosomes. Mol Biol Cell 25, 3726-3739
50. Ziv, Y., Bielopolski, D., Galanty, Y., Lukas, C., Taya, Y., Schultz, D. C., Lukas, J., Bekker-
Jensen, S., Bartek, J., and Shiloh, Y. (2006) Chromatin relaxation in response to DNA double-
61


strand breaks is modulated by a novel ATM- and KAP-1 dependent pathway. Nat Cell Biol 8,
870-876
51. Ren, X., and Kerppola, T. K. (2011) REST interacts with Cbx proteins and regulates
polycomb repressive complex 1 occupancy at RE1 elements. Mol Cell Biol 31, 2100-2110
52. Luger, K., Rechsteiner, T. J., and Richmond, T. J. (1999) Preparation of nucleosome core
particle from recombinant histones. Methods Enzymol 304, 3-19
53. Johnson, A., Li, G., Sikorski, T. W., Buratowski, S., Woodcock, C. L., and Moazed, D.
(2009) Reconstitution of heterochromatin-dependent transcriptional gene silencing. Mol Cell 35,
769-781
54. Li, G., and Widom, J. (2004) Nucleosomes facilitate their own invasion. Nat Struct Mol Biol
11, 763-769
55. Johnson, A., Wu, R., Peetz, M., Gygi, S. P., and Moazed, D. (2013) Heterochromatic gene
silencing by activator interference and a transcription elongation barrier. J Biol Chem 288,
28771-28782
56. Vary, J. C., Fazzio, T. G., and Tsukiyama, T. (2004) Assembly of yeast chromatin using
ISWI complexes. Method Enzymol 375, 88-102
57. An, W., and Roeder, R. G. (2004) Reconstitution and transcriptional analysis of chromatin in
vitro. Methods Enzymol 377, 460-474
58. Chung, S. H., and Kennedy, R. A. (1991) Forward-backward non-linear filtering technique
for extracting small biological signals from noise. JNeurosci Methods 40, 71-86
59. Schwille, P., Meyer-Almes, F. J., and Rigler, R. (1997) Dual-color fluorescence cross-
correlation spectroscopy for multicomponent diffusional analysis in solution. Biophys J 72,
1878-1886
62


60. Coffman, V. C., and Wu, J. Q. (2012) Counting protein molecules using quantitative
fluorescence microscopy. Trends Biochem Sci 37, 499-506
61. Peng, H., Feldman, I., and Rauscher, F. J., 3rd. (2002) Hetero-oligomerization among the TIF
family of RBCC/TRIM domain-containing nuclear cofactors: a potential mechanism for
regulating the switch between coactivation and corepression. JMol Biol 320, 629-644
62. Meshorer, E., and Misteli, T. (2006) Chromatin in pluripotent embryonic stem cells and
differentiation. Nat Rev Mol Cell Biol 7, 540-546
63. Fisher, C. L., and Fisher, A. G. (2011) Chromatin states in pluripotent, differentiated, and
reprogrammed cells. Curr Opin Genet Dev 21, 140-146
64. Morey, L., Pascual, G., Cozzuto, L., Roma, G., Wutz, A., Benitah, S. A., and Di Croce, L.
(2012) Nonoverlapping functions of the Polycomb group Cbx family of proteins in embryonic
stem cells. Cell Stem Cell 10, 47-62
65. Min, J., Zhang, Y., and Xu, R. M. (2003) Structural basis for specific binding of Polycomb
chromodomain to histone H3 methylated at Lys 27. Genes Dev 17, 1823-1828
66. Canzio, D., Chang, E. Y., Shankar, S., Kuchenbecker, K. M., Simon, M. D., Madhani, H. D.,
Narlikar, G. J., and Al-Sady, B. (2011) Chromodomain-mediated oligomerization of HP1
suggests a nucleosome-bridging mechanism for heterochromatin assembly. Mol Cell 41, 67-81
67. Trojer, P., Li, G., Sims, R. J., 3rd, Vaquero, A., Kalakonda, N., Boccuni, P., Lee, D.,
Erdjument-Bromage, H., Tempst, P., Nimer, S. D., Wang, Y. H., and Reinberg, D. (2007)
L3MBTL1, a histone-methylation-dependent chromatin lock. Cell 129, 915-928
68. Tardat, M., Albert, M., Kunzmann, R., Liu, Z., Kaustov, L., Thierry, R., Duan, S.,
Brykczynska, U., Arrowsmith, C. H., and Peters, A. H. (2015) Cbx2 Targets PRC1 to
63


Constitutive Heterochromatin in Mouse Zygotes in a Parent-of-Origin-Dependent Manner. Mol
Cell 58, 157-171
69. Grau, D. J., Chapman, B. A., Garlick, J. D., Borowsky, M., Francis, N. J., and Kingston, R.
E. (2011) Compaction of chromatin by diverse Polycomb group proteins requires localized
regions of high charge. Genes Dev 25, 2210-2221
70. Isono, K., Endo, T. A., Ku, M., Yamada, D., Suzuki, R., Sharif, J., Ishikura, T., Toyoda, T.,
Bernstein, B. E., and Koseki, H. (2013) SAM domain polymerization links subnuclear clustering
of PRC 1 to gene silencing. Dev Cell 26, 565-577
71. Gambetta, M. C., and Muller, J. (2014) O-GlcNAcylation prevents aggregation of the
Polycomb group repressor polyhomeotic. Dev Cell 31, 629-639
72. Davidovich, C., Wang, X., Cifuentes-Rojas, C., Goodrich, K. J., Gooding, A. R., Lee, J. T.,
and Cech, T. R. (2015) Toward a consensus on the binding specificity and promiscuity of PRC2
for RNA. Mol Cell 57, 552-558
73. Rinn, J. L., Kertesz, M., Wang, J. K., Squazzo, S. L., Xu, X., Brugmann, S. A., Goodnough,
L. H., Helms, J. A., Farnham, P. J., Segal, E., and Chang, H. Y. (2007) Functional demarcation
of active and silent chromatin domains in human HOX loci by noncoding RNAs. Cell 129, 1311-
1323
74. Peng, J. C., Valouev, A., Swigut, T., Zhang, J., Zhao, Y., Sidow, A., and Wysocka, J. (2009)
Jarid2/Jumonji coordinates control of PRC2 enzymatic activity and target gene occupancy in
pluripotent cells. Cell 139, 1290-1302
75. Landeira, D., Sauer, S., Poot, R., Dvorkina, M., Mazzarella, L., Jorgensen, H. F., Pereira, C.
F. , Leleu, M., Piccolo, F. M., Spivakov, M., Brookes, E., Pombo, A., Fisher, C., Skames, W. C.,
Snoek, T., Bezstarosti, K., Demmers, J., Klose, R. J., Casanova, M., Tavares, L., Brockdorff, N.,
64


Merkenschlager, M., and Fisher, A. G. (2010) Jarid2 is a PRC2 component in embryonic stem
cells required for multi-lineage differentiation and recruitment of PRC 1 and RNA Polymerase II
to developmental regulators. Nat Cell Biol 12, 618-624
76. Swygert, S. G., Manning, B. J., Senapati, S., Kaur, P., Lindsay, S., Demeler, B., and
Peterson, C. L. (2014) Solution-state conformation and stoichiometry of yeast Sir3
heterochromatin fibres. Nat Commun 5, 4751
77. Kuzmichev, A., Jenuwein, T., Tempst, P., and Reinberg, D. (2004) Different Ezh2-
containing complexes target methylation of histone HI or nucleosomal histone H3. Molecular
Cell 14, 183-193
78. Martin, C., Cao, R., and Zhang, Y. (2006) Substrate preferences of the EZH2 histone
methyltransferase complex. J Biol Chem 281, 8365-8370
65


Full Text

PAGE 1

nrrr r rrnr rrnr n !"##$n"%$!&# &"'$$& & "'$$&())* #+$&&&,-##$.# #+$ /,# #+$!.,#$/+ #+$ n"%$!&# !. "0!#,-$"# #+$!$1,!$-$"#& !#+$.$'!$$ r&#$! /$"/$ +$-&#!! '!()23

PAGE 2

4()23 n

PAGE 3

+&#+$&& !#+$r&#$! /$"/$.$'!$$ ,"#% &" +&$$"00! %$. !#+$ +$-&#!! '!5,"$"+! +!&# 0+$!+$ 6$$!& "7"'+# 0!28()23

PAGE 4

,"#% &"9r+$-&#!:&#"/#$,!&&$-# /+ -$#! / -0$;$& "+! -#"$%$$. "'$r $/,$+! -#"--," 0!$/0## "-' "' +$&&.!$/#$.&&&#"#! $&& 5,"$" +$0 / -'! ,09/:!$0!$&&%$/ -0$;9:2 ".(!$$0'$"$#/#!"&/!0# !$',# !0! #$"&#+#0"$&&$"#! $" '$"$&$"/"'!$',# /+! -#" &#!,/#,!$.,!"'.$%$ 0-$"#"./"/$! <$%$!# +$.$#$.$/,!-$/+"&#+$! /$,!&&$"/+! -#"&0 !,".$!&# .$!$<$.$%$ 0$." %$". &$"&#%$00! /+#$!-$.&"'$$/,$/+! -#" --," 0!$/0## "-'"'9-+: # $"$"%$&#'#"'#+$ /$,!&&$-&# /+ -$#! $0'$"$#// -0 $;$& /+! -#"#$/,!$%$-+00! /+/ -"$&'$"$#/$"'"$$!"'/+! -#" /+$-&#!".&"'$$/,$, !$&/$"/$-' "'n&"'-+<$&+ <#+#<#+" ,&$$-! "/&#$-9-:/$& "$0 / -!$0! $&&%$/ -0$;9:2&& /#$&<#+ -,#0$",/$ & -$&<+$!$&#< (&".# "$ ",/$ & -$,/$ 0&-/2& -$!<+$(.-$!=$&"#+$",/$ 0&-, !#+$!<$.$"&#!#$.#+##+$ .$!$"## /$&".,/$&&$$/#%$#$! # #+$&&$-&# /+ -$#! ;( /+! -#",#" # #+$!2/ -0 "$"#&r !$ %$!<$ #"$..!$/#0+&/$%.$"/$#+# #+$&&$-&# /+ -$#! 2 /+! -#"&" #$/#$.(-$.#$.#!-$#+ # >7(?@$"# '$#+$! ,! !$&,#&!$%$#+$.&#"/# /$,!&&$--$/+"&2".( "/+ -#" r !$ %$!#+$" %$-+00! /+/ ,.$,# =$.# .$"&#!#$&"'$$/,$ &&$--$/+"&#+$!$0'$"$#// -0$;$&

PAGE 5

+$ !-"./ "#$"# #+&&#!/#!$00! %$. !$/ --$".$.#&0,/# 00! %$.A 5,"$"

PAGE 6

nn .$./#$#+&< !@# -$ %$.0!$"#& $"" ..%$+,&".5.$+".%$!.$!!$".r/@ !#+$!,"/ ".# %$ ".&,00 !#

PAGE 7

r <&+# $;0!$&&-.$$0$&#'!##,.$# -.%& !! 5,"$" !+& ,"/ ".# "&,00 !#$;0$!#',."/$,".$!&#". "'".$"/ ,!'$-$"##+! ,'+ ,#-&#,. ".!$&$!/+B#+ ,#+&"/!$.$0#$"#< ." #+%$$$"$# / -0$#$#+&#+$&& &&,00 !#<&$&&$"## -&,//$&& r&"/$!$#+"@&# #+$!+!&# 0+$!+$". !6$$!& "7"'+# !&$!%"' -/ --##$$+$'$"$! ,&'%$#+$!#-$# $!-$%,$"&'+#".%$! / "&#!,/#%$/!#/&-# >CC>>E) /$"$".!#,!#!@"".! +,+$ !0! %."'=+(C-/$"$ +$&&&#"/$"./ 0$!# #+$$ <$"$-$!&<$!$$&&$"# !#+$ / -0$# #+&!$&$!/+< ,.@$# #+"@ #+$!$" !# !-$-$!& #+$!#-$".+$0 "< ,.@$# #+"@# -0!$"#& $" "..".-&&#$!$"".+$! !&+ <"'#+"-$".'%"'-$$!# # /+ &$<+#.$&!$.00!$/#$ #+$,"/ ".# %$/!$0"".& /!/$ ,..# &+0$-$ & <$%$!&0$/#+"@&# -+,&".5 .$+ !+&/ "#",$.".,""' %$&,00 !#".,".$!&#"."'.,!"'-0,!&,# r.$'!$$#+#-.$#+$/ -0$# !$&$!/+0 &&$ ,<$!$<&! ,".##-$& #+ ,'+##+##&-0 &&$# / "#",$ ,+$0$.-$# @$$0#+"'&"0$!&0$/#%$<&+ # $;0!$&&-#+"@&# -0!$"#&"<

PAGE 8

6!".!#+$!,""'$# "&,00 !# #+! ,'+ ,# -/.$-/$!&&# #+"@# -%$! %$/#r/@ !+&0$&"# / -0" "&+0

PAGE 9

nn 5,"$"/ "/$%$."..$&'"$.#+$&#,.&,0$! %&$.#+$$;0$!-$"#&".
PAGE 10

nHHHHHHHHHHHHHHHHHHHHHHHHHHH2 rnHHHHHHHHHHHHHHHHHHH2) nHHHHHHHHHHHHHHHHHHHHHHHHHHHHHH(( nHHHHHHHHHHHHHHHHHHHHHHHHHHHHG) HHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHG3

PAGE 11

nn ',!$$0!$&$"##%$&/+$-$ +&# "$0 &##!"&# ./# "#& +&# "$& ",/$ & -$HHHHHHHHHHHHHHHHHHHHHHHHHHHHHH> /+$-#/!$0!$&$"## ---"/ !$(0 #$"&HHHHHHHHHE /+$-#/!$0!$&$"## ---"/" "/ 29/2:HHHHHHHHG /+$-#/!$0!$&$"## ---"%!"# 29%2:HHHHHHHHH3 2/+$-#/!$0!$&$"## &"'$$/,$/+! #"--," 0!$/0## "-'"' 9-+:00! /+HHHHHHHHHHHHHHHHHHHHHHHHH(E (.# #+$-+00! /+,&"'/+! -#"/ -0$;$&<#+@" <" &# /+ -$#!HHHHHHHHHHHHHHHHHHHHHHHHHHHH(? >+$/$,!&&$-&# /+ -$#! 20 #$"& "" ",/$ & -$H>2 E+$,& "0! #$"&,"/# "& #+$!$". '$" ,&/ ,"#$!0!#&HHHHHHHHH>E G+$/$,!&&$-&# /+ -$#! 20 #$"& "0 ",/$ & !!HHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHH>8 3/$.$!$"## "&$$/#%$#$!&#+$& &$-&# /+ -$#! ;(0! #$" "/+! -#"HHHHHHHHHHHHHHHHHHHHHHHHHHHHHE( ?+$/$,!&&$-&# /+ -$#!&" #$/# $.#+$.$0$# (&,,"# $.HHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHEE 8,/$ 0&-/2&" -$!/HHHHHHHHHHHHHHHH HHHHE3 *(&-;#,!$ -$!"..-$!".".& # ",/$ & -$"2A2 !(A2 &# /+ -$#!HHHHHHHHHHHHHHHHHHHHHHHHHHHHHE8 2),!0 &$..$& !#+$2".(&& /# "<#+/+! -#"$!&HHHHGG

PAGE 12

n nn "#+$",/$,&'$" -$ !'"=# "&&+0$.", /$ & -$&92:",/$ & -$&#+$,."' /@ /+! -#"/ "&&#& I2E?0 E0! #$ "&9(:-" /.& "#$!-"# +&# "$&!$&,5$/## %!$# 0 &##!"&# "./# "&+$&$./# "&"/,.$ /$## -".$!$"#&"$!$&.,$&-$#+ # !'""$".&"$!$&.,$& 0+ &0+ !# &$!"$".#+!$ ""$,1,#" # &"$$#/$0'$"$#/!$',# / -0$;$&9>G:#+#.!$/##$!/+! -#"&#!,/ #,!$ !!$/!,#$$/# !&#+#",$"/$'$" -$ !'"=# "92E3?: <$%$!.$# $/,!-$/+"&&&$$0'$"$#/ / -0$;$& "/+! -#"!$0 !,".$!&# .9' : +$0 / -'! ,09/:0! #$"&!$ "'&#". "'0!.'&#,."'#+$ $0'$"$#/"+$!#"/$ #!"&/!0# "&##$&". !$$&&$"# !#+$$&#&+-$"#". -"#$""/$ '$"$#!"&/!0# "0! $.,!"'" !-.$%$ 0-$"#"."/"/$!98*:/ / -0$;$&!$/#$' !=$."#< -5 !'! ,0&D / -$0!$&&%$ -0$;9:2".( (&-$#+#!"&$!&$#+#/#=$&.". #!-$#+# &"$(? "+&# "$> 9>7(?-$(C>:98:+$---"/ !$(&/ -0 & $. =+($.,=2(".0E8 9':=+(&#+$/##/&,,"#".#+$ -"&#+$/##// !$98:".$.& "% %$."!$/ '"# #+$>7(?-$>-!@92): 2&",1,#"'&$#+#/#=$&,1,# # &"$22* "+&# "$( 9(722*n:922:"---&#+$!$!$#< -5 !2&+%$$$".$"#$.D /" "/29/2:9':".%!"#29% 2:9':<+$!$ #+/ -0$;$& 0 &&$&&2C2&,,"#& "'<#+ "$ #+$&;-0! #$"&92(:+$

PAGE 13

/2/ !$/ -0$;&/ -0 &$. "'2C2r2 2". "$ #+$0! #$"&92(:9',!$>:%2/ "&&#& 7r( ".C !&,,"#&"&& /# "<#+ "'2C2". "$ #+$;0! #$"&9/@"' 0! #$"&:".C( &,,"#&!$-,#,$;/,&%$92(:9': !$% ,&&#,.$&+%$&,''$&#$.&$%$!-$/+"&-& !#+$/-$.#$.'$"$&$"/"' &,/+&+&# "$>7(?#!-$#+# "92>:+&# "$ (" ,1,#"# "922:/+! -#" / -0/# "92E:". !'"=# +'+$! !.$!/ +! -#"&#!,/#,!$+%$$$"0! 0 &$.92G: <$%$!,".$!&#"."'#+$.$#$/,!&&$// -0$;$& "/+! -#"<#+" /$&&" #$#/$!".!$-"&# $"%$&#'# $.

PAGE 14

!"#$%&#%% % '$%(&" %% '%& #%%& "'%%$ ",/$ & -$ !-& ".E+$#$!-",& +&# "$&!$ &,5$/## #+$0 &##!"&/!0# "./# "&&, /+&-$#+# "/$## 0+ &0+ !# "".,1,#"#

PAGE 15

"#$ %%&$ $$ "% )% "---&(/ -0 &$ ,!/ !$&,,"#&DF2 C(nF2(".0E8=+(& #+$/##/&,,"# (".#.,#$&#& /#%#%#+$. -"$."% %$&" !$/ '"# #+$&"$(? +&# "$># nF2( F 0E8 2 ( > E F2C( r--"(

PAGE 16

n "#$ %%&$ $$ %" '*+"*, r--"/2/ "&&#& E/ !$&,,"#&D"'2 C2r29:2". "$ #+$ ;-0! #$"& "'2 2 (9r28: > G 3 2 r2 "'2 ( E 3 ? 8 ( > r--"" "/9/2:

PAGE 17

"#$ %%&$ $$ *+!*, r--"%2/ "&&#& ".C !(&,," #&&& /# "<#+"'2C2". ;0! #$"&".C(&,,"#&!$-,#, $;/,&%$ ; "'2C 2 r--"!"#9%2: C (

PAGE 18

+$!$+%$$$"-"&#,.$&. "$ "#+$"#$!/# ". -"&".#+$0! #$".$"##$& <#+"2/ -0$;$&+ <$%$!#+$!$&" #-,/+@ <" ,##+$!$/,!!/+#$/#,!$ "/+! -#"<#+"/$&$%$!&#,.$&+%$&+ <"#+##+$2&,,"#&".#+$!& #$. -"&&$&& /#$ 923():% ,&#+$%.# #+$ .#"$$.# $ / "!-$. "/ "#!&#<#+#+$ &$!%# "-.$ !".%. ,2&,,"#&#+$ !$/ "&##,#$. 2&" -$!+%"' "$/ 0 $/+&,,"#9 2E:#,.$& #+$&&$-&# /+ -$#! 2 "/+! -#"!$ /+$.%!"'%$<& "+ <2"#$!/#& <#+/+! -#"+$!$/ "&##,#$. 2/ -0/#&",/$ & -!!&<#+ &# /+ -$#! "$20$!#$#!",/$ & -$92E: +$!$/ "&##,#$. 9+ /'&: "$!.'$&",/$ & -$&<#+ &# /+ -$#! "$0$! ",/$ & -$9(2:!$/$"#/!&#&#!,/#,!$". /#$.#+# "$2,1,## ".,$ ".&# $/+.&@&,!/$ ",/$ & -$9((:+ $&$.&/!$0"/$&/ ,.$.,$# #+$ / -0 &# "& &,,"#&,&$."#+$!$/ "&##,# !$/# "& !#+$-$#+ .&,&$.# 0$! !-#+$ $;0$!-$"#&+$!$ !$#&&'"/"## !$& % $#+$&$"/ "&&#$"/$&".# .$#$!-"$#+$ &&$-&# /+ -$#! 2/ -0$;$& "/+! #" r !$ %$! &$!%# "& #+$ -$!=# "&##, & (+%$&+ <"%!"'%$<& 9(>(?:+$ !$/ "&##,#$.(+&$$"/+!/#$!=$.&" $!.-$! -$! 9(>(G:,&"'&=$$;/,& "/+! -# '!0+#+ $$". '$" ,&(/ -0$;! #+ +,-"". <& ,".# +%$<.$!"'$ $/,!<$'+# &!"'"'! ->)) @# 2!+'+$!9(3(?:B+$!$&'$#!# "#%$/ -0$;$&/"" #$;/,.$#+$ 0 &&#$&#+#(-+&$;#$".$.&#!,/#,!$& !#+#" "(0! #$"&&& /#$. +$!$ !$#+$$;/#$/,!&# /+ -$#! (<#+"/$&!$-"&,"@" <" ,#="'$$/#! "-/! &/ 09r:#+$0!$% ,&& #,.$&&,''$&#$.#+#($;&#&"

PAGE 19

r -$!/ !-".-".# .",/$ & -$9(G:D + <$%$!<+$#+$!#+$ .$ !$/0#,!$&#+$ &#,# "!$-"&$,&%$ n0# .#$$<00! /+$&+%$$$".$%$ 0$.# 1,"##+$&# /+ -$#! $0'$"$#/./# "& "+&# "$& ",/$ & -$& 9(8(*: !""$"#!$0! #$ -$9>):,# ..!$&&"'#+$ &&$-&# /+ -$#! $0'$"$#// -0$;$& /+! -#"+&& $$"+".$!$.#+$&$"/$ &,#$00! /+ +! -#"--," 0!$/0## "9+: <$.+'+#+! ,'+0,#&$1,$"/"'9+$1:0&' 0##$!"& +&# "$ ./# "&"./+! -#""."'0! #$"& <$% $!+$1/"" #.!$/#!$%$ $/,!&# /+ -$#!$1,$"#+0$! !-$. ""#%$".0,!$.",/$ & -$&/" !$%$#+$/ //,!!$"/$ $0'$"$#/0! #$"& /+! -#",##<$/+$"'$# $&#&+& ,#$&# /+ -$#!r !$ %$!#+$ #+ $!@" <"#$/+"1,$&&,/+&&$.-$"## %$ /#"#/,#!/$"#!,'# "".'$ #!# "/+! -# '!0+#+#!$ #$",&$.# .$#$!-"$#+$/#,$/,!&=$& "#%$0! # $"/ -0$;$&/"" #$;/,.$#+$",$"/$ ,"/+!/#$!=$.0! #$"&".+$#$! '$"$ ,&/ !# "& "'$$/,$, !$&/$"/$-/! &/ 0&&$"&# %$".0 <$!,#$/+"1,$# 1,"##+$&# /+ -$#! &,,"#& -/! $ /,!0! #$"/ -0$;9>2>>:+$ 1,"#/# "&&$. "#+$0+ # $/+"'$+% !& 0+ !$&9>(>>: !#+$!# & #+$, !$&/$"#"#$"&#$& 0+ !$&# #+$ !$$!$"/$, 0+ !$&9>2>E>G:"'$ $/,$#$/+"1,$&+%$$$"<.$,&$.# &#,. /+! -#" '".#/"0! %.$." "#,#%$" !-# "",/$ & -$&#!,/#,!$".# +$!."-/&9>3E2: $!$<$.$%$ 0$." %$".&$"&#%$00! /+# $!-$.-+,#="''$"$#/ $"'"$$!"'/+! -#" /+$-&#!".&"'$$ /,$, !$&/$"/$# %$!/ -$#+$$;&#"'

PAGE 20

-## "&".# $"$.!$/#&&$&&"'#+$& &$-&# /+ -$#! // -0$;$& /+! -#" ,&"'-+ !#+$!&##-$<$0!$&$"#$ .#+$ &&$-&# /+ -$#! // -0$;$&2".( "/+! -#"B$+% $ ,".#+#2".($-0 .&#"/#-$/+"&-&<+/+#+$&&$-$ "/+! #"!$$/#"'#+$!.&#"/#! $&" $&#&+"'".-"#""'!$0!$&&%$0 / -. -"&+$&$!$&,#&/ "#!,#$&'"/"# # ,!1,"###%$,".$!&#"."'#+$/$,!!/+ #$/#,!$ // -0$;$& <"',&# &,''$� &&$$/,!-$/+"&-& !#+$/$.#$.$0'$"$#/&$"/"'-+& .!$/#".&$"&#%$#$/+"1,$"./ ,.$00 $.# -" #+$!&#,.$& $0'$"$#/ / -0$;&&$""#%$/+! -#"

PAGE 21

nn -n n +$ n 9E(: n 9E>: n!" 9EE: r#$9 r ". #$ ,$@" /@ ,#:9EG: !%&&9EE: !'9E3:".72(29E?:-/$"$& <$!$-"#"$."--$.,-9rr9G?*3D'.!/+"/# ,&r: &,00$-$"#$.<#+2GJ9>))?2)>/ "$:( -r',#-"$9?G2>D$ $/+" '$&!&.:2)),"#&C-0$"/ "&#!$0# -/"92G2E)2((D$ $/+" '$&!&.:GGKrL-$!/0# $#+" 9(2*8G)(>D$$/+" '$& !&.:2)>,"#&C-$,@$-"+# !/# !9:".)2r" "$&&$"#-" /.&9222E))G)D$$/+" '$&!&.:: #>? ".+,-.#&#,!#$.GJ( r$.,-<&/+"'$.$%$!.,"$&& #+$!<&$"./ #$. .$0$#$ $$&E +.! ;#;$"9D?*)ED'-.!/+"/# ,&r:<&.-"&#!#$. !#+!$$ .&,".$!#+$/ "/$"#!# 2)Kr7(*>/$ &<$!$-"#"$."rr &,00$-$"#$.<#+2)J(-r',#-"$".2)), "#&C-0$"/"&#!$0# -/"#>? ".+,-.#&#,!#$.GJ( +$0&-.&0F9r:;(0F9r:; E0F9r:;? 0F9r:;80F9r:"'2".0F 9r:r$28+%$$$" .$&/!$.0!$% ,&9E8:+$&$1,$"/$&$"/ ."' !% 9..'$"$:". !' 9..'$"$:<$!$ -0$."."&$!#$.. <"&#!$#+$/ "'&$1,$"/$ !$&/$"/$0! #$"" 0F9r:%$/# !9E8:+$&$1,$"/$$"/ ."'< &-0$."."&$!#$."# 032%$/# !9$#+/!$##&,!'+:# '$"$!#$0329" -$!/

PAGE 22

:".0329.-$!/:+$&$1,$ "/$&$"/ ."',& "0! #$"&+%$ $$"%$!$.&$1,$"/"'rr +$#!"&'$"/-/$"$&+%$$$"$&#&+$. &#".".,/,&"'$"#%! %$/# !! -+,-"--," .$/$"/%!,&9:#! "&$!!"'#+$'$"$ "#$!$&#"# -,!"$ $-! "/&#$-/$&7(*>/$&<$!$/,#,!$.( E+ ,!&0! !# "$/# "2))/,"/ #$.#&&,$/,#,!$.&+# #+$/ ",$"/ 8 )J"."/,#$.#>?M".+,-.# &#,!#$.GJ(&$,. %!,&$&<$!$0/@'$."7(*>/$& / #!"&$/#"'<#+(2 K'0F9r:/ "#""'#+$,& "'$"$(2K'0& (".2)GK'0r(()r( ".(9G)-r0?2(8)-r2G-r & .,-0+ &0+#$:+$-;#,!$ <&..$.# #+$7(*>/$&.! 0<&$"."/, #$.#>?M".+,-.#&#,!#$.GJ ( !2(23+ ,!&$&<$!$$.<#+!$&+2)--$ !E8+ ,!&# 0! .,/$%!,&$& E8+ ,!&#$!0/@"'-$.,-<&/ $/#$.".,& $. !#!"&.,/"'-/$& $;.-$#+!"$! -.$90 !$"$D*(38D'-. !/+"/# ,&r:<&..$.# #+$/ "/$"#!# 8K'C-"./$&<$!$&$$.$. #I2GJ/ ",$"/$ "'$#"/ #$.0#$& !-# #/"/#%#$.r/$&3E+ ,!&# $!"$/# ""$/#$./$&<$!$&$$/#$. ,&"'2)()K'C-0,! -/"988>>D'-.!/+ "/# ,&r:+$$;0!$&& #!"&'$"$&<&".,/$.. ;//"$9 ;D*8*2 '-.!/+"/# ,&r: nrnr +$0&-.0302".0302<$! $/ "&#!,/#$."&$!# &$1,$"/$"# #$!-",& 0302$;0!$&& "%$/# !9$#+/!$: "/$# 0! .,/$" -$!/"."&$!#$.#
PAGE 23

<&-0$.<#+#+$ <"' !N +$-0$.'$"$<&,&$."# #$!-",& 032$;0!$&& "%$/# !&9 $#+/!$:<#+#''$.!$/ -""#0! #$"& ,$.'$&# #+$"&$!#".#+$ %$/# !<#+/ 9>2))2 :".+ 29)2E 3 :.'$&#%$$"=-$& !$&0$/#%$+$.'$&#$.0! .,/#&<$!$& #$. 2J'! &$'$".#+$'#$.// !."' # 0! .,/$0302".0302-0 &-.& %$!#+$"$N +$0&-.&0302".0302<$ !$#!"& !-$."# #+$ (2/ -0$#$"#/$&!$&0$/#%$+$0! #$"$;0 !$&& "<&".,/$.& 0! 0$# #+ '/# 0!" &.$92(2D-$' $@ !/! &&: !G+ ,!&#>?M$0$$#& <$!$/ $/#$.!$&,&0$".$."/ "#""')2r0+$"-$#+"$&, ", !.$9rD *>E8(D'-.!/+"/# ,&r:".0! #$& $"+# !/ /@#98>E)D'-.!/+ "/# ,&r:".& "/#$.,&"'!$ r& "/# !92>)D$<# <": ,".$! <"'/ ".# "&DEGJ-0/# "2G& $/ ". "EG&$/ ". !3-",#$& #+$-;#,!$2J!# "2))<&..$.#$!/$" #!,'# "# #+$&,0$!"#"#0!$<&+$. $0+! &$E$.&92?)?G3)2D$#+/!$ ##&,!'+:<$!$..$.+$ -;#,!$<&"/,#$. !>)-"#EM !0! #$ "0,!/# "#+$-;#,!$<$!$#!"&$!!$.

PAGE 24

# !$0+! -# '!0+ ,-"&9?>22GG) .:#$!EP#-$&<&+"'<#+ / "#""'2)J!# "2))#+$0! #$"&<$!$ $,#$.G-r!$.,/$.',##+ "$ 9E(G2D'-.!/+"/# ,&r:#08) +$0,!$.0! #$"&<$!$/ "/$"#!#$. <#+-/ "n#!$"#!,'>7#$!9n*))>)8 r0 !$:,&"',$! +$0,!#"..$"## 0! #$"&<$!$&&$&& $.E2(J9)>(( %$;: '$$$/#! 0+ !$&&".#+$!/ "/$"#!# "&<$!$1 ,"#$. -&&$! #$"!. !. &&928G3()*+$!/$"#/:,&"'-",/#,! $!Q&"&#!,/# "& nr 00! ;-#$GP2)8/$&<$!$+!%$&#$./#!#$&"$& ,# "92 >G-r0 #&&,/+ !.$".2G-r& .,-/#!#$:/! &&"@$.< #+()J0! !-.$+.$ !2)-"#E M".1,$"/+$.<#+'/"$$&<$!$/ $/#$. /$"#!,'"'#>))' !G-"#EM ".0/@$./$% ,-$9:<&$&#-#$.$$#& <$!$!$&,&0$".$."(GP ,$! 92)-r0?*2)-r72G-rr'(>E)-r&,/! &$2)J'/$! G) K'C-2)-r>E0! #$&$"+# !/ /@#".)2-rr:(G P ,$!9,$!0,&)(J!# "2)):<&..$ .".#+$-;#,!$<&"/,#$.#EM 2)-"$$#&<$!$/ $/#$./$"#!,'"'#2 >))' !G-"#EM".!$&,&0$".$.<#+ 3P ,$!+$-;#,!$<& .$.# #+$ # 0$! 0!$/+$.&,/! &$/,&+ 9,$!R>)J&,/! &$:"./$"#!,'$.#2>))' !2(-"#EM+! -#"0$$#&<$!$ !$&,&0$".$.",$!/ "#""'2)-r(##+$/ "/$"#!# ()K'C'$"$!#$" ",/$ & -$&/+! -#"<&.'$&#$.< #+2EnC--/! / //",/$&$ 9r&$DG>83D'-.!/+"/# ,&rD#+$ $"=-$/#%#<&.$"$.&',"#: !8-",#$&#>?M 0! .,/$0 ",/$ & -$&/+! -#"<&.'$&#$.<#+)? nC!8-",#$&#>?M+$!$/# "<&&# 00 $.E)-r908): 0,!

PAGE 25

" ",/$ & -$&G>)J"$!&,/! &$'!.$"#<& ,&$. 0,!0 ",/$ & -$&2GE)J "$!&,/! &$'!.$"#<&,&$."$!&,/! &$'! .$"#&<$!$0!$0!$..&& %"'&,/! &$ "#+$,$!r92)-r0?*G)K'C2)-r72G-r2)-r >E)(-r".)G-rr:00! ;-#$>))E) )K' &")G-<$!$ .$. "#+$# 0$! #+$'!.$"#".&-0$& <$!$!/# "$. !28()+ ,!&#()))))' ,&"'3E2<"'"',/@$# # !". !%Bn #!/$"#!,'$9+$!&+$! /$"#/B#+-r:)G-0$!!/# "<&/ $/#$.+$!'-$"#&=$ $/+ !/# "<&"=$.(J'! &$'$$$/#! 0+ $&& nrrr -/$&<$!$,&$.# ".,/$.# .$!$"##$& .$&/!$.0!$% ,&9E*:!$ -/$"$& n)n n)n ) ". r#$) #$ <$!$/,#,!$.# !$/+8)*)J/ ",$"/00! ; -#$3P2)3/$&<$!$ !$&,&0$".$."2)-rr&,00$-$"#$.<#+2)J (-r',#-"$".2)),"#&C0$"/"&#!$0# -/"".0#$."2)/-0 &# !$"$&#/@$0$#!.&+983)*))2)Dn /$"#//:r$.,-<&/+"'$.$%$!E8 + ,!&".E"/ "/$"#!# G))Kr !$#" //.9(3(GD'-.!/+"/ # ,&r:<&.-"&#!#$.".8 /$&<$!$/+"'$.<#+-$.,-/ "#""'(K'C; ;<#+ ) ".2)/+! -#"<&& #$.".",/$ & -$& <$!$0!$0!$.&.$&/!$. %$ nrrrr rrr $#!",/$ & -$!$/ "&##,# "<&0$! !-$.&.$& /!$.0!$% ,&&#.&& 9G)G2:!$!$/ -""#+,-"+&# "$ /#-$ !9((>2".E:&&$-$. !0 $;0!$&&$.".%.,+&# "$&&.$&/!$.9G):< &..$.# 00! ;-#$2A2!!# "2)-r!&0 ?3(r2-r)G-'C-

PAGE 26

n ))GJE)".G-rL-$!/0# $#+" #. &&<&0$! !-$.#ES 00! ;-#$()+ ,!&! -(r,$!# G)r".".&&&#$0 !2 + ,!#G)-r-0$&<$!$"/,#$.#>?S !2+ ,!$ !$&# !'$ "/$,0# E <$$@&;#$"# /+! -#"=# "<&&&$&&$. -#$.r&$.'$&# "+$ #$-0#$,&$.<&"83>0!'-$"#-0$. -0&-./ "&#!,/#9r&". 6 +"& ","0,&+$..#:/ "#""'#< T3)2U",/ $ & -$0 &# ""'&$1,$"/$&9G(: "@"'%$E"."'&#$&".".$" %! E0! #$!+$0! .,/#<&-0$. <#+ "$GV #"#!$#+$"$'/ 9:0!-$! nrrr ) -/$&<$!$/,#,!$."#+$0!$&$"/$ )GK'C -. ;//"$ ".2)Kr !#+!$$.&,/$<$!$0,!$. -GP2)?/$&".&$."2),$!/ "#""'()-r!&20?E)GJE) >G)-r)(G-r2)J '/$! )2-r>E0! #$""+# !/ /@#".)2-rr2()K #"#$. #$#!",/$ & -!!&928"r:<&"/,#$.<#+> 8)K ",/$!$;#!/##EM %$!"'+# +$)G-;#,!$<& .$."# 2GE)J&,/! & $'!.$"#".!/# "$.&.$&/!$. %$)G-0$!!/# "<&/ $/#$.".;$. <#+)(J 0! !-.$+.$&<& $;#!/#$."."=$.'! &$'$$$/#! 0+ !$& & rrn!r (:< )?G--+ $&/! &&! -$/+ #+$!<$!$.!$." 1,!#=&.$92(GG)2GD&/+$!&/$"#/ B#+-r:+$&.$&"./ %$!&0&9E8>33(E*D B." !:<$!$& "/#$.<#+ rW<#$! !>)-""."/,#$.<#+-$#+" %$!"'+#+$/ %$!&0&<$!$#!$#$. <#+2)r7 !E)-".!$.".,!"$. !2( &$/ ".<#+0! 0"$# !/++$"#+$

PAGE 27

/ %$!&0&<$!$"/,#$.<#+-$#+" &,00$-$"#$ .<#+2J-" &"$9(-" $#+ >-" 0! 0#!-$#+ ;&"$9(2GE2D#=X, $!B#$!,!::".GJ/$#//. !()-",#$&"#+$.!@#! -#$-0$!#,!$# $!<&+"'<#+-$#+" ".<#$!#+$ / %$!&0&<$!$.!$.<#+"#! '$"'&".0/$. "+,-.$. ;"#+$.!@ $/+ / %$!&0?)K #+$0&&%#$.& ,# "92)-r& .,-/! "#$08G23-' 9rG)))D&" !::".)> -' #"9(G3G83 *))E&" !:<&..$."."/,#$. "+,-.$. ; !>E+ ,!&"#+$ .!@#$!<&+"'<#+rW<#$!#+$/ %$!& 0&<$!$&&$-$. "#+$1,!#=&.$ &".9G?E8D$'""'$/+" &# "r:#E %$!"'+# 2)))D +$!&+$!/$"#/B#+-r:".<&+$.< #+G),$!#$!/! &&"@$.<#+ )GJ0! !-.$+.$ !2G-"#E 2))K #+$&-0$&<$!$ .$."# #+$ < /+-$!#$!<&+"'<#+G),$!-'$&<$!$ /1,!$.,&"'F$&&; &$!%$! 2r",r/! &/ 0$9F$&&$!-":$1,00$.<#+ "0+"0 /+! -#/2))P C2E35$/#%$9F$&&$!-":"."% %$G2(;G2(r/-$! 9+ # -$#!/&,/& "F:+$, !$&/$"#"#$"& # #-$#!/$&<&'$"$!#$.-'$6

PAGE 28

"./@'! ,"."#$"&#<&&,#!/#$.! -!$& ,!! ,"."'#+$&0 # "#$!$&#+$ 0+ # $/+"'&#$0&<$!$.$#$/#$.+"'7$""$. #$!"'9G>:&# '!-<& / "&#!,/#$.,&"'.#! -#+!$$ '/!$0/ #$&<#+$/+-$&,!$-$"# %$!2)) ".%.,&0 #&"=$.rnrn#% -$&,!$-$"#&<$!$0$! !-$.#>?M "F$&& r?8),&"'0 /+! -# ""#/ !/ !!$/#$.9:2(E)P<#$! 5 $/#%$$&<$!$&$$.$. "'&&.&+$&#+$ .$ !$#+$$;0$!-$"#;/## <&0$ !-$.<#+#+$E88"-"$ ()-B !' "&$! !"#!/$,!-$&,!$-$"#&#+$.$ &!$.!$/ !."'0 &# "<&/+ &$""#+$ r-'$,# / !!$# "/,!%$&<$!$.$!%$.! !$&/$"/$,/#,# ""&&,&"' #+$ !>& #<#+#!0$#,"/# #+$$ < $1,# "29GE:A n nr n n n <+$!$ &.,& "#-$&#+$",-$! $/,$&" #+$/ /% ,-$+$&=$ #+$/ /% ,-$ #$%% <&/!#$.,&"'&$!$&.,# + .-"$ '!$$".$" +$/ "/$"#!# "'2<&.$#$!-"$.# +$$1,# "(A &'()*+, /012n13n#$%% 2 +$/ "/$"#!# $". '$" ,&"'2<&.$#$!-" $.#+$$1,# ">A

PAGE 29

r 45678957:;<=58>?@A<=58> @BC n 10D1 E <+$!$)*)&#+$!# $". '$" ,&"'2# "'2<+/+<&.$#$!-"$.<$&#$!" ##"'+$",-$! "'2$/,$&"&" '$-/$",/$,&<&//,#$.#+$ $1,# "EA .F GE HI>JnBKLMNOP/012P13G <+$!$ I>QRSTI56J20QRS BKLMNO&#+$/ "/$"#!# $". '$" ,&"'2 0! #$" rnnrr#"% +<&0$! !-$.&.$&/!$.0!$% ,&9E*:! $-/$&<$!$/! &&"@$. <#+2(J !-.$+.$9(8*)8D+$!&+$!/$"# /B#+-r: !2)-"#! #$-0$!#,!$".1,$"/+$.2(G-r'/"$$&< $!$<&+$.&$1,$"#<#+,$! 9G)-r0?*2E)-r2)-r2)J /$! )GJE)".)(GJ !# "2)):,$!92)-r!&08) ())-r".2G-r:". ,$!92)-r!&2))-r2G-r )2J.$ ;/+ #$".)GJ ,! &!/ &"$:+! -#"<&!'-$"#$.# #+ $&=$ ())G))0!$r & "/# !92>)D "/&$<# <": !3)// $&#$!"#"'()&$/>)&$/ <#+-0#,.$ (GJ %$!#+$&=$ & "/ #$./+! -#"!'-$"#&<$!$ $;#!/#$.0+$" /+ !-9033C?*:9" r*?>):$;#!/# "-$#+ .+$"#+$ !'-$"#&<$!$"=$.(J'! &$'$$$/# 0+ !$&& #+$&#$2J!# 2))<&..$.".#+$&,0$!"#"#&<$!$/ $/#$. #())));' !2)-"< &$# !$/ #$"$.&92)2(E2$$/+" '$&!& .:<$!$0!$<&+$.&$1,$"#<#+ ,$!2(".>!$&0$/#%$".0$$#$ .$/+#-$#G));' !>-"#EM:

PAGE 30

#+$0!$/$"$.&#$&!/# 0!$<&+$.$ .&<$!$..$.# $/+&#$<#+2-'C9?*)3'-:".)(G-'C-&"&0$!-9 2G3>()22"%#! '$":"."/,#$. #EM !(+ ,!&!$.& ,$/+! -#"&<$ !$/ $/#$./$"#!,'# "+$!$&# #+$ 0!$<&+$.$.&<$!$ /@$...# (G-'C -".)(G-'C-&" &0$!-"."/,#$. "#+$! /@$!#EM %$!"'+# +$0!$/$"&#$&<$!$"/,#$.<#+ "# .$&"#;?9&/?)(>(D"#!,= #$/+ '"#!,=:"#;( 98))EED/--!.'$r:"#r$289&/2)? EED"#!,= #$/+" '"# !,=:"#"'292>*2DrB ,!"r:" .,&$'9G>82D'-.!/+ "/# ,&r:!$&0$/#%$!$<&+$.0!$ /@$.$.&<$!$..$.# #+$--," / -0$;"/,#$. !>+ ,!&+$!$/ %$!$.$.& <$!$<&+$.-,#0$#-$&<#+ ,$!9G)-r0?*G))-r2)-r0 8)2JE)".)?J & .,-.$ ;/+ #$:+! -#"0! #$"/ -0$;$&< $!$$,#$.#3GM..# (2)K -#$-0$!#,!$$,# ",$!9G)-r!&0 8)2)-r08)".2J :+$--," 0!$/0##$./ -0$;$&<$!$&$0! #$.! -#+$$.&"..$/! &&"@$.# 3GM %$!"'+#+$&-0$&<$!$#!$#$.<#+2GK ()-'C-&$".()K () -'C-! #$"&$7"."/,#$.#GGM !(+ ,!& !.'$&# "".& # !'-$"#&+$!'-$"#&<$!$$;#!/#$.<#+0+ $" /+ !-9033C?*:0! /$.,!$ +$--," 0!$/0##$.&<$!$1,"#$.,&"' '+#/$!E8))'!$$"-&#$! -;9)E?)?G23))2D /+$,#$6:<#+00$ &&#$-!0/#$!$/# "& <$!$/!!$. ,# !$/+&-0$+$$/$"/$& +<$!$1,"#$.!$#%$# &#".!. /,!%$0!$0!$.,&"'"0,#/+! -#"+$&$1,$"/$& #+$0!-$!&,&$. !1!$&
PAGE 31

0.+$%$!&$ $,! .29(@: !@: !@:$%$!&$ .+(9R(@: !P2)8 /$&".&$.,&"',$!/ "#""'()-r!& 0?E)2JE)>G)-r )(G-r()J'/$! )2-r>E)2-rr".0! #$""+# !/ /@# #$!0!$/$"$.<#+0! #$"$.&#+$&#$ <&"/,#$.<#+"#-'! &$ $.&92G>8DrB ,!"r:+$$.&<$!$<& +$.,&"',$!/ "#""'()-r !&08)2JE)())-r7)(-r ".)2-rr+$0! #$"& <$!$!$& %$.,&"',E2(J&!&$9)> (2D$$/+" '$&!". &".:".<$!$#!"&$!!$.# )EGY--"0 %".$"$, !.$-$-!"$ 9r0 !$!-&#.#$!-":0$//0! #$"& <$!$0! $.<#+"#+/2932>D/#%$ r #!&.:"."#"'292>*>Dr B ,!"r:"..$#$/#$.<#+ ,&9$#+/!$##&,!'+:r$-!"$&<$! $-'$.,&"'+$/&&#$9 .$!/,$&:

PAGE 32

"#"% <&0$! !-$.&.$&/!$.0!$% ,&9E*:B. #0$ !' !% !')!' ". !%)!% -/$&<$!$0#$. "/ %$!&0&"./,#,!$. !(E+$&<$!$;$. ,&"'()J0! !-.$+.$ !2)-"$&<$!$ <&+$.<#+"."/,#$.<#+)(J !# "2)) !2)-"#$!<&+"'<#+&/ /@"',$!92)-r0?()2J !# "2))".))GJ<$$"():/$&<$!$"/, #$.<#+ /@"',$!9&/ /@"' ,$!0,&>J' #&$!,-".>J %"$&$!,-,": !2+"#>7(?-$>"# 9)?EE*r0 !$$!/r&&/+,&$##&:.,# $." /@"',$!<&"/,#$.<#+/$& !(+#! -#$-0$!#,!$#$!<&+"'<#+& / /@"',$!$;E88Z$$.' # "#Z!#"# .922))8$$/+" '$& !&.:.,#$." /@"',$!<& "/,#$.<#+/$& !2+$&<$!$!"&$.<# +".<&+$.<#+&/ /@"',$! #$!"/,#"'<#+)2Y'C-+ $/+&#/$&<$!$ <&+$.".,"#$. "&.$&<#+! "' "#.$!$'$"#&9?E82D$$/+" '$&!& .:+$-'$&<$!$#@$"". 0! /$&&$.&.$&/!$.0!$% ,&9E8:

PAGE 33

nnn &!nr!nnr!rrr !!rr' nr "%$&#'#$#+$ &&$-&# /+ -$#! // -0$;$& "/+! -# "<$ .$%$ 0$." %$-+00! /+9'2:<+/+ &&$. "&"'$$/,$, !$&/$"/$ -/! &/ 0 $-"#$#+$0 &&# "#$!$ !$"/$ $;&#"'$". '$" ,&/ ,"#$!0!# 0! #$"&<#+,& "0! #$"&"#+$/$#+$ /,& "'$"$&<$!$&#".".,/ $;0!$&&$."#+$!/ !!$&0 "."'@" /@ ,#-/$ & 0!$&$!%$&& /# // -0$; <#+/+! -#".,!"'0,!/# "/$&<$!$/! & &$."@$.<#+0! !-.$+.$0! !# /$ &&+$$;#!/#$.//+! -#"<&&,5$/#$.# r&$.'$&# "# 0! .,/$" .". 0 ",/$ & -$!/# "&+$/",/$ & -$/ -0 $;$&,!#+$!&$0!#$.&,/! &$ '!.$"#,#!/$"#!,'# "+$& #$.!/# "&0""$.# "=$<$!$"/ ,#$.<#+ #"#$."# .$& '"&#$#+$! !+&# "$+$!$&,#"'/ -0$ ;$&<$!$-=$. "1,!#=&.$#+# +.$$"0&&%#$.".,"/# "=$.<#+$,#!% ."% #"$,#!%.""#$!/# -/! &/ 0<&,&$.# /1,!$-'$&#/@&< #+&$!$;/## "# $;/#$, !$&/$"# 0! #$"&&& /#$.<#+0! #$"/ -0$;-'$&# /@& <# .$"#&,!/$ ,". $/,$&&.&#"/#&0 #&/+.&/!$#$&0 #& !$0!$&$"## &"'$/ ",/$ & -$/ -0$;$&-'$6<&,&$.# /!$#$#+$ #-$#!/$& !$&/$"#"#$"&#! #+$/1,!$.-'$&#/@&+,"'Z7$""$.#$!"' 9G>:<&,&$.# .$"##+$ 0+ # $/+"'&#$0& 0+ !$&<+/+/ !!$&0 ".# #+$",-$! 0+ !$ && /#$.<#+0! #$" !$;-0$ "$/ 0! #$"0!$&$"#"#+$/ -0$;#+,& "$

PAGE 34

0+ # $/+"'&#$0"#+$#-$#!/$ !$&/$" #"#$"&#< ,.$ &$!%$.#+$!$!$%$ /0!$&$"#"#+$/ -0$;#+$<$/+" #+$&$1,$"# !.$!#+$!$ !$%$ 0+ # $/+"'&#$0&< ,.$.$#$/#$. /$!##+$-+00! /+<$'$"$!#$." -$!/"..-$!/&+$ 0! #$"&<$!$-=$. "#+$0&&%#$.$,#!% ."/ #$./ %$!&0% #"#$."# "# .9'2/:-/! &/ 0<&,&$. # .$#$/##+$.&/!$#$0 "#& "#+$&,!/$ "./#"'".%.,0! #$"&+$,"/# =$./ %$!&00!$%$"#&" "&0$//"."' 0! #$"&# #+$&,!/$"&& !$& /$"/$#!5$/# !$& -$!/& "./#$.#+#*?J &0 #&!$ "$&#$00+ # $/ +"'<+$>J!$#< &#$00+ # $/+"' <+/+// ,"#& !!". -/ /=# "9'2: !.-$!/&?)J<$!$#< &#$0 0+ # $/+"'9'2/:<+/+&/ "&&#$"#<#+ #+$0!$% ,&!$0 !# 0! # 0[)8) !"".%.,0! #$"# $, !$&/$"#9GG :+$>J".?)J%,$&<$!$,&$.# 0!$./##+$&&$-&# /+ -$#! // -0$;$& "/+! -#"<+/+<&!$0 !#$."#+$ #$;#,"$&& #+$!<&$"./#$.

PAGE 35

*

PAGE 36

n *"#$ %%&'.$%'" '"#%$ $$%" % $ +$.#n, % "# 7-/$&&#$;0!$&&"'/,& "0! # $"&<$!$ '$"$!#$.,&"'$"#%!#!"&.,/# "+! -#"& !$$;#!/#$.! -#+$&$/$"$&". &,5$/#$.# r&$.'$&# "/",/$ & -$/ -0$ ;$&!$,!#+$!0,!$.<#+&,/! &$ '!.$"#/$"#!,'# "+$& #$.",/$ & -$& !$-=$. #"#$."# '"&#$#+$! !+&# "$ "1,!#=&.$#+ #+&$$"0&&%#$.".,"/# "=$.<#+ $,#!%.""'$$/,$-/! &/ 0&,&$. # /1,!$-'$&#/@&# &&$&&#+$ /$,!&# /+ -$#! // -0$; "/+! -#" 9/:+ # $/+"'$+% -$!/9:"..-$!/9/:&+$0! #$" &!$-=$. "#+$0&&%#$. $,#!%."/ #$./ %$!&0 #"#$."# "# .-'$&&#/@&!$/1,!$. <#+-/! &/ 0"., !$&/$"#"#$"&# # -$#!/$9/@"$&:<$!$"=$. -'$6+$0+ # $/+"'&#$0&<$!$.$"#$. +,"'7$""$.#$!9!$."$&:+!$$ '/!$0/#$&!$"=$.<#+$/+-$&,! $-$"#/ "#""' %$!2))".%.,&0 #& ".!$&,#&!$-$"\/$!GK

PAGE 37

(r"nn)r rnrn ,!#+$!%$!#+$//,!/ #+$-+00! /+<$/ ,"#$.#+$",-$! >><#+"",/$ & -$9'($:r ",/ $ & -$&<$!$0!$0!$.! 1//1//!.*+ E)/$&<+$!$ #+ 1/*/( ". 1/*/ +%$$$".$0$#$.9E8:+$>> ",/$ & -$&<$!$-=$. "#+$0&&% #$.$,#!%."/ #$./ %$!&0 #"#$."#("# ."&& !$& /$"/$#!5$/# !$&"./#$.#+#9?G\(:J &0 #&!$#< &#$00+ # $/+"'#+$0! # "".%.,# $, !$&/$"#<& #@$""# // ,"#2))J >>",/$ & -$+ ..-$!/>> $;-"$<+$#+$!#+$-+00! /+/".$#$/# -$!& 0! #$" ",/$ & -$<$"=$. -$!=# 7 2 "",/$ & -$9'(5:&"/$ 72 !-&#!-$!"& ,# "932:72<&# !"&$"#$;0!$&&$."7(*>/$& +$0!$&$"/$ $". '$" ,&720! #$"0!$%$"#&1, "#"'#+$$;/#&# /+ -$#! 72 "",/$ & -$<+$ %$!$;0!$&& <&&& $&&"'#& -$!=# "&##,& r ",/$ & -$&<$!$0!$0!$.! -72#!"& $/#$.7(*>/$&". -=$. "#+$0&&%#$.$,#!%."/ #$./ %$!&0 #"#$."#("# "&& !$&/$"/$#!5$/# !$&"./#$.#+ #EJ23J(GJ()J2?J".28J &0 #& !$ "$#< #+!$$ ,!%$".&;&#$0 0+ # $/+"'!$&0$/#%$,!.#&,''$&# #+# "$",/$ & -$/"&& /#$<#+,0# &;7 20! #$"&"&,--!#+$-+ 00! /+&.!$/#".&$"&#%$#$/+"1,$# 1, "###%$&&$&&&&$-&# /+ -$#! $0'$"$#// -0$; "/+! -#"

PAGE 38

)

PAGE 39

r ) / '( %%&#$.#n % "#01"#%$ "%$'23#4%3 %"#%$1 9$: 1//1//!.*+ E)/$&/ "#".-$! >><#+" ",/$ & -$'! &$'$$$/#! 0+ !$&&"&& &$;#!/#$.! -",/$ & -$& 0!$0!$.! 1//1//!.*+ E)/$&9:,/$ & -$&<$!$-=$. "#+$ 0&&%#$.$,#!%."/ #$./ %$!&0&,!/$ #"#$."#("# .9: &-0$&"'$-'$ #+$/1,!$.&$1,$"/$ -/! &/ 0&&+ <"9/: !$0!$&$"##%$ .&#!,# #< &#$00+ # $ /+"' !$&/$"/$#!5$/# !9/@"$: .$#$/#$.+,"'7$""$.#$!9!$."$:&&+ < "9.:+$0$!/$"#'$ 0+ # $/+"' &#$0& >><#+"",/$ & -$9$:95: 72$;0!$&&$."7(*>/$& -$!=$& "",/$ & -$'! &$'$$$/#! 0+ !$&&"&& &$;#!/#$.! ",/$ & -$&0!$0!$.! -7(*>C !.*+2(+ /$&9:,/$ & -$&<$!$-=$. "#+$0&&%#$.$,#!%."/ #$./ %$!&0 #"#$."#("# .9':+$ !! <+$.&-0#+#72 -$!=$&&#$0< &$ "",/$ & -$!$0!$&$"##%$ &"'$$/,$-'$ #+$/1,!$.&$1,$"/$&& + <"9+:-0$& !$&/$"/$ #!5$/# !$&9/@"$:".0+ # $/+"'&#$0& .$#$/#$.+,"'7$""$.#$!9!$."$:!$ &+ <"9:+$0$!/$"#'$ 0+ # $/+"'&#$0& 72 "",/$ & -$$&,#&!$ -$"&\+$,.$" #$&!#!!,"#/$ !GY

PAGE 40

$rrn r!! 1,"##+$&# /+ -$#! 2/ -0$;# ",/$ & -$ <$ "#! .,/$#+$ )*++n ,& "'$"$& )n )n )#$ ". ) "# @" /@ ,# -/$&!$&0$/#%$;(;?".r$28!$# +$/ !$&,,"#& /" "/2 9/2:/ -0$;$&". #+$ #+$!2/ -0$; $&/ "#""'2"#+$/ !$&,,"#98: +$$;0!$&& #+$,& "0! #$"&<$!$".,/$. )GY'C;,"$&& #+$!<&$"./#$. n!" /$&<$!$"/,#$.<#+2)Yr !>.&# $0$#$ /,&9+$!$#$! :+$2",/$ & -$/ -0$;$&<$!$& #$. -/$&". !/# "=$.,#!/$"#!,'# "'! &$'$$ $/#! 0+ !$&&<&,&$.# "=$#+$ .&#!,# ",/$ & -&$;#!/#$.! -,# !/$"#!,'# "!/# "&9'>:!/# 28#+$0$@ ",/$ & -$&<&&$$/#$. !# +$-+"&&+$2 ",/$ & -$/ -0$;$&<$!$-=$. "#+$0 &&%#$.$,#!%."/ #$./ %$!&0 #"#$."#>"# .9'>:+$+"&&"./#$.#+#*83J*?(J *?(J".*?(J ".%.,, !$&/$"#&0 #&+. "$$/,$ ;(;? r$28"."'2!$&0$/#%$9'>: +$&$.#&,''$&#"&&$&# /+ -$#! 2A2 !2# ",/$ & -$ !,$ ,#&&,$& +&# "$$0# 0$//$&&# <$-=$.#+$2 ",/$& -$/ -0$;$& #"#$."#(" # .&<$9'>/:+$&-$ !$&,#&<$!$ #"$.,#="'"("# "&#$. "#>"# .# -=$ #+$2" ",/$& -$/ -0$;$&"..# <$& -=$.#+$2 ",/$ & -$/ -0$;$& #"#$."# "# .9'>.:+$-=# 0! .,/$.#+$&-$!$&,#&&#+$-=# "# .$&'"&#+&# "$& "%$&#'#$ <+$#+$!#+$$;0!$&& "$%$ 0! #$"",$"/$# +$&&$-&# /+ -$#!<$0!$0!$.

PAGE 41

" ",/$ & -$&! n)n -/$&"#+$0!$&$"/$ %!"' ; / "/$"#!# "&+$&&$-&# /+ -$#! ;(# ",/$ & -$<&" # $/#$.#&0! #$"$;0!$&& "$%$9'>$: "/$&,/! &$'!.$"#,#!/$"#!,'# "& &$. "#+$% ,-$".-&& 0!#/$&#&0 &&$#+##+$&&$-&# /+ -$#!-$ .$!$"#"'!/# "&+$-+"&&&+ <$.#+#!/# "&((".(>+%$#+$&-$ &&$-&# /+ -$#!&!/# "289'>: &$$@ ,#".$0$".$"#$%.$"/$ !#+$&&$-& # /+ -$#!<$0$! !-$.&"'$ $/,$/ /=# "&&9'>': #+ )*+ n ". rn3n ,& "0! #$"&<$!$ / $;0!$&&$."#+$ n -/$&+$/! &&"@$." ",/$ & -$!/# &<$!$ 0!$0!$.& %$+$&"'$$/,$/ /=# ""&&&+ <$.#+#(>J ;( ".-+$!!;( %$!0<+/+// ,"#& !!". / /=# "+$&-$"&& .&0$.2EJ ;?".-+$!!;?/ / =$r !$ %$! #+;(". -+$!!;?,& "0! #$"&<$!$/ $;0!$&&$." n -/$&"&&& %$ &+ <$.#+#(>J ;(".-+$!!;?/ / =$+,&#+$&$.#&,''$&##+# "$ 2".& "$" ",/$ & -$

PAGE 42

5

PAGE 43

5 #"''' $0'1%"#%$1%&6.*% % $%%"'%%$ 9:'! &$'$$$/#! 0+ !$&&"&& ",/$ & -&$;#!/#$. -!/# "& G>)J&,/! &$'!.$"#,/$ & $&<$!$$;#!/#$.! n)n n)n ) ". #$)#$ -/$&&-0$-'$ '! &$ '$&&+ <"!/# "28"./#$.!! <+$.$ <#+$'$<&,&$. !&"'$$/,$ -'"'9.:+$0$!/$"#'$ !$&/$"/$ 0+ # $/+"'&#$0& ;( ;?"'2".r$28 "" ",/$ & -$ -!/# "28+$2 ",/$ & -$/ -0$;$&<$!$-=$. "#+$0&&% #$.$,#!%."/ #$./ %$!&0 #"#$."# .$&.!$/#$.'"&#>9:( 9/:".9.:$&,#&!$-$"&\ 9$:+$0$!/$"#'$ !$&/$"/$0+ # $/+"'& #$0& ;( "" ",/$ & -$ 0!$0!$.! n)n /$&"#+$0!$&$"/$ ;/ "/$"#!# "& )Y'C -9/@!: )GY'C-9!$.!: !()Y'C-9'!$$"!:+$ ;(",/$ & -$/ -0$;$&<$!$ -=$. "#+$0&&%#$.$,#!%."/ #$./ %$!&0 #"#$."#>"# $&,#&!$-$"&\9:+$0$!/$"#'$ $&/$"/$0+ # $/+"'&#$0& ;( "" ",/$ & -$! -!/# "&((".(>+$ ;(",/$ & -$/ -0$;$&<$!$ -=$. "#+$0&&%#$.$,#!%."/ #$./ %$!&0 #"#$."#>"# $&,#&!$-$"&\9':"'$$/,$/ / =# ""&&;(".-+$!! ;(<$!$&#/ $;0!$&&$." n -/$&9# 0:;?".-+$!!;?<$!$ &#/ $;0!$&&$." n -/$&9-..$:;(".-+$!!;?<$!$ &# / $;0!$&&$." n -/$&9 ## -:+$2",/$ & -$/ -0$;$& -!/# "28 <$!$-=$. #"#$."#>"# 9$#:".-+$!!9/$"#$!:<$!$ -'$.%$! #+$#< -'$&9!'+#:&+ <&(> J/ /=# "/$!GY

PAGE 44

$nrrrrr rnrr &&$&&<+$#+$!#+$2,& "0! #$"&$+ %$&#+$!$". '$" ,& / ,"#$!0!#&<$0$! !-$. /+$-/&&& / -0!$#+$$%$ #+$,& "0! #$"&# #+$!$". '$" ,&/ ,"#$!0!#&<$0$! !-$.<$&#$!" ##"'$;0$!-$"#&+$"=$..# "./#$.#+##+$$%$& ;?"."'2 !$&-!# #+# #+$!$". '$" ,& / ,"#$!0!#&#)GY'C;<+$#+$/@'! ," .$;0!$&& "$%$ ;(&&-! # #+# #&$". '$" ,&/ ,"#$!0!#9'E: #$&#<+$#+$!#+$,& "0! #$"& !-// -0$ ;$&<$0$! !-$./ --," 0!$/0## "9 :$;0$!-$"#&+$ .#"./#$.#+#;(;? ".r$280!$/0##$$". '$" ,&"'2".+/ 2<+$"'20!$/0##$& $". '$" ,&+/29'E:"..# "# "%$&#' #$<+$#+$!2,& "0! #$"& //,0 0! #$!& $". '$" ,&'$"$&<$0$! !-$./+! -# "--," 0!$/0## "9+:&& +$+.#"&&"./#$.#+#;( ;?"'2".r$28!$ $"!/+$.##+$0! #$!& @" <"2#!'$#'$"$ &9'E/:+,&#+$&$.#"./#$#+# #+$,& "0! #$"&,"/# "&&#+$!$". '$" ,&/ ,"#$!0!#& 1,"##+$$;/#",-$!".#+$/ "/$"#!# 2/ -0$;$&"-/$&<$ 0$! !-$., !$&/$"/$ !!$# "0$/#! &/ 09 :$;0$!-$"#&9'E.:+$ / "/$"#!# "".#+$",-$! "'2<$!$$&#-# $.# $)2(Yr&&,-"'#+##+$ 00! ;-#$/$",/$,&&=$&2) U 2) U GK-$0& .+$1,"#$."'20! #$"" %$/$&<&00! ;-#$28)))$/,$&,!# +$!!$#+$",-$! 0 / -. -"& +&$$"$&#-#$.# $ ,#23)))93:+,&#+ $",-$! 2/ -0$;$&! ,'+$1,& # #+$",-$! 0 / -. -"&

PAGE 45

7

PAGE 46

n 7#&%%&"% %&# (%%"% 9:B$&#$!" #"&& 0! #$"$%$&,&"'"# .$&. !$/#$.'"&#$". '$" ,&0! #$"& "/$, &#""'<&,&$. !#+$ ."'/ "#! ]"./ #$&" "&0$//".&9:"&& #+$ "#$!/# $". '$" ,&"'2".+/2<#+ 2,& "0! #$"&;#!/#&<$!$ 0!$/0##$."#"# .+$0!$/0##$& <$!$"=$.--," ##"',&"' "# .$&.!$/#$.'"&#"'2".+/2+$" 0,#/ "#"$.GJ #+$$;#!/#B.$" #$& 72(2-/$&]"./#$&" "&0$//".&9 /:+"&& #+$"."'2 ,& "0! #$"&# $". '$" ,&#!'$#'$"$0! #$!& +$!'-$"#$./+! -#"&& #$.! n)n n)n ) ". #$)#$ -/$&<$!$ 0!$/0##$.,&"'"# .$&.!$/#$.'"&#;( ;?"'2".r$28!$&0$/#%$ $&,#&!$-$"&\9.:W,"#/# #+$" ,-$!".#+$/ "/$"#!# "'22 / -0$;$&"-/$&+$,# / !!$# "/,!%$& 9/@. #"$:<$!$##$.<#+ "$ / -0 "$"#.$ !$$.,& ""><#+#!0$ #,"/# "9!$."$:+$#$&+ <&#+$ !# $". '$" ,&# #''$."'20! #$"9 "C;:.$#$/#$.<$&#$!" ##"'#+$ / "/$"#!# $". '$" ,&"'2"."'2 ,& "".#+$",-$! $". '$" ,& "'20! #$"

PAGE 47

$rrn rn #+ ,'+!/# "(> #+$&,/! &$'!.$"#�/ / "#"& #+" ",/$ & -$& "..",/$ & -$&*?(J ".%.,, !$&/$"# &0 #&+%$ "$;($/,$<+/+ &,''$&#&#+##$&#.",/$ & -$/"&& /#$ <#+ "$29'>".'>: ,!#+$!"%$&#'#$#+$&&$-&# /+ -$#! 2# 0 ",/$ & -$&<$ & #$.",/$ & -$&/ "#""'" .#! ".0 ",/$ & -$&.$!$"#r&$ .'$&# "/ ".# "9'G:!/# "2*,&$. #+$-+"&&/ "#"$.9E8\(:J 9>2\G:J".9()\3:J ",/$ & -$&.",/$ & -$&".#!",/$ & -$&!$&0$/#%$ +$-;#,!$ ",/$ & -$&<&-=$. # "#$."#>"# "#+$0&&%#$. $,#!%."/ #$./ %$!&09'G/:+$-+ "&&"./#$.#+#*E>J*E>J *G8J".*E?J ".%.,, !$&/$"#&0 #&+. "$$/,$ ;(;? r$28"."'2!$&0$/#%$9'G.: +,&#+$&$.#"./#$#+# "$2 /"&& /#$<#+#!",/$ & -$& ,!#+$!"%$&#'#$#+$&&$-&# /+ -$#! 2/ -0$;<$'$"$!#$. -;#,!$ ",/$ & -$&/ "#""'",/$ & -!! &!'$!#+"#!",/$ & -$&9'G: !/# "((/ "#"$.923\*:J".92)\G:J 0$ "#",/$ & -$&".+$;",/$ & -$& !$&0$/#%$+$-+"&& !/# "(( &+ <$.#+#?2J83J?2J".G?J ".%.,, !$&/$"#&0 #&+.#< $/,$& ;(;?r$28". "'2!$&0$/#%$9'G.:"./#"'#+# "$ 2/ -0$;/"&& /#$<#+-,#0$ ",/$ & -$&!/# "(>/ "#"$.92?\3:J".92 (\G:J +$;",/$ & -$&". +$0#",/$ & -$&!$&0$/#%$+$-+"& & !/# "(>&+ <$.#+#()J283J ((*J".283J ".%.,, !$&/$"#&0 #&+. #< $/,$& ;(;?

PAGE 48

r$28"."'2!$&0$/#%$9'G.: '$#+$!#+$&$.#&,''$&##+# "$2 /"&& /#$<#+-,#0$",/$ & -$& "!rrrr rrrrn 0! %.$..# "$%.$"/$ #+$2&& /# "<#+-,#0$",/$ & -$&<$ !$/ "&##,#$.#$#!",/$ & -".2G-$!0 ",/$ & -!!&! -!$/ -""#+&# "$ /#-$!&<#+ #"# "$$".9'G$':+$ #"",/$ & -!!&<$!$"/,#$.<#+ ",/$!$;#!/#! ) -/$&9'G$:+$-;#,!$<&&,5$/## &,/ &$ '!.$"#,#!/$"#!,'# "".!/# "&/ "#" "'#+$",/$ & -!!&9!/# "&((".(>: <$!$"=$.+$"'220 ",/$ & -$/ -0$;$&<$!$-=$. #" "#+$0&&%#$.$,#!%."/ #$./ %$!&0" && !$&/$"/$#!5$/# !$&"./#$. #+#E(J".G?J ".%.,, !$&/$"#&0 #& +%$#< $/,$& "'2 #$#!",/$ & -$ !!/# "&((".(>!$&0$/#%$ 9'G:".>)J ".%.,, !$&/$"# &0 #&+&#< $/,$& "'2 "2G-$!0 ",/$ & -$"#$!$&#"'#+$!$<$!$ #+!$$$/,$& "'2 "2G-$!0 ", /$ & -$+,&#+$&$.#&,''$&##+# "$2/"0 #$"#&& /#$<#+?",/$ & $&

PAGE 49

r 8

PAGE 50

8#"''' $0'1%"#%$1%&6 .*%% %'1"'%%$ 1 9:'! &$'$$$/#! 0+ !$&&"&& ",/ $ & -&$;#!/#$.! -!/# "& 2GE)J&,/! &$'!.$"#,/$ & -$&<$!$0!$0! $.! n)n n)n ) ". #$)#$ -/$&$0!$&$"##%$-'$& '! &$'$!$ &+ <"!/# "&2*((".(>"./#$./ !/ .$.!&$ <#+$'$&<$!$,&$. &"'$$/,$-'"'9/:/+$-#/.$"&# !# #+$-=# 2",/$ & -$/ -0$; "#+$&,!/$ #" #$."#>"# .9.:+$0$!/$"#'$ !$&/$"/$0+ # $/+"'&#$0& ;( ;?"'2".r$28 0 ",/$ & -!!+$/ !/ .$.!&!$. $&/!$."9'G:+$/@! "./#$&#+$0$!/$"#'$ 0+ # $/+"'&#$0& 20! #$"& "" ",/$ & -$ <+/+&!$0/#$.! -9'>:$&,#&!$-$ "&\9$: <.'!-.$&/!$&#+$ 00! /+,&$. !"="'#+$&&$-&# /+ -$ #! "'22/ -0$; !$/ "&##,#$.#$#!",/$ & -!!9:".2G$!0 ",/$ & -!!9':9':'! &$ '$$$/#! 0+ !$&&"&& ",/$ & -&$; #!/#$.! -#+$!/# "&"./#$. %$ #+$'$9$#:$0!$&$"##%$&"'$-'$& #+$ /1,!$.&$1,$"/$&!$&+ <"9-..$:+$ 0$!/$"#'$ !$&/$"/$0+ # $/+"'&#$0& &-0$&! -!/# "&"./#$.&&+ <" $&,#&!$-$"&\/$!GY

PAGE 51

rrr!rr rr*nr r,!0 #$"#"..$!$"##$./$&+%$.&#"/# $#,!$& /+! -#"93(3>: ,!#+$! "%$&#'#$<+$#+$!#+$/$.$!$"## "/" ",$"/$&&$-&# /+ -$#! 2 ",/$ & -$/ -0$;7-/$&/ -0$-$"#$.<#+ #+$ )*++n ,& "'$"$<$!$ ".,/$.# .$!$"## !-"'$-! $&9&:#$!2)..$!$"## "#+$ 2" ",/$ & -$/ -0$;$&<$!$0!$0!$.". -=$.9'3/:+$+"&& #+$" ",/$ & -$!/# "2G" ./#$.2A2&&$-&# /+ -$#! 2# ",/$ & -$9'3.:<+/+&#+$&-$ &,".$!$"##$.-/$&+$+"&& !/# "()"./#$.#+#2?2J ?2J33J".83J ".%., !$&/$"#&0 #&+%$#< $/,$& ;( ;?r$28"."'2 !$&0$/#%$9'3.:"./#"'#+##< !'$!!/# #+$;(/ "#""'2 / -0$;&& /#$&<#+.",/$ & -$&+$&$.#& ,''$&##+#.",/$ & -$/"&& /#$ <#+#< $/,$& ;(#+#&"/ "#!&#<#+ ,".$!$"##$.-/$& ,!#+$!"%$&#'#$<+$#+$!/$.$!$"## "&$$/#%$#$!&#+$&# /+ -$#! ;(# 0 ",/$ & -$<$0$! !-$.-#$.. '$&# /+! -#"!$.,/"'r&$ / "/$"#!# "9'3:!/# "((".(>/ "#" $.",/$ & -!!!'$!#+" #!",/$ & -$9'3:+$-+"&& !/# "(("./#$.#+#>2)J2(*J 22EJ".2))J ".%.,, !$&/$"#&0 #&+% $#< $/,$& ;(;? r$28"."'2!$&0$/#%$9'3.: +$-+"&& !/# "(> "./#$.#+#G(8J(G?J(?J".>2J ".%. ,, !$&/$"#&0 #&+%$#< $/,$& ;(;?r$28"."'2!$ &0$/#%$9'3.:+$!$ !$#+$&$ .#,!#+$!"./#$.#+##< .!'$!!/# #+$;(/ "#""'2/ -0$;$&

PAGE 52

&& /#$&<#+",/$ & -$&#+#+%$&$/ ".2 / -0$; ,"."&,-#+$&$ &$!%# "&&,''$&##+#/$.$!$"## "& $$/#%$#$!&#+$&&$-&# /+ -$#! ;(0! #$" "/+! -#"

PAGE 53

9 9."''(&& %'"!'1 # $0'1%"#%$1%&6.02) %%"#%$ 9:'! &$'$$$/#! 0+ !$&&"&& ",/$ & -& $;#!/#$.! -!/# "& 2GE)J&,/! &$'!.$"# ,/$ & -$&<$!$0!$0!$.! n )n n)n ) ". #$)#$ .$!$"##$.-/$& $0!$&$"##%$-'$& '! &$'$!$&+ <"! /# "&2G()((".(>"./#$./ / .$.!&$ <#+$'$&<$!$,&$. !&"'$$ /,$-'"'9/:/+$-#/ !$0!$&$"## #+$-=# 2", /$ & -$/ -0$; "#+$&,!/$ #"#$."#>"# .9.:+$0$!/$"#'$ !$&/$"/$0+ # $/+"'&#$0& ;(;?"'2".r$28 "",/$ & -$0!$0!$.! -#+$ .$!$"##$.-/$&+$/ !/ .$.!&!$ .$&/!$."9'3:$&,#&!$-$"&\

PAGE 54

$rrrrr nr*r !$% ,&&#,.$&+%$&+ <"#+##+$+&# "$#& #+$",/$ & -$!$" #!$1,!$. / -0/#"'",/$ & -!!&292E: #$&# #+$$$/#& ( "#+$"#%$2 ",/$ & -$&# /+ -$#!<$# @.%"#'$ #+$ /##+#;E".;8!$" #$;0!$&&$. "-/$&93E:;E".;8,& "0! #$"&<$!$$;0!$&&$." !% 7/$&!$&0$/#%$,/$ & -$&<$!$0!$0!$.". -=$. "#+$0&&%#$.$,#!%." / #$./ %$!&0"#>"# .9'?".? /:+$-+"&& #+$ ",/$ & -$!/# "2G&+ <$.#+#*?)J".*? EJ ".%.,, !$&/$"#&0 #&+%$ "$$/,$ ;E".;8!$&0$/#%$ 9'?.:+$-+"&& #+$ 0 ",/$ & -$!/# "(>"./#$.#+#(3*J". (3>J !$&/$"#&0 #&+%$#< $/,$& ;E".;8!$&0$/#%$9 '?.: !/ "#! <$$&#&+$.<.#0$-/$& #+#&#$;0!$&&;E". ;8!$&0$/#%$,/$ & -$&<$!$0!$0!$. "#+$0&&%#$.$,#!%."/ #$. / %$!&0".-=$."#>"# .& %$9'?".?/:+$-+ "&& #+$" ",/$ & -$!/# "2G"./#$ .#+#*?2J ".%.,, !$&/$"#&0 #& +%$ "$$/,$ #+;E".;8!$ &0$/#%$9'?$:+$-+ "&& #+$0 ",/$ & -$!/# "(>&+ <$.# +#(GEJ".(?8J ".%., !$&/$"#&0 #&+%$#< $/,$& ;E" .;8!$&0$/#%$9'?$:+,& #+$&$.#"./#$#+##+$($.0! #$". $& #$/##+$/$,!&&$-&# /+ -$#! ;E".;8 "/+! -#"

PAGE 55

::#"''' $0'1%"#%$1% &&"(01#('%%&) 0( 9:'! &$'$$$/#! 0+ !$&&"&& ",/$ & -&$;#!/#$.! !/# "& 2GE)J&,/! &$'!.$"#,/$ & -$&< $!$0!$0!$.! !% C )n4 ". !% C )n$ 9$#:". !%55C )n4 ". !%55C )n$ 9!'+#:$0!$&$"##%$-'$& '! &$ '$!$&+ <"!/# "&2G".(>"./#$./ !/ .$.!&$ <#+$'$&<$!$,&$. &"'$$/,$-'"'9/:/+$-#/.$0/# #+$-=# 2 ",/$ & -$/ -0$; "&,!/$ #"#$."# >"# .9.$:+$0$!/$"#'$ !$&/$"/$0+ # $/+"'&#$0& ;E". ;8 "",/$ & -$& #$.! !%C )n4 ". !%C )n$ 9.:".! !%55C )n4 ". !%55C )n$ 9$:&&+ <" +$/ !/ .$.!&!$.$&/!$."9'?: $&,#&!$-$"&\

PAGE 56

n $!rrrn + "%$&#'#$#+$&# /+ -$#! ".%.,&,, "#& 2<#+"#+$",/$ 0&/$&<$$-0 $.!$/$"#.$%$ 0$.&"' $$/,$--," 0!$/0## "00! /+ 9>(:,/$ 0&-/20! #$"&<$!$$;#!/#$.! --/$&"./! &&"@$.<#+ 0! !-.$+.$2<&-=$. "#+$0 &&%#$.$,#!%."/ #$./ %$!&0 #"#$."#"# .9'8:"'$ $/,$-'$&#/@&<$!$/1,!$.,&"' -/! &/ 0"&& #+$",-$!& 2,& "0! #$"&&+ <$.#+#*8*J *?*J**)J".*??J ".%.,, !$&/$"#&0 #&!$ "$$/,$ ;( ;?r$28"."'29'8:!$&0$/#% $"./#"'&# /+ -$#! 2A2A2A2 $/,$ !;(;?r$28" '2". "$/ 0 $/+&,,"# 2

PAGE 57

;; "'%' $"*$%%$" 9:/+$-#/,&#!# #+$-=# 20! #$"& "#+$0&&%#$.$,#!%." / #$./ %$!&0 #"#$."# "# .+$2/ -0$;$&$;#!/#$.! n)n n)n ) ". #$)#$ -/$&<$!$0,$.. <" #"#$."# "# "#$!/# "<#+$,#!%."9:+$0$!/$"#'$ !$&/$"/$0+ # $/+"'&#$0& ;(;?"'2".r$28&&+ <" $&,#&!$-$"&\

PAGE 58

*r,r -*rr "%$&#'#$<+$#+$!(&$"#$!/#&<#+"/ $& )*++n ,& "'$"$& )!% ". )!' <$!$&#$;0!$&&$." !% ". !' -/$&!$&0$/#%$"#! .,/# )!% ". )!' ,& "&"# #+$!!$&0$/#%$7-/$&!$&# !$. >7(?-$>$%$& .$"&#!#$.9'*:+$.#"./#$ #+##+$#< ,& "0! #$"&,"/# "&#+$! $". '$" ,&/ ,"#$!0!#&+$!$&.,>7(?-$>" !' -/$&-$'$"$!#$. =+2(! -#+$",/$ 0&-<&-=$. "#+$0&&%#$.$,#!%."/ #$. / %$!&0"#"# .9'*:"'$$/,$--," 0!$/0## ""&&&+ <$. #+#283J".2G?J ".%.,, !$&/$"#&0 # &+%$#< $/,$& $.". =+("./#"'-;#,!$ -$!/"..-$!/ ( "%$&#'#$#+$&&$-&# /+ -$#! ( "/+! -#"#+$( ",/$ & -$/ -0$;$&<$!$0!$0!$.".-=$. "#+$0&&%#$.$,#!%." / #$./ %$!&0 #"#$."#>"# .9 '*/:+$-+"&&&+ <$.#+# 2*GJ".2*(J !$&/$"#&0 #&+%$#< $/ ,$& $.".=+("./#"'#+# #< (/ -0$;$&/"".# ",/$ & -$+$ $." ",/$ & -$/ -0$;$&<$!$ & -=$. #"#$."#(9'*.: !"#"# .$&9'*$:+$+"&&'%$&-!!$&,#&"'#+$&$"# .$& '$#+$!#+$&$.#"./#$#+# (".&# ",/$ & -$"2A2 !(A2&# /+ -$ #!

PAGE 59

r <

PAGE 60

<) $2%&$%%$ (($= (0(%$%%"'%%$ *>* %)>*%"#%$1 9:--," &#""' >7(?-$>" !'55 !%55 !' !% !' )!' ". !%)!% -/$&,&"'"# ..!$/#$.'"&#>7(?$>9'!$$": &<$!$&#"$.<#+ $/+ ,$:%$!-' $&!$&+ <"/$!&GY-9: ,/$ 0&-/$.".=+(!$-;#,!$ -$!"..-$!+$( / -0$;$&$;#!/#$.! !')!' ". !%)!% -/$&<$!$0,$.. <" #"#$."#"# "#$!/# "<#+$,#!%."9$#:+$0$!/$"#'$ !$&/$"/$0+ # $/+"'&#$0& $.". =+(&&+ <"&/@!9!'+#: / -0!& "#+$!$.! !#+$" -$!/& !$0/#$.! -9'2:$&,#&!$-$"& \9/:(".&# ",/$ & -$"2A2 (A2&# /+ -$#!+$( ",/$ & -$/ -0$;$&! !')!' ". !%)!% -/$&<$!$-=$. #"#$."# .$&.!$/#$.'"&#>9$ #:+$0$!/$"#'$ !$&/$"/$ 0+ # $/+"'&#$0& $.".=+( "" ",/$ & -$&&+ <"&/@! 9!'+#:$&,#&!$-$"&\ !/ -0!& #+$!$.! !#+$" -$!/& !$0/#$.! -9'2:9.$:+$0$!/$"#'$ !$&/$"/$0+ # $/+"'&#$0& $. "" ",/$ & -$+$$.(" ",/$ & $/ -0$;$&<$!$-=$. #"#$."# .$&.!$/#$.'"&#(9.:" .9$: !/ -0!& "#+$!$.! #+$" -$!/&!$0/#$.! -#+$9'2: $&,#&!$-$"&\

PAGE 61

n n/ nn "#+&&#,.<$.$%$ 0$." %$00! /+# && $&&#+$/$,!&&$-&# /+ -$#! $0'$"$#// -0$;$& "/+! -#"".0! %.$.$ %.$"/$#+##+$// -0$;$&2". ($-0 .&#"/#-$/+"&-&<+/+#+$&&$$ "/+! -#"+$/$,!&&$&# /+ -$#!!$$/#&#+$-$/+"&-<+/+#+$ // -0$;$&"##$$&#&+".-"#" !$0!$&&%$0 / -. -"&r $/,!/ ,"#"'& $. "&"'$$/,$, !$&/$"/$ -/! &/ 0&0 <$!,00! /+# 1,"###%$ &&$&&#+$",-$! $/,$&<#+" -/! $/,!0! #$"/ -0$;"="', !$ &/$"/$0+ # $/+"'&#$0&#+$&/ '! ,0/ ,"#$.&,,"#/ -0 &# -$-!"$ ,". 0! #$"&$;0!$&&$." 67 /#$&9>>:.$%$ 0"'".00"'&"'$$/,$, !$&/$"/$#< / !/ "/.$"/$ .$#$/# "#+$7$"$!-"'! ,0".#+$&,!-" "'! ,0/+!/#$!=$.&,,"#/ -0 &# <#+"!$/ "&##,#$.#$ -$!&$/ -0$;9>2: / -""'--," 0!$/0## "".&"'$ $/,$-'"'#+$'! ,0.$%$ 0$.&"'$$/,$0,. <"9r,:# 0! $+ < -"0! #$"&". <+/+@".&!$0!$&$"#"". %.,/$,!0! #$"/ -0$;$&9>(: $!$/ -""''$"$#/$"'"$$!"'/+! -#" --," 0!$/0## "".&"'$ $/,$-'"'<$.$%$ 0$.-+# 1,"# /$,!&&$-&# /+ -$#! $0'$"$#// -0$;$& "/+! -#" #+r,". -+!$&$. --," 0!$/0## "D+ <$%$!-++&$$"&0$/ /.$%$ 0$.". 0#-=$. 0! #$"&&& /#"'<#+/+! -#" $r rrr #+ ,'+",/$ & -$+&#< .&--$#! +&# "$ !'"=# "+&# "$#&+%$ $$"&+ <"# $&--$#!/.$.9(8:+$ >7(?-$>-!@+&$$"&,''$&#$.# $

PAGE 62

n /@&#$ !#+$/" "/2 "#$!/# "<#+#+$;0! #$"&93G:" /+$/ 0!"/0$<$&+ ,..$#$/#-;#,!$ ",/$ & -$ & ,".<#+ "$ !#< ;2 / -0$;$& <$%$! ,!-+"&&"./#$. #+# "$2/"0 #$"#&& /#$ <#+?",/$ & -$&&,''$&#"'#+##+$2/ -0$ ;+&-,#0$"."'&#$& ",/$ & -$& !#+##+$",/$!$"%! "-$"#.!$/#& #+$2/ -0$;&&$"-,#0$ ",/$ & -$&+$&$.#& -0#+##+$"."' 2# "$.&@&,!/$ ",/$ & -$0!$%$"#&&& /# #+$&$/ ".",/$ & -.&@&,!/$<#+..# "2 "---"/$& "$r20! # $"&&"/$ #+!$1,!$+&# "$&"$ -$#+# 9333?: !$% ,&&#,.$&+%$&+ <"#+##+$$#,!$& /+ -#"!$.&#"/#$#<$$" 0,!0 #$"#"..$!$"##$./$&".!$$/##+ $-0 !#"/$ $&#&+"'".-"#""'

PAGE 63

n "$'$&0$//'$"$#!"&/!0# "0! $93(3>: ,! &$!%# "&#+##+$&&$&# /+ -$#! ;( "/+! -#"&.&#"/#$#< $$"-"..$!$"##$./$&&,''$&##+# #+$;0! #$"&.%$!&#+$!,"/# "&.,!"'/ $.$!$"## "$/$"#&#,.$&+%$&+ <" #+#;(0 &&$&&$&,"1,$/+!/#$!&#/&.,!"'. $%$ 0-$"#"./$//$0! '!$&& 9E*38:",&$=' #$;(#!'$#&2# / "&##,#%$+$#$! /+! -#""0!$"# !'".$0$".$"#-""$!938:"-/$&;(# !'$#&2# -# #//+! & -$&" (".$0$".$"#-""$!".".&&## -# #/ /+! & -$&<#+ ,#.&& /# "9E*: ;(&#+$/#%$&,,"# ---"2 #+"+# !$.$"'". / -0/# /+! -#" &#!$#/+ /+!'$.-" /.&93*:+$/+!'$. -" +&$$"0! 0 &$.# "#$!/#<#+",/$ & -$". # /!$#$!$"#$!/# "&<#+ #+$! ",/$ & -$&B$0! 0 &$#+#/$.$!$"## "".,/$&!$;(0! #$"&# $ .$. "# /+! -#"<+/+-/##$,!#+$!/+! #"/ -0/#"'# $&#&+".-"#" &#$$0'$"$#/&$"/"',!#+$!&#,.$&!$"$ $.$.# $;0 !$#+$-$/+"&-&".,"/# $& #+$,"1,$;(0! #$" ,!&"'$$/,$--," 0!$/0## ""&&" ./#$.#+##+$",/$ 0&-/ 20! #$"&. #&$"#$!/#<#+"/$&,". $!#+$!$;0!$&& "$%$&&-!# $". '$" ,&/ ,"#$!0!#& <$%$!&$%$!&#,.$& #+$".%.,2&,,"#&&+ <$.#+# #+$/"&$&& /#$ 9232*:&,''$&#"'#+##+$/ -0$; !-# "0!$%$"##+$ &$&& /# ".%.,&,,"#& !#+##+$ &$!%# "&. #!$$/##+$ 0+& '// ".# "&$/$"#&#,.$&&+ <$.#+ # #+ +".---" + '+/( !' -$!&9?)?2:".#+$ -$ !=# "/"$0!$%$"#$. //# "9?2:,/+ -$!=# +C+/( -0"!/+#$/#,!! $"#+$ "' !"'$ !'"=# !'$0 / -. -"&#+#/ %$!-,#0$"$'+ !"''$"$&&,/+&#+$

PAGE 64

n ;'$"$/,&#$!&".#+$"/#%$/+! & -$" $-$/$& <$%$!&"/$#+$%&# -5 !# 0 / -. -"&!$!$#%$&".,&, %$!0<#+0! #$!!$' "& #+$+C+/( -$!=# "-" #$!$1,!$. '$"$&<#+&-0 / -. -"&+& +0 #+$&&&/ "&&#$"#<#+#+$.$0$# ++0 -"$/#"'$;0!$&& '$"$&<#+ !'$!0 / -. -"&9?)?2:$!#< $-0 !#"## #$&#+ <#+$ -$!=# +C+/!$',#$& "'!"'$ !'"=# /+! -# "&#!,/#,!$ $*rr n!n $!$<$0! %.$.!$/#$%.$"/$#+#",/$ 0&-/ (&-;#,!$ -$!". .-$!!$% ,&&#,.$& #+$!$/ "&##,#$.(! $/+$..%$!'$"#%$<& ,#&##$& ( -$!=# "9(>(G:+$!$/ "&##,#$.(<# +%$/ !$&,,"#&+&$$".$"#$.& .-$!9(>:+$!$/ "&##,#$.(<#+ ,!&,," #&+&$$"&+ <"# $" -$!/ $$/#! "-/! &/ 09(G:+$!$/ "&##,#$.(< #+#+!$$&,,"#&+&$$" ,".# -;#,!$ -$!&.-$!&#!-$!&".+'+$! !. $! -$!&9(E:+$&$%!# "&/ ,.$ .,$# #+$",-$!& (&,,"#&,&$."#+$!$/ "&##,#$.&& !#+$-$#+ .&,&$.# /+!/#$!=$#+$ -$!=# "&##$&$#! # "!/# "# ",/$!$;#!/#&! #+ ---&". &,''$&#$.#+##+$00!$"#$/,!<$'+# (&/ "&&#$"# <#+-;#,!$ -$!.-$!". -$!9(3( ?: <$%$!#+$'$#!# "/ ,." # $;/,.$" "(0! #$"& !"$;#$".$.&#!,/#,!$ (,! &$!%# "&,&"',#! &$"&#%$&"'$$/,$--," 0!$/0## "!$& %$.#+$&$.&0!#$& B$ ,".#+#(".&# ",/$ & -$"2A2 !(A2&# /+ -$#! B$ &,''$&##+#" -$!/(-'+#0! $" #+$"#$&#&+-$"#&#'$ 0 / -" !-# "".#+##+$&,&$1,$"#&&$".&0!$."' (0! #$"& "' /+! -#"-!$1,!$.-$!/("#+&.$ #+$"#!$/!,#-$"# (# &0$//

PAGE 65

n /" "/ ."'& !&$1,$"/$&0$//" ."'/# !&< ,.0! #$ #!-$#+# >7(? "".5/$"#",/$ & -$9 E3?(?G:+&< ,.$.# "."' .-$!/(# #+$",/$ & -$ $."#$!/# "<#+>7(?-$>./# "<+/+# +$" /##$&-$#+# ".5/$"#",/$ & -$ !<#+"",/$ & -$".!$0$#&#+$//$ 9'2):+&.$&" ,&# #+$ !-# +$#$! /+! -#"#+$0! #$"&9?3: +&.$/"$;0"#+$0!$% ,&.&/ %$!$&#+ #(% !&.". ",/$ & -$ &,&#!#$& %$!" ",/$ & -$&9???8:".-$! /( "$$."."'# ",/$ & -$ < ,.0 &# "#+$&$/ ".(# -$#+#$#+$+& # "$# ><#+"#+$&$/ ". ",/$ & -$ "&,--!<$.$%$ 0$." %$00! /+ +/ ,0$.&"'$$/,$ !$&/$"/$-'"'# &&$&&#+$/$,!&&$&# /+ -$#! $0'$"$#// -0$;$& /+! -#"-+/ ,.0! %.$"&'+#&# #+$! $0'$"$#// -0$;$&+$/$,! &&$-&# /+ -$#! #+$// -0$;$&2" .( "/+! -#"0!$&$"#$.+$!$ 0! %.$&,&<#+#+$!&#&&$-&# /+ -$#! #+$&$#< / -0$;$& "/+! -#"<#+" /$&". $!&"%,$ .## ,".$!&#".0!$% ,& /+$-/.#+$ .# #+$/"#$!/# "<#+/+! -#"$.&# %$"&'+#&".#$&#$+0 #+$&$& #+#&+ ,."&0!$,!#+$!&#,.$& #+2" .("#+$$&#&+-$"#".-"#$""/$ !$0!$&&%$0 / -. -"&

PAGE 66

nn *? *?%($%('&%#* () %" %3#"#%$ &0 9: 2/ -0/#&/+! -#"<#+-"-,-!# 2A? <#+"/$&9:-$!/( /##$&#!-$#+# >7(?<#+"",/$ & -$ !".5/$"#",/$ & -$"<#+# "$2"."'# ",/$ & -$< ,.0 &# "#+$ &$/ ".(# -$#+#$#+$+&# "$# ><#+"#+$&$/ ".",/$ & -$

PAGE 67

n 2r&#$9())?:$ ".#+$&$1,$"/$A/$,! !'"=# '$" -$,"/# n *); ?8?8))(,'$!7$/+&&r".!$-$#+/@6 9()2(:$<"&'+#&"# ",/$ & -$". /+! -#"&#!,/#,!$A" !.$!$.&##$ !.& !.$! $.!^ 8#n *5 E>3EE? >%$!".$",6r9()22:"-/" #$!0$#<$$"&# "$>r ./# "& ".! #$""#$!0!$#$!&A-$!'"'%.$"/$ !_ &# "$"','$_ nr0r *) (** >)?EF$"#"$!".$"@ 9()2>:$',# ",/$ & -$."-/&+&# "$ ./# "& 8970# )? (G*(33 Gr,&&$-" ".$r #$6". 7,##$.=$9()2(:$!/$%"'#+$ $0'$"$#/".&/0$#+! ,'++&# "$!$.$!& 8970# *< 2(282((? 3/@!$B".%"#$$"&$9()2>:$" -$!/+#$/#,!$A. -" !'"=# "#$!0+&$/+! & -$& n *8) 2(?)2(8E ? <-"". !$!r9()2G: &#! "&# "r ./# "& &# "$&+# ",$"/$,/$ & -$"-/& nr0: **8 ((?E((*G 8"6".7"'&# "9()2>://,0 "'/+! -#"A / --$/+"&-& '$##"'# '$" -/#!'$#&&# 00"'#!"&/!0# #!/".&#"'0,# #n 7< 8)88(E *+"7r"'"&+=,-$ ,/+! $.$!r,0#r,$$! 6-$&6$"@"&!@!6".F+"' F9()2>:+$+&# "$>>7(?r-,## "" 0$.#!/' -!$0! '!-&>7(?-$#+# "".' $"$$;0!$&& ): *8G**) 2)r!',$! "6,&#"+" 7+!0$r "6!,!B6>!. '# r!#" !B$r!/ !! ## $"$!'".-"69())*:

PAGE 68

n $ #+$0 / -0! #$""#+$0! 0'# !$0!$&&%$+&# "$-!@& 87 79* ?3(?3?22B"'B"'6!.5,-$"#! -'$ .r$-0 "$&". F+"'9())E: $ +&# "$(,1,#"# "0 / -&$"/"' 87 75* 8?> 8?82( FF+"'6 "& #!" EE>G3 2> B"'B"'!.5,-$"# -'$$-0 "$&". F+"'9())(: $ +&# "$>&"$(?-$#+ # "" / -'! ,0&$"/"' 900 )<; 2)>*2)E> 2E!"/&67"'&# "".B ./ /@ 9())E:+! -#"/ -0/# 0 / -'! ,00! #$"/ -0$; 900 5?9 2G?E2G?? 2G&@$".$$r!-$&7!$&& $0! ,$!#" @ ,#/+B,#="./@!$B9() 2):"'2/ -0/#&/+! -#"&#!,/#,!$ ".!$0!$&&$&'$"$$;0!$&& "".$0$".$"# +&# $,1,#"# #n 5; EG(E3E 23 <$".,&#"92**?:$& & /# /+! -"0$0#.$& 0r 3(0 *55: 2*8()3 2?,5&@" -&++!r= @r7"" &+!".7"" r9())>:-$!=# #+$ / -'! ,00! #$ "r$28&!$',#$.7 0+ &0+ !# 0r3nrr7 5?? 2>G2E)

PAGE 69

nr 28 r".!"/&69()2):"+# /+! -#"!$.$"'0 / -'! ,0 0! #$"0 &#$! !&$;/ -&&-$/+"&#/.&# "/#! -",/$ & -$"."' 0r3 7< *E>8*EE8 2*=0 "@.$ &" &r#$,r !!$!,!#. -$= -$=6.r".$!69())?:+$ & #$.#$!-". -" "'2& .-$!-.$ &#$<$&#!,/#,!$." -$!& 0r3 79 2(?3E2(??3 ()7-"'$!r0r". < $6n9())(:+$r. -" 0 + -$ #/ !-&+$/0 -$! 8970 < EG>EG? (2 rr/! 7".!"/&69 ()2(:+! -#"./# //,!& # "$0$!",/$ & -$".. $&" #!$1,!$#+$ /./0#/+ +&# "$( +;9< : $E?23(((r/"#7$"!/"."9() 2E:!&#&#!,/#,!$ #+$2 ,1,## ".,$ ,".# #+$",/$ & -$ 87 8*7 G*2G*3 (>%. %/+ .!/+76 ."' ".$/+9()2E:.-$!/&##$ ( 8700(0% 7) *(>3*(E8 (EB,r,!#r#@"@ %/r,!!$ ".&,!-""9()2>:"."' "#$!/# "&$#<$$" "'" "/ ."'". (0! #$"& 0r3 8) *G2* *G(?(G$!!".$!r /$!= '$$!& .". '$&9()2(: r $/,!!/+#$/#,!$ +,-"0 / -!$0!$&&%$ / -0$;( $))))G (3 ".F+"'9())E:nF2(&!$1,!$. #+#+$+&# "$-$#+#!"&$!&$ /#%#".#+$&$"/"',"/# #+$F( / -0$; #n *8 G?3?

PAGE 70

n (?$!&."+6!%$&-,& $&#".$!".!#$69())>:2 -$'.# "C9F:/ -0$;! -! & 0+#+#/ "#"&0 / -@$".> #n )5 >>G(>>3( (8 '#$ !,!B6>!.F$$ r "6$/@ ,"' !/".$"$!'9()2(:&--$#!/ .$.",/$ & -$& n *8* 282 2*>(*r,!0+60!"B" 6,=$# 7'!-"6$"#$= 66!'+$.". <9()2>: "'$$/,$"&& / -"# $0'$" -/&##$&"" !-".#,!/$& +08(0%90=9( **? ???(???? >)$=6 <$6-$'"r6" 6-. ',$=7+"F".$", 6r9()2E:# /+ -$#! &#$&0$//&"$ /$## """$"#!$0! #$ -$ nr );< (2>(3(2>>8 >2%$& .!"'# "!#$$ "7$"$!-"".&,!-"" 9())8:"'$$/,$"&& +,-"#$ -$!&$ -$! 8nr 7 (8?(8* >(6",-"!,=&+# &,@',"#+"7!@6+$"6 "'7".9()22:! "'/$,!0! #$"/ -0$;$&,&"'&"'$$/,$0, <" 87 7:5 E8EE88 >>n!/+r".&/ 9())?:,," #/ ,"#"'"-$-!"$ ,".0! #$"& 8 #% 7 >2*>(2 >E$"% !"'7$"$!"".&,!-""9())>: .$"#/# "$<"#$!/# "&#$ !+,-"#$ -$!&$9+:A&#!,/#,! -0/# "& !+//,-,# ""..&@$!# & &/ "'$"#0 "#-,## 8700(0% 5* 3G)*3G2G

PAGE 71

>G$"!@$B%$& "'7$"$!-"".&,!-"" 9())3:"&& +,-"#$ -$!&$/#%#". ,"/# "#< / !&"'$$/,$ / "/.$"/$, !$&/$"/$&0$/#! &/ 0 (rnr90 *); E**(G))) >3' F+"'WF+ .+6 ".9()2G:&--$#!/,"G22EE >?$$6$$6,$".$$9( )2G:"-/& ",/$ & -$&&$-". $$/#& -$#+# nr ))> >8$".<"'B #7 &&$! !&.!#+ -$<". F+,"'9()2>:B!$.$$!&&.$",/$ & -$& <#+/ !."#$.-,#&$0!$"#! &#$0&".&"'$&$0!$;#&#$0& n *8) EE(EG( >*r.$",$-r -#+ !#+r/7"'+#6 #$ <-"!#+ -$<".B"' r9()2G:"-/!$',# #!"&/!0# "/# !&",/$ & -$!$.$"' 7 E)"r !#+6+-@ 6 !#$& $!."".rr" +!r F+"'r&+$##$&$"66". !$! r9()22:&# "$ ../# "&/ "#! ",/$ & -$,")2?>)(? E(7# +,@,&,/++! &+ @+!&+# ',/+7". '&+"@'<92**8:r$# $-$&$;!$%$! &"r>>-,#"#-/$ 87 5<5 388 3*(

PAGE 72

E>+$"'$"".7$!00 79()2E: 72!$0!$&&$&.$!$"## "".,/$ '$"$&"$-! "/&#$-/$&#+! ,'+/ 0$!#%$ "."'<#+2"..$!$0!$&&$& 0,!0 #$"/&& /#$.'$"$& #n 57 ()?G()*2 EE". +r". ". +,5-,! +! .##$ @" r! /@. !.r".7 &$@ 9())8: / -'! ,00! #$"& "'2C!$,"/# ""@$.# #+$/ !$#!"&/ !0# "!$',# !/!/,#!# -"#" /$.$"## r *58 2G2>2G(E EG.$!@"r$!#$"&". +rr$ !r !!/$7 &$@$#$!& /@. !". -79())?:0+ &0+ !#$ !r$28#!'$#&#+$"'2 +&# "$(,1,#"'&$# /+! -#" #n ); 2)?2() E3+$"7-B,5)>2>2E E?$""7+$!. <"& #"".! /@. !92**3: $1,!$-$"# !&#"/+! & -$"/#%# 87 5:< 2>22>? E8!$&# %&@,,.!@$& ".$69()2E:&# "$>>& $1,!$.# r"#"$0/# !@! '!$&& #$!n-'$ n73 )7 (2*G (()2E*F+$",/7 @ # %/r+$ 6".$"9()2E:;(&# && /#$&<#+-# #//+! & -$&%( 2".$0$".$"#-$/+"&-".& "$$.$. !!$/!,#"'2/ -0$;# -# #//+! & -$& #n )8 >?(3>?>* G)F%$ 0 &@"#,@& /+,#=,@&6$@@$! 6$"&$"!#$@6".+ +9())3:+! #"!$;# ""!$&0 "&$# ,$

PAGE 73

&#!".!$@&&.,#$." %$r".7 2.$0$".$"#0#+< 8n ; 8?)8?3G2$"".7$!00 79()22:"#$! /#&<#+;0! #$"&".!$',#$& 0 / -!$0!$&&%$/ -0$;2 //,0"/#2$$$"#& #n 5* (2))(22) G(,'$!7$/+&#$"$!6"./+". 692***:!$0!# ",/$ & -$/ !$ 0!#/$! -!$/ -""#+&# "$& #%!'3r 5?7 >2* G>6 +"& "@ !&@B,!# <&@ B ./ /@".r =$. 9())*:$/ "&##,# +$#$! /+! -#".$0$".$"# #!"&/!0# "'$"$&$"/"' #n 58 ?3*?82GE".B. -69())E:,/$ & -$&/ ##$#+$! <""%& 8970# ** ?3>?3* GG6 +"& "B,$$#=r'" .r =$.9()2>:$#$! /+! -#/'$"$ &$"/"'/#%# !"#$!$!$"/$".#!"&/!0 # "$ "'# "!!$! nr );; (8??2(8?8(G3!6== ".&,@-9 ())E:&&$$&#/+! -#",&"' B/ -0$;$& #%!'3r 5:8 882)( G?"B". $.$!9())E:$/ "&##,# ".#!"&/!0# ""&& /+! -#"" %#! #%!'3r 5:: E3)E?E G8+,"'".7$""$.92**2: !
PAGE 74

3) -"".B,6W9()2(: ,"#"'0 #$"$/,$&,&"'1,"###%$ !$&/$"/$-/! &/ 0 "%0r90 5: E**G)3 32$"'$.-"".,&/+$!6>!. 9())(:$#$! -$!=# ""'#+$ Cr. -"/ "#""'",/$!/ / # !&A0 #$"#-$/+"&! !$',#"'#+$&<#/+$#<$$"/ /#%# ""./ !$ 0!$&& # 5)? 3(*3EE 3(r$&+ !$!".r&#$9())3:+! -#" "0,!0 #$"#$-! "/&#$-/$&". .$!$"## 8#n : GE)GE3 3>&+$!".&+$!9()22:+! -# "&##$&"0,!0 #$"#.$!$"##$.". !$0! '!--$./$& n7<. )* 2E)2E3 3Er !$&/, ==,# B,#=$"#+".! /$ 9()2(: %$!00"',"/# "& #+$ / -'! ,0;0! #$"&"$-! "/ &#$-/$& n9rn *? E?3( 3Gr"6F+"'".,r9())>:#!,/# ,!&& !&0$//"."' / /+! -"# +&# "$>-$#+#$.#&(? *: 28(>28(8 33"= +"'+"@!7,/+$"$ /@$!7r"rr.+" !@!6"..9()22:+! "-$.#$. -$!=# 2 &,''$&#&",/$ & -$!.'"'-$/+"&!+$#$! /+! -#"&&$#n 7* 3?82 3?! 5$!-&6>!.1,$! 7@ ". //,"$$ !.5,-$"#! -'$$-0&#-$!B "'".$"$!'9())?: >r2+&# "$-$#+# ".$0$".$"#/+! -#" /@ n *)< *2G*(8 38!.#r$!#r7,"=-"",F 7,&# %+$!!," !@/="&@n!! <&-#+".$#$!& 9()2G:;(!'$#&2#

PAGE 75

"&##,#%$$#$! /+! -#""r ,&$F' #$&" !$"# !'"$0$".$"#r""$! # n 8; 2G?2?2 3*!,6+0-"!/@6 <&@r!"/&6".7"'&# 9()22: -0/# /+! -#".%$!&$ / -'! ,00! #$"&!$1,!$& /=$. !$' "& +'+/+!'$ )8 ((2)(((2 ?)& 7". 7,r-.,= ,@+!6&+@,! $!"&#$"".7 &$@9()2>:r. -" 0 -$!=# ""@&&,",/$!/,&#$!"' 2# '$"$&$"/"' n )9 G3GG?? ?2-$##r".r,$!69()2E:// # "0!$%$"#&''!$'# #+$ / -'! ,0!$0!$&& !0 + -$ #/ n 5* 3(*3>* ?(%. %/+B"',$"#$& 5& .!/+76 ."'$$6 ".$/+9()2G: ""67$!#$&=rB"'671,== ,!,'-"" ." ,'+ $-&6!"+-6$'". +"'9())?:,"/# ".$-!/# /#%$".&$"#/+! -#". -"&"+,-" /" "/ ."'& n *)< 2>22 2>(>?E$"'6 ,$%<',#F+"'6 F+ <".B& /@69())*: 6!.(C6,"5/ !."#$&/ "#! ($"=-# //#%#".#!'$#'$"$ //,0"/" 0,!0 #$"#/$& n *5< 2(*)2>)( ?G".$!,$! #% !@"r r==!$6 !'$"&$"$!$! $$,r// r0%@ %r! @$ & &+$!@!"$&B $@$=&#! $--$!&67 &$ 6&" %r%!$&! /@.

PAGE 76

n r$!@$"&/+'$!r".&+$!9()2):6!.( &(/ -0 "$"#"$-! "/&#$/$&!$1,!$. !-,#"$'$.$!$"## "" .!$/!,#-$"# 2". -$!&$ # .$%$ 0-$"#!$',# !& 8n *) 3283(E ?3<'$!#r"""'6$"0#7 ,!".&$-$$!". $#$!& "9()2E: ,# "&##$/ !-# ".&# /+ -$#! $&#!> +$#$! /+! -#"!$& 8nrr7 8 E?G2 ??7,=-/+$%6$",<$"$-0&#".$ "$!'9())E:$!$"#=+( / "#""'/ -0$;$&#!'$#-$#+# +&# "$ 2 !",/$ & -+&# "$> #07 n *7 28>2*> ?8r!#" ".F+"'9())3:,&# !#$0!$$!$"/$& #+$F(+&# "$ -$#+#!"&$!&$/ -0$; nr );* 8>3G8>?)