Citation
Regulation of m6A mRNA methylatioin and stem cell pluripotency through GSK-3

Material Information

Title:
Regulation of m6A mRNA methylatioin and stem cell pluripotency through GSK-3
Creator:
Faulds, Kelsie Jo ( author )
Place of Publication:
Denver, Colo.
Publisher:
University of Colorado Denver
Publication Date:
Language:
English
Physical Description:
1 electronic file (72 pages) : ;

Thesis/Dissertation Information

Degree:
Master's ( Master of science)
Degree Grantor:
University of Colorado Denver
Degree Divisions:
Department of Integrative Biology, CU Denver
Degree Disciplines:
Integrative biology

Subjects

Subjects / Keywords:
Epigenetics ( lcsh )
Glycogen synthase kinase-3 ( lcsh )
RNA editing ( lcsh )
Epigenetics ( fast )
Glycogen synthase kinase-3 ( fast )
RNA editing ( fast )
Genre:
bibliography ( marcgt )
theses ( marcgt )
non-fiction ( marcgt )

Notes

Bibliography:
Includes bibliographical references.
System Details:
System requirements: Adobe Reader.
Statement of Responsibility:
by Kelsie Jo Faulds.

Record Information

Source Institution:
University of Colorado Denver Collections
Holding Location:
Auraria Library
Rights Management:
All applicable rights reserved by the source institution and holding location.
Resource Identifier:
986227597 ( OCLC )
ocn986227597
Classification:
LD1193.L45 2016m F39 ( lcc )

Downloads

This item has the following downloads:


Full Text
REGULATION OF m6A mRNA METHYLATION AND STEM CELL PLURIPOTENCY THROUGH GSK-3
by
KELSIE JO FAULDS
B.S., Indiana University- Purdue University Indianapolis, 2013
A thesis submitted to the Faculty of the Graduate School of the University of Colorado in partial fulfillment of the requirements for the degree of Master of Science Integrative Biology Program
2016


2016
KELSIE JO FAULDS ALL RIGHTS RESERVED
11


This thesis for the Master of Science degree by Kelsie Jo Faulds has been approved for the Integrative Biology Program by
John Swallow, Chair Christopher Phiel, Advisor Amanda Charlesworth Xiaojun Ren
July 30th, 2016
m


Faulds, Kelsie Jo (M.S., Biology)
Regulation of m6A mRNA Methylation and Stem Cell Pluripotency through GSK-3 Thesis directed by Assistant Professor Christopher Phiel.
ABSTRACT
Glycogen Synthase Kinase 3 (Gsk-3) is a critical serine/threonine kinase known to regulate a diverse array of cellular functions including gene expression, cell differentiation, and cellular proliferation. Two different isoforms are present in mammalian cells, Gsk-3a and Gsk-3p, and they are almost exclusively negative regulators through phosphorylation of their target substrates. Two key pathways known to be affected by Gsk-3 activity are the insulin and Wnt signaling pathways. Both pathways are constitutively active in Gsk-3oT~; Gsk-3(1 embryonic stem cells (ESCs).
These mouse ESCs deficient in Gsk-3 have been shown to remain in a pluripotent state capable of indefinite self-renewal, even in the absence of leukemia inhibitory factor (LIF). Gsk-3 inhibition has also been shown to promote the formation of induced pluripotent stem cells (iPSCs).
N6-methyladenosine (m6A) is the methylation of adenosine at the nitrogen-6 position, and is the most abundant internal mRNA modification. Although it was discovered more than forty years ago, very little is know about the function and regulation of this modification. An RNA methyltransferase, Mettl3, and an RNA demethylase, FTO, have been discovered recently, showing that the m6A modifications are both dynamic and reversible. It was also revealed that ESCs lacking Mettl3 remain in a highly pluripotent state and are unable to undergo differentiation, suggesting that m6A
IV


also plays a key role in stem cell pluripotency. The phenotypic similarities between Gsk-3aJGsk-3f3 double knockout (DKO)ESCs and Melll3 ESCs, led us to hypothesize that Gsk-3 is playing a direct role in the regulation of m6A. A direct connection between Gsk-3 and the m6A modification on mRNA would have profound consequences for understanding how different Gsk-3-dependent signaling pathways regulate the balance between pluripotency and differentiation in embryonic stem cells.
The form and content of this abstract are approved. I recommend its publication.
Approved: Christopher Phi el
v


TABLE OF CONTENTS
CHAPTER
I. INVOLVEMENT OF GSK-3 IN M6A REGULATION...............................1
Gsk-3 Overview.......................................................1
Pluripotency in Mouse Embryonic Stem Cells........................4
Effect of LIF on Stem Cell Pluripotency...........................6
Effect of Gsk-3 Inhibition on Stem Cell Pluripotency..............7
m6A mRNA Modification................................................7
N6-methyladenosine (m6A) mRNA modification effect on stem cell
pluripotency......................................................9
Specific Aims.......................................................10
Quantify levels of m6A methylation in wild-type..................10
Involvement of Gsk-3 in FTO Phosphorylation......................10
Materials and Methods...............................................10
Observing Protein Expression.....................................10
Protein Isolation..........................................10
Western Blotting...........................................11
Overexpression of FTO and Mettl3 in Mammalian Cells..............12
Gibson Assembly Cloning....................................12
N2A and HEK293T Mammalian Cell Transfection................14
mESC Transfection using PEI................................15
Quantification of m6A in Mammalian Cells via LCMS/MS.............16
RNA Isolation..............................................16
vi


mRNA Enrichment
16
mRNA Digestion............................................17
Dot Blot..................................................17
Quantification of Endogenous FTO and Mettl3......................18
RNA Isolation.............................................18
cDNA Synthesis............................................18
qPCR......................................................18
Detection of FTO Phosphorylation in Mammalian Cells..............19
Overexpression of FTO-V5..................................19
V5 Immunoprecipitation....................................19
Protein Staining and LCMS/MS..............................20
Phosphoprotein Enrichment.................................20
Results..............................................................20
Over-Expression of FTO and Mettl3 in Mammalian Cells.............21
Levels of Endogenous FTO in Mammalian Cells......................24
Effect of Gsk-3 Inhibition on FTO Protein Expression.............27
Quantification of m6A levels in mESCs............................29
Effect of Mettl3 and FTO Overexpression on Pluripotency Genes in
mESCs............................................................31
Characterization of Axin' and Axin+/' mESCs....................32
Effect of PI3K Pathway on m6A levels.............................35
Phosphorylation of FTO...........................................36
II. DISCUSSION...........................................................42
vii


Conclusions
42
Final Words..............................................45
III. FUTURE DIRECTIONS...........................................47
REFERENCES.......................................................50
APPENDIX.........................................................58
A. Equations...................................................58
B. Buffer Reagents.............................................58
C. Cellular Mediums............................................58
D. IDT gBlock Sequences........................................58
viii


LIST OF FIGURES
Figure
1. Verification of Successful Gibson Assembly Cloning.............................23
2. Verification of Plasmid Expression in Mouse Embryonic Stem Cells...............24
3. FTO Protein Expression in WT and Gsk-3 DKO mESCs Cultured in Complete ESC
Media in the Presence of LIF.....................................................26
4. FTO Expression in mESCs Cultured in Complete ESC Media in the Absence of LIF
for 14 Days.......................................................................26
Figure 5. FTO Gene Expression in mESCs Cultured in Complete ESC Media in the
Absence of LIF for 14 Days.......................................................27
Figure 6. Effect of Gsk-3 Inhibition on FTO Protein Expression in WT ESCs........29
Figure 7. Quantification of m6A in WT and Gsk-3 DKO cells........................30
Figure 8. Esrrb Gene Expression in mESCs with Overexpression of Mettl3 or FTO....32
Figure 9. Characterization of Axin' and Axin+/' mESCs...........................34
Figure 10. Quantification of m6A in WT and pi 10* cells...........................36
Figure 11. Phospho-Protein Enrichment Schematic...................................39
Figure 12. Phospho-Protein Enrichment.............................................40
Figure 13. FTO-V5 Protein Overexpression in mESCs.................................40
Figure 14. FTO-V5 Protein LC MS/MS................................................41
IX


LIST OF ABBREVIATIONS
3 UTR 3 Cintranslated Region
AGi Ascorbic Acid and a Gsk-3 P inhibitor supplement
Alkbh5 AlkB Homolog 5
APC Adenomatous Polyposis Coli
BMP2 Bone Morphogenetic Protein 2
BMP4 Bone Morphogenetic Protein 4
BPD Bipolar Disorder
CKIa Casein Kinase I-alpha
Erkl Extracellular Regulated Kinase 1
Erk2 Extracellular Regulated Kinase 2
ESC Embryonic Stem Cells
Esrrb Estrogen-Related Receptor Beta
FGF4 Fibroblast Growth Factor 4
FTO Fat Mass and Obesity Associated Protein
GFP Green Fluorescence Protein
Gsk-3 Glycogen Synthase Kinase
GWAS Genome Wide Association Study
DEPC Diethylpyrocarbonate
DKO Double Knockout
DMEM Dulbeccos Modified Eagle Medium
HEK293T Human Embryonic Kidney Cells
hESC Human Embryonic Stem Cells
x


HOTAIR HOX Transcript Antisense RNA
iPSC Induced Pluripotent Stem Cells
Klf4 Kriippel-like factor 4
LCMS/MS Liquid Chromatography Tandem Mass Spectrometry
LiCl Lithium
LIF Leukemia Inhibitory Factor
LNCRNA Long non-coding RNA
KO Knockout
m6A N6-methyladensine
m6A-seq N6-methyladensine sequencing
MEK Mitogen Activated and Extracellular-Regulated Kinase Kinase
mESC Mouse Embryonic Stem Cells
Mettl3 Methyl Transferase-like 3
miRNA MicroRNA
mRNA messenger RNA
N2A Neuroblastoma Cells
ncRNA Non-coding RNA
NSC Neural Stem Cells
Opti-MEM Minimum Essential Media
pi 10* Myristoylated form of pi 10 subunit
PBS Phosphate Buffered Saline
PEI Polyethylenimine
PI(3,4,5)P3 Phosphatidylinositol-3, 4, 5-triphosphate
XI


PI3K Phosphatidylinositol-3-Kinase
qPCR Quantitative PCR
RIP RNA Immunoprecipitation
rRNA Ribosomal RNA
snoRNA Small Nucleolar RNA
SNP Single Nucleotide Polymorphism
STAT3 Signal Transducer and Activator of Transcription 3
Tcfi T-cell factor 3
TdT Terminal Deoxynucleotidyl Transferase
tRNA Transfer RNA
YTHDF2 YTH Domain Family 2
Xll


CHAPTER I
INVOLVEMENT OF GSK-3 IN REGULATION OF m6A DEMETHYLASE, FTO Gsk-3 Overview
Glycogen Synthase Kinase 3 (Gsk-3) is a kinase that is a key component in numerous intracellular pathways, with over 100 known substrates (Beurel, Grieco, & Jope, 2015). It is a highly conserved proline-directed serine/threonine protein kinase (Hooper, Killick, & Lovestone, 2008) that has two different isoforms, Gsk-3a and Gsk-3P, shown to regulate diverse cellular functions (Wu & Pan, 2010) such as structure, gene expression, mobility, and apoptosis (Jope, Yuskaitis, & Beurel, 2007). Gsk-3a and Gsk-3P are encoded by two independent genes (Woodgett, 1990), yet have highly similar kinase domains (98% identity) (Doble, Patel, Wood, Kockeritz, & Woodgett, 2007). These isoforms exhibit functional redundancy in most pathways; each isoform is able to compensate for absence of the other (Bartman et al., 2014; Huang & He, 2008). Typically a negative regulator, Gsk-3 is rare among kinases in that it is constitutively active in its basal state, and is ubiquitously expressed. Both Gsk-3 a and Gsk-3 p have a preferred consensus phosphorylation motif of S/T-X-X-X-S/T (Fiol, Mahrenholz, Wang, Roeske,
& Roach, 1987). Most Gsk-3 substrates require pre-phosphorylation of target substrates at a carboxy-terminal serine or threonine before Gsk-3 phosphorylates the target substrate (Hooper et al., 2008).
Gsk-3 is widely expressed and highly active in resting cells but is inhibited in response to cellular signals, such as hormones and growth factors (Doble et al., 2007). Gsk-3 itself is regulated by four key mechanisms: phosphorylation, subcellular localization, formation of protein complexes containing Gsk-3, and the phosphorylation
1


state of Gsk-3 target substrates (Jope et al., 2007). Inhibition or genetic deletion of Gsk-3 isoforms leads to changes in gene expression (Bartman et al., 2014), alterations in DNA methylation (Meredith et al., 2015), and changes in stem cell pluripotency (Sanchez-Ripoll et al., 2013).
The involvement of Gsk-3 in the Wnt and insulin signaling pathways has been well established (Cross, Alessi, Cohen, Andjelkovich, & Hemmings, 1995; Peifer, Pai, & Casey, 1994; Yost et al., 1996). In Gsk-3a _/_; Gsk-3fi mouse embryonic stem cells (mESCs), both pathways are constitutively active and ligand independent (Doble et al., 2007). In the insulin signaling pathway, insulin binding its receptor activates phosphoinositol-3 kinase (PI3K), which in turn activates Akt (Ding, Chen, & McCormick, 2000). Akt then phosphorylates serine-21 and serine-9 in free cytoplasmic Gsk-3a and Gsk-3p (Cross et al., 1995; Klippel et al., 1996), respectively, and these phosphorylated amino-termini fold back and inhibit Gsk-3 kinase activity by acting as a pseudosubstrate (Frame, Cohen, & Biondi, 2001). This results in de-phosphorylation of downstream substrates and elicits an increase in glycogen and protein synthesis (Doble & Woodgett, 2003).
Gsk-3 also has a pivotal role in Wnt signaling, being a key component of the multi-protein P-catenin destruction complex (Clevers & Nusse, 2012). In the absence of Wnt, Gsk-3 is active and able to keep cytoplasmic P-catenin at low levels through phosphorylation. Once phosphorylated by the destruction complex, comprised of Axin, Gsk-3, CKIa, and APC, P-catenin is ubiquitinated and targeted for degradation by the proteasome (Aberle, Bauer, Stappert, Kispert, & Kemler, 1997). When Wnt binds its receptor, Frizzled, Gsk-3 is physically displaced from the destruction complex (Zeng et
2


al., 2005). P-catenin is able to accumulate and translocate to the nucleus, leading to association with LEF/TCF family of DNA binding proteins (Korinek et al., 1997) and the transcription of Wnt target genes (Jansson, Kim, & Cheng, 2015). The inhibition of Gsk-3 relieves the suppression of these target genes (Wu & Pan, 2010).
Gsk-3 dysregulation has been found to be associated with various disease states, such as obesity, inflammation, neurological disorders, neurodegenerative disorders and diabetes (Wu & Pan, 2010). Therefore, inhibiting or knocking out Gsk-3 will help provide insight into the precise role for Gsk-3 in these diverse diseases. Therefore, it is not surprising that several Gsk-3 small molecule inhibitors have been discovered, and are used to probe the biological function of Gsk-3, although none of these inhibitors can discriminate between the two isoforms (Coghlan et al., 2000). Examples of commonly used inhibitors include lithium chloride (LiCl), SB-415286 and CHIR99021. SB-415286 and CHIR99021 inhibit Gsk-3 through ATP competition (Bain et al., 2007; Coghlan et al., 2000; Murray et al., 2004), while LiCl functions by displacing magnesium, a required cofactor for Gsk-3 function (Klein & Melton, 1996). It is noted that LiCl has been a common treatment for bipolar disorder for over 60 years (Meijer, Flajolet, & Greengard, 2004), yet it remains to be determined whether the therapeutic effects of lithium are due to Gsk-3 inhibition or a Gsk-3-independent mechanism.
While small molecule inhibitors are widely used to probe the function of Gsk-3, no small molecule is specific, raising the possibility of off-target and dose-dependent effects, making the interpretation of data more difficult. For this reason, our lab has used a variety of methods that rely on either genetic deletion of Gsk-3 or tonic inhibition of Gsk-3 via the ectopic activation of specific signaling pathways. For example, stable
3


expression of the pi 10a catalytic subunit of PI3K (termed pi 10*) in wild type mouse ESCs leads to the phosphorylation and inhibition of Gsk-3 and constitutive activation of the insulin signaling pathway (Popkie et al., 2010). Gsk-3 double-knockout (Gsk-3 Pluripotency in Mouse Embryonic Stem Cells
Mouse embryonic stem (ES) cells are derived from the inner cell mass (ICM) of pre-implantation blastocysts (Evans & Kaufman, 1981) and are characteristically pluripotent; each cell has the capability to differentiate into all cell types derived from the three embryonic germ layers: ectoderm, mesoderm, and endoderm (Burdon, Smith, & Savatier, 2002; G. J. Pan, Chang, Scholer, & Pei, 2002). ESCs are capable of indefinite self-renewal in vitro under appropriate culturing conditions (G. Pan & Thomson, 2007). Given the ability of pluripotent stem cells to differentiate into virtually any cell type, intense research efforts have been focused on somatic cell reprogramming and its potential in the treatment of many devastating diseases (Salomonis et al., 2010). Despite these efforts, there remain holes in our knowledge about the precise mechanisms involved in maintaining stem cells in a pluripotent state (G. Pan & Thomson, 2007).
Development of the embryo is controlled by coordinated action of signaling pathways, extrinsic factors, and transcription factors (Sanchez-Ripoll et al., 2013). Somatic cell reprogramming has previously been accomplished by nuclear transfer into oocytes (Pomerantz & Blau, 2004) or by fusion with ES cells (Ishikawa et al., 2006).
This indicated that embryonic cells contained factors that could confer pluripotency to
4


somatic cells (Patel & Yang, 2010). In a seminal series of experiments, Takahashi & Yamanaka demonstrated that overexpression of specific transcription factors (Oct4,
Sox2, Klf4, c-Myc) are capable of reverting differentiated cells into stem cells, termed induced pluripotent stem cells (iPSCs) ((Nakagawa et al., 2008; Takahashi & Yamanaka, 2006). Transcription factors activate or repress expression of downstream genes when exposed to environmental and developmental signals (Kadonaga, 2004). These cells exhibit the characteristic cell surface markers, express the same genes, and have the same differentiation potential as ES cells (Takahashi & Yamanaka, 2006).
The so-called Yamanaka factors (Oct4, Sox2, Klf4, c-Myc), have been studied in-depth to better understand how they act as master regulators of pluripotency. Oct4, also known as Oct3, is a member of the POU (Pit-Oct-Unc) transcription factor family and is expressed almost exclusively in ES cells (Okamoto et al., 1990). Oct4 often binds in partnership with Sox2. Studies show that Oct4, Sox2, and Nanog, another transcription factor shown to promote pluripotency (Mitsui et al., 2003), bind to many of the same promoter sequences and target common core signaling pathways that are intricately connected in governing pluripotency (Loh et al., 2006). One key transcriptional target of Nanog is Esrrb (Estrogen-Related Receptor P) (Festuccia et al., 2012). Esrrb is required for suppressing differentiation and lies downstream of Gsk-3 and Tcf3 (Martello et al., 2012). These transcription factors and networks work synergistically in a highly regulated manner to control and maintain stem cell pluripotency.
Effect of LIF/STAT Pathway on Stem Cell Pluripotency
Under early, commonly used cell culturing conditions, ES cells tended to spontaneously differentiate rather than undergo continuous self-renewal. Leukemia
5


inhibitory factor (LIF) was discovered to be a key factor that could promote the maintenance of self-renewal of mouse ES cells in vitro (G. Pan & Thomson, 2007). LIF is a member of the interleukin-6 cytokine family and binds to a heterodimeric receptor, consisting of the LIF receptor and gpl30. Binding of LIF to its receptor activates downstream signaling pathways through gpl30, such as STAT3 (signal transducer and activator of transcription 3), PI3K, and Ras/Erk pathways (Cartwright et al., 2005).
Activation of the STAT3 pathway leads to dimerization and translocation of STAT3 into the nucleus, where it binds promoters and enhancers of target genes (Graf, Casanova, & Cinelli, 2011). When the STAT3 pathway is disrupted, ES cells undergo differentiation. Alternatively, artificial activation of the STAT3 pathway can maintain self-renewal of ES cells, even in the absence of LIF (Tai & Ying, 2013). The LIF/STAT3 signaling pathway is one of the only known pathways involved in mESC pluripotency (Smith, 2001). However, this pathway is expendable in ES cells before gastrulation, suggesting other signaling cascades are vital for ESC renewal (Sato et al., 2003).
Both the activation of the STAT3 and the PI3K pathway positively regulates self-renewal. Alternatively, the activation of the Ras/Erk pathway leads to ES cell differentiation into endoderm lineage. As LIF activates all three pathways, balance must be fine-tuned in order to achieve LIF-mediated maintenance of ESC self-renewal (Storm et al., 2007). LIF is often supplemented with Bone Morphogenetic Protein 2 or 4 (BMP2/4) in culture medium to better sustain pluripotency (Sanchez-Ripoll et al., 2013). Effect of Gsk-3 Inhibition on Stem Cell Pluripotency
Inhibition of Gsk-3 has also been shown to enhance and sustain stem cell pluripotency (Sanchez-Ripoll et al., 2013). It was discovered that simultaneous inhibition
6


of Gsk-3 and mitogen-activated protein kinase kinase (MEK, also known as MAPKK), was sufficient to achieve ground state pluripotency. The combination of these two inhibitors was deemed the 2i cocktail (Ying et al., 2008). Furthermore, mESCs that are devoid of both Gsk-3 isoforms are resistant to differentiation (Doble et al., 2007; Sanchez-Ripoll et al., 2013). Two signaling pathways regulated by Gsk-3 activity, Wnt (Wray et al., 2011) and insulin (Sanchez-Ripoll et al., 2013), have both been implicated in the maintenance of stem cell pluripotency, yet the precise role for Gsk-3 in these pathways remains unclear.
N6-methyladenosine mRNA modification
There are over 100 known RNA nucleotide modifications, many of which play important regulatory roles, similar to that of dynamic DNA and protein modifications (He, 2010). N6-methyladensoine (m6A) is the methylation of the N6 position of adenosine and is a post-transcriptional mRNA modification (Grosjean, 2005). It is the most abundant and dynamic internal eukaryotic mRNA modification. m6A is roughly 0.1%-
0.4% of total adenosine residues in mRNA (Meyer et al., 2012). Through m6A-seq, it was revealed that m6A modifications cluster around the stop codon, within long internal exons (Dominissini et al., 2012), and within the 3 untranslated region (Meyer et al., 2012). m6A-seq was performed using a human hepatocellular carcinoma cell line and identified roughly 12,000 m6A sites within 7,000 coding genes and 250 non-coding; conversely, many transcripts were completely devoid of m6A (Dominissini et al., 2012). m6A is highly evolutionarily conserved between the mouse and human, with many of the same orthologous mRNAs methylated, suggesting important biological function for m6A modification (Dominissini et al., 2012).
7


The addition of m6A is catalyzed by Mettl3 (methyl-transferase like 3) and Mettll4 (Lee, Kim, & Kim, 2014), which are components of a larger methyltransferase complex (J. Liu et al., 2014); Mettl3 is believed to be the primary catalytic component of this complex. The m6A modification is reversible, and is regulated by RNA demethylases. Two m6A demethylases have been identified, FTO and Alkbh5 (Jia et al., 2011; Zheng et al., 2013). FTO, the fat mass and obesity associated protein, was one of the first genes identified via a genome wide association study (GWAS) to contain a single nucleotide polymorphism (SNP) associated with obesity in humans (Loos & Yeo, 2014). SNPs in the first intron are associated with increased body mass index and increased risk for diabetes (Keller et al., 2011). The association is thought to be mediated by insulin signaling, but the true mechanism still remains largely unknown. It has also not been explained whether aberrant m6A levels result from the presence of the SNP associated with obesity.
Four out of five YTH domain family proteins have been confirmed for the selective binding of the m6A modification through a conserved hydrophobic pocket (Li, Zhao, Wu, & Shi, 2014). YTHDF2 was one of the first proteins found to recognize and bind m6A (Wang et al., 2014). Binding of YTHDF2 has been shown to regulate RNA decay through localization of the methylated mRNAs to the P-bodies, where mRNA is then degraded (Wang et al., 2015). Knockdown of YTHDF2 results in roughly a thirty percent increase in mRNA half-life of methylated targets when compared to non-targets (Wang et al., 2014). This could serve to adjust the expression of regulatory genes. YTHDF1 directly promotes translation of m6A mRNAs (Wang et al., 2015). m6A has also been shown to alter the local structure of mRNA and long-noncoding RNA
8


(IncRNA). It has been shown to be essential for development and cell viability, yet its mechanisms are still poorly understood (N. Liu et al., 2015).
N6-methyladenosine (m6A) mRNA modification effect on stem cell pluripotency
Thousands of mRNAs show conserved m6A modifications, including those encoding transcription factors required for maintaining pluripotency. mRNAs encoding Nanog, Klf4, and Myc all contain m6A tags (Batista et al., 2014). Methylation of these transcription factor encoding mRNAs could lead to a reduced mRNA half-life. Mettl3 was recently identified as a regulator of termination of naive pluripotency through a small interfering RNA screen (Geula et al., 2015). In pre-implantation embryos, pluripotent stem cells are referred to as 'naive', and they become 'primed' during post-implantation development, through activation of differentiation markers and repression of pluripotency genes (Weinberger, Ayyash, Novershtern, & Hanna, 2016). Genetic deletion of Mettl3 leads to severe decrease of m6A (Batista et al., 2014). After being grown in differentiation media for twenty-one days, Mettl3' mESCs failed to up-regulate developmental markers and repress pluripotency genes, such as Nanog and Esrrb (Geula et al., 2015). Furthermore, differentiation defects could be rescued through introduction of WT Mettl3 allele (Batista et al., 2014). This suggests that levels of m6A dynamically effect stem cell pluripotency.
Specific Aims
The main objective of this research project is to study the relationship between Gsk-3 and stem cell pluripotency by a novel mechanism: the regulation of the N6-methyladenosine (m6A) modification on mRNA. We postulate that the m6A modification is regulated by Gsk-3 through phosphorylation of the protein FTO. FTO is a known m6A
9


demethylase and when phosphorylated, the protein would be marked for ubiqutination and degradation. This is mechanistically similar to the role of Gsk-3 in the regulation of P-catenin. Inhibition of Gsk-3 would result in accumulated FTO protein levels, leading to reduced m6A levels and increased stem cell pluripotency. Identifying the regulatory role of m6A and FTO through Gsk-3 may provide a strong mechanistic understanding of the involvement of Gsk-3 in stem cell differentiation.
Involvement of Gsk-3 in m6A Regulation
Aim #1: Quantify levels of m6A methylation in wild-type and Gsk-3 DKO mouse embryonic stem cells using liquid-chromatography, mass spectrometry.
Aim #2: Determine phosphorylation status of FTO through liquid-chromatography, mass spectrometry and phosphoenrichment.
Materials and Methods
Observing Protein Expression:
Protein Isolation
1. Cell media was removed with vacuum and cells were washed with 500ul lx PBS.
2. Cells were lysed with 350ul IP lysis buffer with 1% NP-40 and Sigma Protease Inhibitor Cocktail at 1:1000 using rubber policeman.
3. Lysates were incubated on ice for 30 minutes, vortexing thoroughly every 10 minutes.
4. Lysates were centrifuged at 14,000 RPM for 15 minutes at 4 C in order to pellet cellular debris.
5. Supernatant was transferred to a fresh microcentrifuge tube, used immediately, or stored at -20 C.
10


Western Blotting
For FTO westerns, nitrocellulose membrane was blocked in 5% milk/TBST for 1 hour at room temperature while rocking. Primary FTO antibody (PhosphoSolutions Reference#: 597-FTO) was added to the membrane at 1:1000 in lOmL of 1% milk/TBST. Membrane was incubated in primary antibody overnight at 4C while rocking. Membrane was then washed with TBST (lx for 15 min and 2x for 5 min) and Anti-Mouse secondary antibody (GE Healthcare Reference #: NA93IV) was added at 1:10,000 in lOmL of 1% milk/TBST for 30 minutes at room temperature while rocking. Membrane was washed with TBST (3x for 5 minutes) and then ECL (Amersham ECL) was added to membrane for 5 minutes. Membrane was blotted dry and then imaged on ChemiDoc XRS+ (Biorad).
For a-tubulin westerns, membrane was blocked in 4% BSA/TBST for 1 hour at room temperature while rocking. Primary a-tubulin antibody (Cell Signaling Reference#: A11126) was added at 1:1000 in lOmL of 4% BSA/TBST. For secondary antibody, Anti-Mouse was added at 1:20,000 in lOmL of 4% BSA/TBST. Similar procedure was followed as used in FTO westerns.
For Gsk-3a/p westerns, membrane was blocked in 5% BSA/TBST for 1 hour at room temperature while rocking. Primary Gsk-3a/p antibody (Calbiochem Reference #: 368662) was added to membrane at 1:1000 in lOmL 5% BSA/TBST. For secondary antibody, Anti-Mouse was added at 1:20,000 in lOmL 5% BSA/TBST. Similar procedure was followed as used in FTO westerns.
For V5 westerns, membrane was blocked in 5% milk/TBST for 1 hour at room temperature while rocking. Primary V5-HRP conjugated antibody (Invitrogen Reference
11


#: R961-25) was added to membrane at 1:1000 in lOmL 5% milk/TBST. No secondary antibody needed. Similar imaging procedure was followed as used in FTO westerns.
For Flag westerns, membrane was blocked in 3% milk/TBST for 1 hour at room temperature while rocking. Primary Flag antibody (Sigma Reference #: F3165) was added to membrane at 1:1000 in lOmL 3% milk/TBST. For secondary antibody, Anti-Mouse was added at 1:20,000 in lOmL 3% milk/TBST. Similar procedure was followed as used in FTO westerns.
Over-Expression of FTO and Mettl3 in Mammalian Cells
Gibson Assembly Cloning of FTO V5 AND METTL3 FLAG into pCAGEN
1. Mammalian expression vector of interest, pCAGEN, was linearized using 2 uL of EcoRl restriction enzyme, 2uL EcoRl Buffer, 2 ug of circular pCAGEN, and 14 uL dH20, to make the final reaction volume 20 uL. The digest reaction was incubated at 37C for 15 minutes.
2. 5 phosphate groups on pCAGEN were removed in order to prevent plasmid recircularization. 1 uL of antarctic phosphatase (NEB) was added to the digest reaction. Samples were incubated at 37C for 15 minutes.
3. The effectiveness of the digest reaction was confirmed by running the digested product on a 1% agarose gel. The circular plasmid was added as a control.
4. After validation of successful digestion, the remaining linear plasmid was purified using the QIAquick Gel Extraction Kit from QIAGEN.
12


a. 1 volume of isopropanol was added to remaining digest reaction. Solution was added to spin column in a collection tube. Tube was spun at 10,000 rpm for 1 minute and the flow through was discarded.
b. The wash was performed by adding 750 uL of PE Buffer to the spin column. Tube was spun at 10,000 rpm for 1 minute and the flow through was discarded.
c. Empty column was re-spun at 10,000 rpm for 1 minute.
d. The spin column was placed in a fresh collection tube. 30 uL Buffer EB was added to the spin column and the tube was spun at 10,000 rpm for 1 minute to elute purified digest product.
5. The synthesized gBlock gene fragments (IDT, sequences contained in Appendix) were resuspended according to IDT protocol.
a. The tube was centrifuged for 5 sec at 3000 xg.
b. Sterile TE buffer (pH 7.5) was added to a concentration of lOng/uL.
c. Solution was homogenized by vortexing and incubated at 50 C for 20 minutes.
d. Sample was placed on ice for immediate use. (Eventually stored at -20C).
6. A 3-fold molar increase of DNA fragments containing 15 bp overlaps and 50 ng of linear plasmid was combined for the assembly (5-fold molar excess of fragment was used if the DNA was less than 200 bp). DNA fragments were converted into pmoles using Equation 1.
13


7. The Gibson assembly was prepared on ice by combining 50ng linear pCAGEN vector, 3-fold molar excess fragments, and 10 uL Gibson Assembly Master Mix. Milli-Q H20 was added to make a total volume of 20 uL.
8. Samples were incubated at 50C for 15 minutes (samples that contained more than 3 fragments were incubated at 50C for 30 minutes). After incubation, samples were immediately placed on ice or stored at -20C.
9. NEB DH5-alpha competent E. cob cells (included in Gibson Assembly Kit) were transformed with 2 uL of assembly reaction. Overnight cultures were made from colonies on LB + ampicillin plates. Plasmids were purified via the GeneJET Plasmid Miniprep Kit (Thermo Scientific) according to protocol.
10. To confirm if fragments were successfully cloned into pCAGEN, restriction digests were performed and products were run out on a 1% agarose gel.
N2A and HEK293T Mammalian Cell Transfection Using PEI
1. Day 1: Cells were plated at 1 .OxlO6 cells per well in 6-well plates in cell specific media (Appendix).
2. Day 2: Media was not changed in 6-well plates. 2.0 ug of total DNA (1800 ng plasmid of interest + 200 ng pMax-GFP) was added to 100 uL Opti-MEM per transfection. No DNA was added to untransfected control well. In a separate tube, 5 uL of PEI was added to 95 uL Opti-MEM per transfection. Tube was tapped to mix and incubated at room temperature for 5 minutes. 100 uL PEI:Opti-MEM was transferred to DNA:Opti-MEM tubes. Tubes were tapped to mix, centrifuged at lowest speed for collection, and incubated at room
14


temperature for 20 minutes. Mixture was added to cells drop-wise. Cells were incubated at 37C with 5% CO2 overnight.
3. Day 3: To determine if transfection was successful, presence of green
fluorescence from pMax-GFP was observed using fluorescence microscopy.
mESC Transfection Using PEI
1. Mouse ESCs were washed, trypsinized, and resuspended in Opti-MEM. 10 uL of resuspension was added to 10 uL trypan blue dye. The total number of ESCs was counted using the Cell Countess (Invitrogen).
2. 1 x 106 cells were aliquotted into 2 mL microcentrifuge tubes, one per well for a six-well plate. Tubes were centrifuged for 2 minutes at 1500rpm.
Supernatant was carefully aspirated.
3. Cell pellets were resuspended in 300 uL Opti-MEM.
4. 2 ug of total DNA was added to the resuspended cells (200 ng pMax-GFP and 1800 ng plasmid of interest). No DNA was added to untransfected control cells. Cells were mixed by careful pipetting.
5. 100 uL of PEI was added to the resuspended cells. Cells were mixed by pipetting.
6. Cells were incubated for 30 minutes at room temperature. Mixture was pipetted every 10 minutes.
7. The transfection reaction was plated drop-wise on freshly prepared gelatin-coated 6-well plates with 2mL warm and complete ESC media (Appendix).
8. Transfection was incubated overnight at 37 C and visualized the next day using the fluorescence microscope to confirm GFP expression.
15


Quantification of m6A Levels in Mammalian Cells
RNA Isolation
RNA was isolated using Direct-zol RNA Miniprep by Zymo. 500uL of TRIzol was added per well of a 6-well plate to begin lysing process (lmL of TRIzol was added per 10cm plate). RNA isolation followed kit protocol. All isolated RNA was quantified using Nanodrop 2000 (ThermoScientific).
mRNA Enrichment
1. 50 ul of oligo-d(T) magnetic beads were aliquotted to fresh microcentrifuge tubes, one per RNA sample.
2. 200 ul of Lysis/Binding Buffer (miRVANA RNA Isolation Kit) was added to each tube and samples were vortexed and mixed on rotator for 2 minutes at room temperature.
3. 5ug of isolated total RNA was added to magnetic beads. Tubes were placed on rotator overnight at 4 C.
4. Tubes were placed on magnet plate for one minute and supernatant was saved as oligo-dT other for further analysis.
5. 100 ul RNase-free H20 was added to tubes, vortexed, and placed back on magnet, discarding H20. Wash was repeated two times.
6. In order to elute RNA from beads, 20 ul cold lOmM Tris-HCl at pH 7.5 was added to beads and the tube was incubated at 80 C for 2 minutes.
7. Tube was returned to magnet and RNA was immediately placed in new tube on ice.
16


8. RNA was quantified using the Quibit HS RNA Assay Kit (ThermoFisher Scientific) and stored in the -20 C.
mRNA Digestion
lug of poly-A mRNA was digested by 4ul nuclease PI (2 U) in 40 ul of LCMS/MS buffer (Appendix) at 37 C for 1 hour. After incubation, 3ul of ammonium bicarbonate (1 M) and 0.5 ul alkaline phosphatase (0.5 U) was added. An additional incubation at 37 C for 1 hour was performed. To confirm digestion, samples were run out on a 1% agarose gel with an undigested RNA sample as a control. Samples were transported to Anschutz Medical Campus for analysis using LCMS/MS. Levels of adenosine and methyl-adenosine were reported.
Dot Blot
Nitrocellulose membrane was rehydrated in H20 for 3 minutes. The membrane was then placed in the Bio-Dot Microfiltration Apparatus (BioRad). Each well H20 and flushed by gentle vacuum. 5ul of H20 was added with 5ug of total RNA. RNA was allowed to bind membrane via gravity until all solution had flown through. The membrane was removed from the apparatus and cross-linked using UV light (Stratalinker). The membrane was placed back in the apparatus and blocked for 10 minutes using sterile TBST with 5% milk. Primary Anti-N6-methyladenosine antibody (Milipore Reference #: ABE572) was added to membrane at 1:500 in at room temperature for 1 hour in 5%milk/TBST. Membrane was then washed four times with TBST. For secondary antibody, Anti-Rabbit was added at 1:5,000 for 30 minutes at room temperature in 5% milk/TBST. The membrane was washed four times with TBST and imaged using Pierce ECL Western Blotting Substrate.
17


Quantification of Endogenous FTP and Mettl3 in Mammalian Cells
RNA Isolation
RNA isolated using mirVana mirRNA Isolation Kit by Life Technologies followed kit protocol. When RNA was to be isolated using Direct-zol RNA Miniprep by Zymo, 500uL TRIzol was added per well of a 6-well plate to begin lysing process (lmL of TRIzol was added per 10cm plate). RNA isolation followed kit protocol. All isolated RNA was quantified using Nanodrop 2000 (ThermoScientific). cDNA Synthesis
cDNA was synthesized using High Capacity Reverse Transcriptase kit (Applied Biosystems) according to manufacturers protocol. Total RNA, lug- 2ug, was used to synthesize cDNA. The amount of input RNA used was kept constant for each set of RNA samples. qPCR
To quantify gene expression, three biological replicates were created for each cell or treatment type. Total RNA was isolated from cells and cDNA was synthesized using lug-2ug RNA. All cDNA samples were diluted to 8.89ng/ul using DEPC H20. A master mix for each probe was made by combining 2x TaqMan Mix (with UNG), 20x TaqMan probe, and DEPC H20. Master mix components were multiplied by total number of wells designated for each probe. After 19.38uL of master mix was added to each designated well, 5.63 uL of diluted cDNA was added to plate in triplicates in order to have three technical replicates of each sample. Plates were spun down for 30 seconds at 2,000 RPM to ensure all components were combined at the bottom of the plate, and then placed in
18


StepOne qPCR Machine (Applied Biosystems). Data was collected by running the
Comparative Ct (AACt) program, which followed the cycling parameters:
qPCR Program:
2 min 50C x 1 cycle
10 min 95C x 1 cycle
[15 sec 95C
1 min 60C] x30 cycles
Detection of FTP Phosphorylation in Mammalian Cells
Overexpression of exogenous FTO-V5
WT and Gsk-3 DKO mESCs were transfected with 2000 ng of FTO containing a V5 epitope tag, referred to as FTO-V5, according to protocol previously described. Total protein was isolated and successful transfection was confirmed through western blot using a primary antibody to the V5 epitope tag.
V5 Immunoprecipitation
Remaining protein lysate, 300 ul, was added to 2 ul of V5-agarose beads (Bethyl Laboratories Reference #: SI90-119). Lysates were incubated with beads for 2 hours at room temperature while rotating. Lysates were centrifuged at 3000 x g for 60 seconds at 4C, in order to pellet beads. Pellet was washed 4 times with IP lysis buffer and Sigma Protease Inhibitor Cocktail. Protein was eluted by adding 40 ul of lx Tris-tricine sample buffer and incubated for 5 minutes at 100 C. Beads were pelleted by centrifugation at 14,000 rpm for one minute. Supernatant was transferred to a fresh micro-centrifuge tube and stored at -20 C until use. Successful immunoprecipitation was confirmed through western blot using an antibody to the V5 epitope tag.
Protein staining and LCMS/MS
19


V5 immunoprecipitated protein samples were run out on 7.5% polyacrylamide Mini-PROTEAN TGX Precast Gel (BioRad). The polyacrylamide gel was then stained with Imperial Protein Stain (ThermoScientific). FTO-V5 stained protein band was identified and excised. Samples were transported to Anschutz Medical Campus for analysis using LCMS/MS.
Phosphoprotein enrichment
Total protein was isolated from WT and Gsk-3 DKO mESCs that were transfected with FTO-V5. Samples were enriched for phosphoproteins using the Pro-Q Diamond Phosphoprotein Enrichment Kit (Invitrogen Reference #: P33358) according to manufacturers protocol for nondenatured protein lysates.
Results
Several studies have shown that inhibition of Gsk-3 increases stem cell pluripotency, even in the absence of LIF, but the exact mechanisms and pathways involved remain to be determined. The same differentiation resistant phenotype is seen in mESCs lacking the RNA methyltransferase, Mettl3, leading us to hypothesize that there may be a mechanistic connection between Gsk-3 inhibition and regulation of RNA methylation that dictates pluripotency. It was shown in Mettl3 KO ESCs that reduced levels of m6A mRNA methylation leads to an increase in the half-life of those mRNAs, which notably includes many pluripotency-related genes. These same pluripotency genes are also increased in Gsk-3 DKO ESCs. Therefore, we hypothesized that Gsk-3 is regulating the m6A mRNA modification. Because Gsk-3 is almost exclusively a negative regulator, we proposed Gsk-3 is regulating m6A through controlling the levels of FTO protein via phosphorylation, much as it regulates P-catenin in the Wnt pathway.
20


Phosphorylation of FTO would subsequently lead to ubiquitin-mediated degradation in WT ESCs. Therefore, when Gsk-3 is inhibited or genetically deleted, FTO would accumulate, and m6A levels would decrease. This decrease of m6A would result in the increased half-life of specific mRNAs, leading directly to enhanced pluripotency. Over-Expression of FTO and Mettl3 in Mammalian Cells
In order to determine the precise mechanism by which Gsk-3 affects m6A, we wanted to overexpress both the m6A demethylase, FTO, and the m6A methyltransferase, Mettl3, into mouse embryonic stem cells. We first needed to clone these protein coding sequences into a mammalian expression vector. Gibson Assembly cloning (Gibson, 2011) was used to insert each of these sequences into mammalian expression vector, pCAGEN. gBlock gene fragments (IDT) are double-stranded, sequence verified nucleotide fragments that were synthesized to be identical to FTO and Mettl3 protein and contained amino-terminal V5 and Flag epitope tags, respectively (sequences in Appendix). An epitope tag was used to facilitate the detection of each protein by using epitope specific antibodies, as well as to distinguish between endogenous and exogenous protein. Gibson Assembly requires that each fragment contain 15-20 bp overlaps that correspond with the expression vector. Subsequently, 15 bp overlaps complementary to pCAGEN linearized with EcoRI were added to each end of the synthesized DNA fragments. Gibson assembly mastermix contains three key enzymes, an exonuclease, DNA ligase, and DNA polymerase to create a sealed double-stranded plasmid, with the gBlock inserted in proper orientation. OneShot chemically competent cells were transformed with Gibson Assembly product and plasmid DNA was isolated through mini-preps (GeneJet). A restriction digest was performed to screen clones in order to ensure proper insertion of the
21


gBlock. Clones with proper restriction enzyme digest bands (Figure 1A and IB) were subjected to Sanger sequencing provided by Eton Bioscience to further confirm correct cloning.
After successful cloning of Mettl3 and FTO, we wanted to confirm that these constructs would express in mammalian cells. Mouse embryonic stem cells were transfected with 1800ng of plasmid DNA and 200 ng of GFP using polyethylenimine (PEI) as a transfection agent (Bartman, Egelston, Ren, Das, & Phi el, 2015). Mouse embryonic stem cells were chosen in order to study the effect of manipulating m6A levels on pluripotency. Therefore, mESCs were an ideal model. Successful transfection was visualized through presence of GFP.
In order to verify successful overexpression of these plasmids in mESCs, protein was isolated and subjected to western blot against an untransfected control protein lysate. Antibodies to V5 and Flag epitope tags were used (Figure 2A and 2B). Both constructs produced robust protein expression, indicating we were able to overexpress these proteins in mouse embryonic cells.
22


BglH Digest
B
1000 bp
EcqRV Digest
Figure 1. Verification of Successful Gibson Assembly Cloning.
(A) BglH restriction digest of pCAGEN-FTO-V5 to ensure that transcripts were inserted correctly into mammalian expression vector pCAGEN. 900bp fragments were expected in correct clones
(B) EcoRV restriction digest of pCAGEN-MettB-Flag to ensure proper cloning. 800bp fragments were expected in correct clones.
23


A
Untransfected FTO Overexpression
65 kD
IB: V5
B
Mettl3
Untransfected Overexpression
65 kD
IB: Flag
Figure 2. Verification of Plasmid Expression in Mouse Embryonic Stem Cells. (A) Western blot using an Anti-V5 antibody to detect expression of FTO-V5-pCAGEN (B) Western blot using Anti-Flag antibody to detect expression of pCAGEN-MettB-Flag.
Levels of Endogenous FTO in Mammalian Cells
Our hypothesized mechanism proposes that Gsk-3 regulates FTO through phosphorylation, resulting in ubiquintation and degradation of FTO. Therefore, we wanted to quantify levels of endogenous FTO in order to determine if FTO protein levels were indeed higher in Gsk-3 DKO mESCs due to the inability of FTO to be phosphorylated by Gsk-3 and subsequently marked for degradation. Under normal ESC culturing conditions, with the addition of LIF, no difference was seen between levels of protein in WT compared to Gsk-3 DKO mESCs (Figure 3). These results were expected because the addition of LIF maintains WT ESCs in a pluripotent state. Gsk-3 DKO ESCs
24


are able to maintain high pluripotency levels regardless of LIF addition. Therefore, we concluded that optimized cell culturing conditions was necessary in order to separate pluripotency mechanisms from the effects of LIF addition.
A previous study indicated that Gsk-3 DKO ESCs were able to retain pluripotency even after removing LIF for 14 days (Doble et al., 2007). We decided to implement a similar regimen, culturing WT and Gsk-3 DKO mESCs in complete ESC media (Appendix) in the absence of LIF for fourteen days. Cells were washed and treated with new media daily. On day 14, protein was isolated and quantified. We then performed a western blot to assess levels of FTO and a-tubulin (Figure 4). A robust decrease of FTO was seen in WT ESCs when compared to Gsk-3 DKO ESCs. a-tubulin served as a loading control to indicate relative levels of protein. This data strongly supports our hypothesis that Gsk-3 DKO ESCs have accumulated levels of FTO protein through lack of FTO degradation.
In order to rule out possible effects on FTO protein due to changes in gene expression, we examined FTO gene expression in these same cells. In addition to protein, total RNA was also isolated (Zymo) and cDNA was synthesized (Applied Biosystems). FTO gene expression was quantified through qPCR (Figure 5). Results indicate that relative gene expression remain constant, with a minor decrease in the Gsk-3 DKO cells. This is consistent with our hypothesis that regulation of FTO occurs post-transcriptionally.
25


WT
DKO
50 kD
IB: FTO
50 kD
IB: a-tubulin
Figure 3. FTO Protein Expression in WT and Gsk-3 DKO mESCs Cultured in Complete ESC Media in the Presence of
LIF. Protein band sizes are indicated on left side, a-tubulin western served as a loading control.
WT DKO
50 kD IB: FTO
50 kD IB: a-tubulin
Figure 4. FTO Expression in mESCs Cultured in Complete ESC Media in the Absence of LIF for 14 Days. FTO protein expression was observed in WT and Gsk-3 DKO mESCs that were grown in the absence of LIF for 14 days.
The a-tubulin western was used as a protein loading control.
26


1.2
1
0.8 £f 0.6
0.4
0.2
0
WT -LI Fd 14 DKO -LI Fd 14
FTO
1
Figure 5. FTO Gene Expression in mESCs Cultured in Complete ESC Media in the Absence of LIF for 14 Days. FTO gene expression was observed in WT and Gsk-3 DKO mESCs that were grown in the absence of LIF for 14 days using qPCR
Effect of Gsk-3 Inhibition on FTO Protein Expression
Because we determined that FTO protein levels were significantly reduced in WT mESCs when compared to Gsk-3 DKO mESCs, we wanted to determine if treating WT ESCs with a Gsk-3 inhibitor would also be sufficient to prevent degradation of FTO protein in the absence of LIF. In order to determine the effects of Gsk-3 inhibition on FTO levels, WT cells were grown without LIF for fourteen days as previously described. WT cells were treated with various concentrations of known Gsk-3 small molecule inhibitors, LiCl and SB-415286 on day 14 and 15. On day 16, protein was isolated from
27


WT cells and FTO and a-tubulin western blots were performed to access levels of protein present.
Results indicated that FTO protein levels increased with increased concentrations of SB415286, with the most robust expression seen in cells treated with 15pM SB415286 (Figure 6A). The LiCl treated cells showed a similar trend in increasing FTO expression levels with increasing LiCl concentrations, with the most robust expression seen in cells treated with lOmM LiCl (Figure 6B). These data show that Gsk-3 inhibition can mimic the effects on FTO protein expression that we observed in Gsk-3 DKO ESCs.
28


A
OuM SB SuM SB
lOuMSB 1 SuM SB
50 kD
IB: FTO
50 kD
IB: a-tubulin
B
OmM Kl ImM LiCI 2mM lid 5mM UCI lOmM LICI
50 kD
IB: FTO
50 kD
IB: a-tubulin
Figure 6. Effect of Gsk-3 Inhibition on FTO Protein Expression in WT ESCs. WT mESCs were cultured in complete ESC media in the absence of LIF for 16 days. On days 14 and 15, cells were treated with increased concentrations of (A) SB-415,286 or (B) LiCI. Protein was isolated on day 16 to observe the effect of Gsk-3 inhibition on FTO expression in a dose-dependent manner. The a-tubulin westerns were used as a protein loading control.
Quantification of m6A levels in mESCs
Our hypothesized mechanism suggests that Gsk-3 regulates FTO through phosphorylation. It has already been well established that FTO is the m6A demethylase. If Gsk-3 is knocked-out and FTO protein accumulates, the overall levels of m6A should be reduced. Therefore, we wanted to quantify levels of m6A from Gsk-3 DKO and WT cells. WT and Gsk-3 DKO cells were grown without LIF for 14 days. On day 14, total RNA
29


Effect of Mettl3 and FTP Overexpression on Pluripotency Genes in mESCs
We next wanted to quantify the expression of pluripotency genes when we overexpressed either FTO or Mettl3 in mESCs. Because decreased m6A is associated with increased pluripotency and increased mRNA stability, we expected to see an increase in gene expression when we overexpressed FTO and a decrease in gene expression when we overexpressed Mettl3. We chose to observe Esrrb (estrogen receptor P) mRNA because it is known to be affected by m6A methylation. We grew WT and Gsk-3 DKO mESCs in the presence of complete ESC media with LIF. We then transfected FTO-V5 into WT mESCs and Mettl3-Flag into Gsk-3 DKO mESCs. Total RNA was isolated 48 hours after transfection and cDNA was synthesized. Quantitative PCR analysis shows that Esrrb mRNA levels stayed relatively constant after either treatment. We do see a minimal increase in Esrrb in WT with FTO (Figure 8A) and a minimal decrease in Gsk-3 DKO with Mettl3 (Figure 8B), although neither is significant. We uncovered that 48 hour overexpression is not enough time to create a large impact on gene expression. We determined that a stable cell overexpressing Mettl3 or FTO would be a more sufficient way to determine gene expression levels.
31


A
B
1.4
1.2
a 08
ce
0.6
0.4
0.2
0
WT WT + FTO
Esrrb
1
0.8
a o.6
ce
0.4
0.2
0
T
DKO OKO + Mettl3
Esrrb
Figure 8. Esrrb Gene Expression in mESCs with Overexpression of Mettl3 or FTO. (A) Esrrb expression was observed in WT and WT + FTO mESCs grown in complete ESC media with LIF addition. (B) Esrrb expression was observed in Gsk-3 DKO and Gsk-3 DKO + Mettl3 mESCs grown in complete ESC media with LIF addition.
Characterization of Axin' and Axin mESCs
Because Gsk-3 is a key component in numerous intracellular pathways, we wanted to investigate the effect of those pathways on m6A levels and FTO regulation. Gsk-3 is inhibited through activation of the Wnt and Insulin signaling pathways and both
32


pathways have also been implicated in stem cell pluripotency. We wanted to determine if activation of either the Wnt or Insulin pathways had an effect on levels of m6A in mESCs. We first wanted to look at Wnt signaling using Axin' and Axin+/' mESCs that we received from Frank Costantini, whose lab originally cloned and characterized Axin, but had not previously been characterized. Deletion of Axin would result in a constitutively active, ligand independent Wnt signaling. In order to determine if Axin was knocked out, we examined levels of P-catenin protein. Axin is a key component of the P-catenin destruction complex in the Wnt pathway, along with Gsk-3, so P-catenin protein levels should be elevated in Axin' ', similar to that of Gsk-3 DKO cells. Results from western blotting experiments indicated that P-catenin protein levels are not elevated in the Axin' and Axin+/' mESCs (Figure 9A). Expression appears to be lower than that of WT mESCs. This indicates that the P-catenin destruction complex is still intact and P-catenin is being rapidly degraded.
Next we wanted to quantify gene expression levels of a gene known to be affected directly by the Wnt pathway. Activation of the Wnt pthway elevates expression of Axin2, so we would anticipate higher levels of Axin2 in Axin'' and Axin+/' mESCs. RNA was isolated from WT, Axin' ', and Axin+/' and cDNA was synthesized. QPCR was performed and Axin2 gene expression was quantified in the Axin' and Axin+/', using WT as a control. Increases in Axin2 are moderate and are not indicative of Axin being genetically deleted (Figure 9B). These results indicate that Axin is still functioning properly and cells were not used for further experimentation. Taken together, we speculate that since the Axin' ESCs were derived more than 20 years ago, tubes may have been mislabeled and we were sent the wrong clones.
33


A
DKO Axin *A Axin+A WT
95 kD
IB: p-catcnin
50 kD
IB: a-tubulin
B
1.6 T 1.4 |
1.4 1.2 1
1.2 I 1 ]
_ 0.8 ]
0.8 S
0.6 j
0.6 0.4
0.4
0.2 0 0.2 ] 0 1
WT
Axin -/
WT
Axin +/-
AXIN 2
AXIN 2
Figure 9. Characterization of Axin7" and Axin+/" mESCs. (A) P-catenin protein expression was observed in WT, Axin' ", and Axin+/", and Gsk-3 DKO mESCs. a-tubulin western was used as a protein loading control. (B) AXIN 2 expression levels were quantified in WT, Axin' ", and Axin+/" mESCs.
34


Effect of PI3K Pathway on m6A levels
Because Gsk-3 plays an integral part in the insulin/PI3K pathway, we wanted to determine if activation of the pathway would result in an effect on m6A levels. Therefore, we wanted to quantify levels of m6A from pi 10* mESCs and WT mESCs. While Gsk-3 is fully functional in pi 10* cells, the pi 10 subunit is myristoylated, leading to constitutive activation of the insulin pathway and inhibition of Gsk-3. WT and pi 10* cells were grown without LIF for 14 days. On day 14, total RNA was isolated from both cell types and was enriched for mRNA using oligo d(T) magnetic beads. Each mRNA sample was then quantified via Quibit and 500 ng of mRNA was digested into single nucleotides using nuclease PI. Samples were sent to the Anschutz Proteomics Core and nucleotide bases were quantified via LC-MS/MS. Results indicated that there is no difference in levels of N6-methyladenosine in pi 10* cells compared to WT (Figure 10). This suggests that there is no effect of insulin signaling on m6A, therefore regulation does not likely occur through this pathway.
35


1.6
1.4
1.2
1
<
<
vO
E
S 0.8
0.6 0.4 0.2 0
pllO*
WT
Figure 10. Quantification of m6A in WT and pllO* cells. WT and pi 10*
mouse embryonic cells were cultured in complete ESC media in the absence of LIF for 14 days. On day 14, total RNA was isolated. mRNA was enriched and digested into single nucleotides. Samples were analyzed using LCMS/MS in order to quantify both N6-methyladenosine and unmethylated adenosine.
Phosphorylation of FTP
Up to this point, we have presented important evidence suggesting that Gsk-3 activity is important for regulating FTO protein levels as well as m6A levels. However, most of the evidence of a role for Gsk-3 in regulating FTO has been circumstantial. Therefore we sought to obtain more definitive evidence that FTO is phosphorylated by Gsk-3. We noted that mouse FTO contains a Gsk-3 consensus motif,
245 SCEGSEDESEDES 257, within its amino acid sequence. In addition, mass-spectrometry data revealed phosphorylation on these serine residues in mouse cells (http ://www. cell signal. com/common/content/content .j sp?id=phosphositeplus). Hence, we
36


focused on that consensus sequence as the putative Gsk-3 phosphorylation site. Since there is no phospho-specific antibody for these sites on FTO, we were unable to perform a simple western blot. Instead, we approached this question by utilizing a kit that selectively binds phosphorylated proteins to a proprietary resin, allowing for an enrichment of all phosphorylated proteins. We could then use antibodies to FTO (endogenous) or epitope tag (overexpressed) to evaluate the phosphorylation status of FTO in WT and Gsk-3 DKO ESCs.
A Phospho-Protein enrichment kit (Molecular Probes) was used to enrich for phosphorylated proteins from ESCs. We isolated total protein from WT and Gsk-3 DKO mESCs where FTO protein levels are similar (Figure 3) and subjected each lysate to phospho-enrichment (Figure 11). We also saved the flow-through for further analysis of unphosphorylated proteins. Both the enriched and flow-through samples were quantified and analyzed by western blotting (Figure 12A). Endogenous FTO is observed in both WT and Gsk-3 DKO phospho-enriched samples. We expected protein in WT due to Gsk-3 phosphorylation, but protein may be present in Gsk-3 because FTO is being primed and therefore is being phosphorylated by another kinase. We also saw FTO protein in both samples of the flow-through, although Gsk-3 DKO cells has much more robust expression of protein in the flow-through. Because the levels of endogenous FTO are low, we decided to overexpress FTO-V5 and then subject the samples to phospho-enrichment. We transfected WT and Gsk-3 DKO mESCs with FTO-V5 and isolated total protein, then performed V5 immunoprecipitation on a WT and Gsk-3 DKO sample to confirm expression. Next we performed phospho-enrichment on each sample, with untransfected WT cells used as a control. Lysates were then subjected to western blotting
37


with a V5-specific antibody (Figure 12B). For phospho-enriched samples, robust FTO was seen in WT cells, but no protein was detected in Gsk-3 DKO samples. This indicates that FTO is phosphorylated in WT mESCs, but not in Gsk-3 DKO mESCs.
We next sought to determine the precise sites of phosphorylation on FTO. Our approach was to overexpress a tagged version of FTO in WT and Gsk-3 DKO ESCs, then immunoprecipitate FTO, and perform mass spectrometry to identify phosphorylated residues. Therefore, we overexpressed FTO-V5 through PEI transfection into both WT and Gsk-3 DKO mESCs, and then immunoprecipitated FTO-V5 using V5 magnetic beads. Western blotting was performed to ensure that the FTO-V5 was being expressed and that the immunoprecipitation was accomplished successfully (Figure 13). We were then able to run protein lysates through SDS-PAGE, stain the gel using Imperial Protein Stain, and excise the band from the gel. Samples were transported to Anschutz Proteomics Core for analysis via LC/MS. Results indicated that 730 proteins were observed in the samples, therefore nonspecific binding occurred during immunoprecipitation. FTO was indeed one of the observed proteins, but we only obtained 42% coverage of the complete protein sequence in WT cells (Figure 14A), while coverage in Gsk-3 DKO ESCs was a meager 14% (Figure 14B). No phosphorylation was detected in either sample. Although we have yet to determine the precise site(s) of phosphorylation on FTO, based on LC/MS data, we can narrow down possible sites to those that were not covered, 58% of the protein. In addition, we did not obtain any coverage of the Gsk-3 consensus motif in either sample, meaning that the data does not rule out the possibility that FTO is phosphorylated by Gsk-3 on this consensus motif. Further studies will be necessary to fully test this hypothesis.
38


Figure 11. Phospho-Protein Enrichment Schematic. Phospho-enrichment enriches for all phosphorylated proteins, while unphosphorylated proteins are discarded in the flow-through.
39


A
Phospho-Enrichment Flow-Through
WT DKO WT DKO
50 kD
IB: FTO
B
V5 IP Phospho-Enrichment
WT DKO WT DKO WT FTO FTO WT FTO FTO
55 kD --- ~ . IB: V5
Figure 12. Phospho-Protein Enrichment. (A) Levels of endogenous FTO were analyzed from WT and Gsk-3 DKO mESCs from phospho-enrichment and phosphorylated depleted flow-through using an antibody specific to FTO. (B) Levels of overexpressed FTO-V5 were analyzed from WT and Gsk-3 DKO mESCs from phospho-enrichment and V5 immunoprecipitation. Untransfected WT was used as a negative control.
WT DKO
55 kD
IB: V5
Figure 13. FTO-V5 Protein Overexpression in mESCs. FTO-V5 protein expression was observed through a V5 specific antibody in WT and Gsk-3 DKO mESCs.
40


A
FTO.MOUSE (100%), 58,006.8 Da
Alpha-ketoglutarate-dependent dioxygenase FTO OS=Mus musculus GN = Fto PE=1 SV=1
17 exclusive unique peptides, 21 exclusive unique spectra, 24 total spectra, 210/502 amino acids (42% coverage)
M K R V Q T A E E R E R E A K K L R L L EEL E D T W L P Y L T P K D D E F Y Q Q WQ L K Y P K L V F R E A G S 1 PEE
LHKE V P E A F L T L H K H G C L F R D V V R 1 Q G K D V L T P V S R 1 L | G D PGCTYKY LN T R L F T V P W P V
K G C T V K Y T E A E 1 A A A C Q T F L K L N D Y L Q V E T 1 Q A L E E LAV R E KANE D A V P L C M A E F P R A G V
G P S C D D E V D L K S R A A Y N V T L L N F M D P Q K M P Y L K E E P Y F G M G K|M A V S W H H D E N L V D R S A V A
V Y S Y S C E G S E D E S E D E S S F E G R D P DTWHVG FK 1 SWD 1 E T P G L T 1 P L H Q G D C Y F M L D D L N A
T H Q H C V L A G S QPR F S S T H R V A E C S T G T L D Y 1 L E R C Q L A L Q N V L N D S D D G D V S L K S F D P A V
L K Q G E E 1 H N E V E F E W L R Q F W F Q G N RYK LCT D W W C E P M T H L E G L W K K M E S M T N A V L R E V K R
E G L P V E Q R S E 1 L SAIL V P L T V R Q N L R K E W H A R C Q S R V V R T L PVQQKPDCR P Y W E K D D P S M
P L P F D L T D V V s E L R G Q L L E A R S
B
FTO.MOUSE (100%), 58,006.8 Da
Alpha-ketoglutarate-dependent dioxygenase FTO OS-Mus musculus CN-Fto PE-1 SV-1 6 exclusive unique peptides, 7 exclusive unique spectra, 7 total spectra, 70/502 amino acids (14% coverage)
MKRVQTAEE R E R E A K K L R L L E E L EDTWL PY L T P K D D E F Y Q QWQLKYPKLV F REACS 1 PEE
LHKEVPEAF L T L H K H G C L F R D V V R 1 Q G K D V L T P V S R 1 L 1 G D P GCTYKYLN T R L F T V P W P V
KGCTVKYTE A F 1 A A A C Q T F L K L N D Y L Q V E T 1 Q A L E E L A V R E K A N E D A V P L CMAE F P R A G V
GPSCDDEVD L k S R A A Y N V T L L N F M D P Q K M P Y L K E E P Y F G M G K MAVSWHHD E N L V D R S A V A
VYSYSCEGS E DESEDESS F E G R D P D T W H V G F K 1 SWD 1 E T P G L T 1 P LHQCD C Y F M L D D L N A
THQHCV LAG S QPRFSSTHRV A E C S T G T L D Y 1 L E R c a L A L Q N V LND5DDGD V S LK S F D P A V
L K Q G E E 1 H N E V E F E W L R Q F W F Q G N R Y K L C T D WW CEP M T H L E G L W K K M E S M T N A V L R E V K R
EGLPVEQRS E | L S A 1 L V P L T V R Q NLRKEWH ARCQSR V V R T L P VQQKPDCR P Y W E KDDPSM
PLPFDLTDV V s E L RGQL L E A R S
Figure 14. FTO-V5 Protein LC MS/MS. LC/MS FTO coverage seen in (A) WT mESCs and (B) Gsk-3 DKO mESCs. Yellow highlight indicated amino acid sequence coverage.
41


CHAPTER II
DISCUSSION
Conclusions
Our data is consistent with our hypothesis that Gsk-3 contributes to the regulation of stem cell pluripotency through the regulation of FTO and subsequently, m6A mRNA modification. Due to highly similar phenotypic characteristics of Gsk-3 DKO and Mettl3 KO ESCs, we hypothesized that low levels of m6A contributes to increased stem cell pluripotency. We postulated that Gsk-3 negatively regulates the m6A modification through phosphorylation of FTO, the m6A demethylase, resulting in ubiquitination and degradation. FTO phosphorylation would result in low levels of cytoplasmic FTO, and subsequently increased levels of m6A, causing a more rapid degradation of m6A modified mRNAs in wild-type cells. Pluripotency genes with m6A modifications would be degraded through selective binding of YTHDF2, poising ESCs for differentiation. In order to maintain pluripotency in wild-type stem cells, serum and LIF must be used in culturing conditions. Alternatively, when is Gsk-3 is absent, phosphorylation is reduced and FTO levels are elevated, resulting in reduced m6A levels and increased pluripotency.
When initially looking at wild-type and Gsk-3 DKO mESCs, FTO protein levels were relatively constant. It was determined that culturing WT ESCs in the presence of LIF artificially enhanced pluripotency, therefore FTO levels remained high. Cell culturing conditions needed to be optimized in order to observe accurate FTO levels. ESCs cultured in complete ESC media in the absence of LIF for fourteen days allowed for optimal observation of FTO protein expression (developed by Jennifer Egelston, Phi el Lab). When WT and Gsk-3 DKO mESCs were grown under these optimized conditions,
42


FTO expression was greatly reduced in WT ESCs when compared to Gsk-3 DKO ESCs. This data supports our initial hypothesis that in WT ESCs, FTO protein levels are indeed regulated by Gsk-3. In addition, we looked at gene expression levels of FTO in WT and Gsk-3 DKO cells grown under optimized conditions. Levels of FTO mRNA were relatively constant, with a slight decrease seen in Gsk-3 DKO mESCs. This supports our hypothesis that the mechanism behind regulation of FTO occurs post-translationally, rather than at the transcriptional level. Furthermore, we were able to rescue FTO protein expression in WT mESCs with addition of a Gsk-3 inhibitor, supporting our hypothesis that Gsk-3 is contributing to the degradation of FTO. The addition of lOmM LiCl or 15uM SB for two days was optimal for rescue of FTO.
In order to confirm that Gsk-3 DKO cells had increased pluripotency, we compared gene expression levels of transcription factors implicated in maintaining pluripotency. We observed increased expression of Nanog, Essrb, and Oct4 in Gsk-3 DKO ESCs compared to WT ESCs, confirming that Gsk-3 DKO cells have increased pluripotency even in the absence of LIF for fourteen days (data not shown, J. Egelston, Phiel Lab).
We next wanted to quantify m6A in both WT and Gsk-3 DKO cells. Since FTO protein levels are increased in Gsk-3 DKO ESCs, we expected to observe changes in levels of m6A modifications on mRNA. Total RNA was isolated from WT and Gsk-3 DKO mESCs cultured in complete ESC media in the absence of LIF for 14 days. mRNA was enriched from total RNA using magnetic oligo dT beads. Collected mRNA was digested into single nucleotides using nuclease PI in order to perform Liquid Chromatography Tandem Mass Spectrometry (LC MS/MS). LC MS/MS data showed
43


roughly a 50% reduction in Gsk-3 DKO ESCs compared to WT ESCs, substantiating our hypothesis that inhibition of Gsk-3 results in reduced m6A mRNA methylation levels through the regulation of FTO.
To confirm that FTO is indeed being phosphorylated, we wanted to subject samples to phospho-enrichment utilizing a kit that selectively binds phosphorylated proteins to a proprietary resin. We subjected WT and Gsk-3 DKO mESCs to phospho-enrichment in order to look at endogenous FTO protein. FTO protein is observed in both WT and Gsk-3 DKO phospho-enriched samples. We believe this is due to FTO being primed by another kinase before Gsk-3 is able to phosphorylate its target. We saw a much more robust protein expression in Gsk-3 DKO flow-through, than in WT ESCs, indicating that much of the FTO protein in Gsk-3 DKO cells is unphosphorylated. We also overexpressed FTO-V5 construct in WT and Gsk-3 DKO cells and subject those samples to phospho-enrichment. For phospho-enriched samples, robust FTO was seen in WT cells, but no protein was detected in Gsk-3 DKO samples. This indicates that FTO is phosphorylated in WT mESCs, but not in Gsk-3 DKO mESCs.
Next we wanted to determine the precise residues within FTO where phosphorylation occurs. We again overexpressed FTO V5, immunoprecipitated the protein, and subjected the samples to Liquid Chromatography Tandem Mass Spectrometry (LC MS/MS). Unfortunately, only 42% of coverage of FTO was achieved in WT ESCs and only 14% in Gsk-3 DKO ESCs. Phosphorylation was not detected in WT or Gsk-3 DKO ESCs but neither sample included coverage of the Gsk-3 consensus motif. We can narrow down our phosphorylation target site to that of the 58% of
44


coverage not determined. This still leaves the Gsk-3 consensus site as possible target. Further studies will be required.
Final Words
Gsk-3 is tremendously important kinase involved in regulation of numerous intracellular pathways. Uncovering another layer of Gsk-3 complexity through understanding of the mechanism behind m6A regulation could have large impacts on current knowledge of devastating diseases. When dysregulation of Gsk-3 or m6A occurs, similar disease phenotypes are produced. FTO variants have now been associated with Alzheimers disease, independent of FTO effect on diabetes. Knockdown of FTO decreases tau phosphorylation, a protein associated with fibrillar lesions in neurodegenerative disorders (Pitman RT, 2013). Remarkably, over-activity of Gsk-3 has been shown to lead to increased P-amyloid production and inflammatory responses, hallmark characteristics of AD (Hooper et al., 2008). Gsk-3 and FTO could be working through the same pathway, ultimately affecting Alzheimers disease through mRNA methylation.
Another key disease is type-II diabetes. Overexpression of Gsk-3 increases phosphorylation and down-regulation of insulin receptor substrate-1. Inhibition of Gsk-3 helps overcome the resistance to insulin and promotes the conversion of glucose to glycogen (Eldar-Finkelman & Krebs, 1997). FTO was identified in a human GWAS study linking FTO with higher body mass index and type-II diabetes. A direct link between diabetes and FTO has yet to be determined (Loos & Yeo, 2014).
The missing link could be Gsk-3s regulation of m6A. Similar stem cell pluripotency characteristics, disease phenotypes, and supporting data have led us to the
45


conclusion that there is a strong association between FTO and Gsk-3. In-depth understanding of this mechanism could lead to potential downstream therapeutics. Our main focus as we move forward is determining the specific phosphorylation site(s) in FTO and to determine if the mechanism behind m6A is similar in humans to that observed in mouse ESCs.
46


CHAPTER III
FUTURE DIRECTIONS
Our lab has established a connection between Gsk-3 and m6A. Further characterization is still required to validate our mechanism. Our first focus is determining the specific site at which FTO is phosphorylated. We have provided evidence that indicates FTO is phosphorylated in WT mESCs and phosphorylation is lost in Gsk-3 DKO mESCs, but we have yet to provide conclusive evidence that Gsk-3 is responsible for the phosphorylation. This may be determined by attempting LC MS/MS in hopes to achieve better coverage of the FTO protein. This would show that the phosphorylation is present at the Gsk-3 consensus site in WT and absent in the Gsk-3 DKO cells.
Future directions will also include further characterization of m6A mRNAs via methyl-seq. We will use oligo d(T) beads and m6A specific antibodies to enrich for mRNAs that contain the m6A tag in WT, pi 10*, and Gsk-3 DKO mESCs. We will use methyl-seq in order to identify specific mRNAs that are affected by deletion of Gsk-3 and the myristoylation of the pi 10 subunit. This will help us to determine if known regulators of stem cell pluripotency are indeed affected by loss of Gsk-3. A better understanding of methylated genes being up-regulated or down-regulated in Gsk-3 DKO mESCs may also give us a better understanding of each components role in various disease states.
Because m6A is associated with decreased mRNA stability through selective binding of YTHDF2, our lab will perform mRNA half-life studies by treating WT and Gsk-3 DKO cells with alpha-amanitin, an inhibitor of RNA polymerase II, after removing LIF from cell media for fourteen days. In Gsk-3 DKO mESCs, where m6A is greatly reduced, mRNA half-life should be greatly increased. We will do qPCR in order to
47


evaluate levels of mRNA expression of genes known to regulate stem cell pluripotency and genes that were identified using methyl-seq. Studies have already shown that Mettl3 KO cells have roughly 30% decrease in half-life in these methylated pluripotency genes. We hope to see the same decrease in Gsk-3 DKO mESCs.
We want to precisely determine which Gsk-3 pathway is affecting levels of m6A. We will initially look at the Wnt and PI3K pathways because both pathways have also been implicated in stem cell pluripotency. Our lab will develop an Axin, a key compenent in the Wnt pathway, knockout cell line utilizing CRISPR guide RNAs specific to Axin. Characterization of Axin KO cells that we previously provided showed no increase in P-catenin protein expression and no increase in Axin2 gene expression. We concluded that Axin was still fully functional in these cells. We will then use Axin -/- and pi 10* cells, previously described, to investigate how inhibition of Gsk-3 through activation of upstream signaling events affects m6A levels in mRNA. We will work to quantify levels of m6A methylation in Axin KO cells. We did not see a change in m6A levels in pi 10*, but this pathway may still have some correlation with the regulation of m6A. Further investigation in required.
Lastly, we will look at FTO and m6A levels in different human cell types. Gsk-3 is implicated in a plethora of human diseases. Insight into levels of m6A in various human cell types could help determine if these disease states are altered by Gsk-3 inhibition and levels of m6A. We would also want to determine if the mechanism is the same in human cells. Human FTO protein lacks the same Gsk-3 consensus site, although much of the rest of the protein is conserved (87%). A single serine in the consensus site is mutated to a
48


proline. The site still provides a viable Gsk-3 target but further experiments will be imperative.
49


REFERENCES
Aberle, H., Bauer, A., Stappert, J., Kispert, A., & Kemler, R. (1997). beta-catenin is a target for the ubiquitin-proteasome pathway. EMBO J, 76(13), 3797-3804. doi: 10.1093/emboj/l 6.13.3797
Bain, J., Plater, L., Elliott, M., Shpiro, N., Hastie, C. J., McLauchlan, H., Cohen, P. (2007). The selectivity of protein kinase inhibitors: a further update. Biochem J, 408(3), 297-315. doi:10.1042/BJ20070797
Bartman, C. M., Egelston, J., Kattula, S., Zeidner, L. C., DTppolito, A., Doble, B. W., & Phiel, C. J. (2014). Gene Expression Profiling in Mouse Embryonic Stem Cells Reveals Glycogen Synthase Kinase-3-Dependent Targets of Phosphatidylinositol 3-Kinase and Wnt/beta-Catenin Signaling Pathways. Front Endocrinol (Lausanne), 5, 133. doi: 10.3389/fendo.2014.00133
Bartman, C. M., Egelston, J., Ren, X., Das, R., & Phiel, C. J. (2015). A simple and efficient method for transfecting mouse embryonic stem cells using polyethylenimine. Exp Cell Res, 550(1), 178-185. doi:10.1016/j.yexcr.2014.07.020
Batista, P. J., Molinie, B., Wang, J., Qu, K., Zhang, J., Li, L., Chang, H. Y. (2014). m(6)A RNA modification controls cell fate transition in mammalian embryonic stem cells. Cell Stem Cell, 75(6), 707-719. doi: 10.1016/j.stem.2014.09.019
Beurel, E., Grieco, S. F., & Jope, R. S. (2015). Glycogen synthase kinase-3 (GSK3): regulation, actions, and diseases. Pharmacol Ther, 148, 114-131. doi: 10.1016/j. pharmthera.2014.11.016
Burdon, T., Smith, A., & Savatier, P. (2002). Signalling, cell cycle and pluripotency in embryonic stem cells. Trends Cell Biol, 72(9), 432-438. Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/12220864
Cartwright, P., McLean, C., Sheppard, A., Rivett, D., Jones, K., & Dalton, S. (2005).
LIF/STAT3 controls ES cell self-renewal and pluripotency by a Myc-dependent mechanism. Development, 132(5), 885-896. doi: 10.1242/dev.01670
Clevers, H., & Nusse, R. (2012). Wnt/beta-catenin signaling and disease. Cell, 149(6), 1192-1205. doi: 10.1016/j.cell.2012.05.012
50


Coghlan, M. P., Culbert, A. A., Cross, D. A., Corcoran, S. L., Yates, J. W., Pearce, N. J.,
. Holder, J. C. (2000). Selective small molecule inhibitors of glycogen synthase kinase-3 modulate glycogen metabolism and gene transcription. Chem Biol, 7(10), 793-803. Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/11033082
Cross, D. A., Alessi, D. R., Cohen, P., Andjelkovich, M., & Hemmings, B. A. (1995).
Inhibition of glycogen synthase kinase-3 by insulin mediated by protein kinase B. Nature, 378(6559), 785-789. doi:10.1038/378785a0
Ding, V. W., Chen, R. H., & McCormick, F. (2000). Differential regulation of glycogen synthase kinase 3beta by insulin and Wnt signaling. J Biol Chem, 275(42), 32475-32481. doi:10.1074/jbc.M005342200
Doble, B. W., Patel, S., Wood, G. A., Kockeritz, L. K., & Woodgett, J. R. (2007). Functional redundancy of GSK-3alpha and GSK-3beta in Wnt/beta-catenin signaling shown by using an allelic series of embryonic stem cell lines. Dev Cell, 12(6), 957-971. doi:10.1016/j.devcel.2007.04.001
Doble, B. W., & Woodgett, J. R. (2003). GSK-3: tricks of the trade for a multi-tasking kinase. J Cell Sci, 77d(Pt 7), 1175-1186. Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/12615961
Dominissini, D., Moshitch-Moshkovitz, S., Schwartz, S., Salmon-Divon, M., Ungar, L., Osenberg, S., Rechavi, G. (2012). Topology of the human and mouse m6A RNA methylomes revealed by m6A-seq. Nature, 485(1291), 201-206. doi:http://www.nature.com/nature/journal/v485/n7397/abs/naturellll2 html supplementary-information
Eldar-Finkelman, H., & Krebs, E. G. (1997). Phosphorylation of insulin receptor
substrate 1 by glycogen synthase kinase 3 impairs insulin action. Proc Natl Acad Sci USA, 94( 18), 9660-9664. Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/9275179
Evans, M. J., & Kaufman, M. H. (1981). Establishment in culture of pluripotential cells from mouse embryos. Nature, 292(5819), 154-156. Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/7242681
Festuccia, N., Osorno, R., Halbritter, F., Karwacki-Neisius, V., Navarro, P., Colby, D., Chambers, I. (2012). Esrrb is a direct Nanog target gene that can substitute for
51


Nanog function in pluripotent cells. Cell Stem Cell, 77(4), 477-490. doi:10.1016/j.stem.2012.08.002
Fiol, C. J., Mahrenholz, A. M., Wang, Y., Roeske, R. W., & Roach, P. J. (1987).
Formation of protein kinase recognition sites by covalent modification of the substrate. Molecular mechanism for the synergistic action of casein kinase II and glycogen synthase kinase 3. J Biol Chem, 262(29), 14042-14048. Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/2820993
Frame, S., Cohen, P., & Biondi, R. M. (2001). A common phosphate binding site explains the unique substrate specificity of GSK3 and its inactivation by phosphorylation. Mol Cell, 7(6), 1321-1327. Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/11430833
Geula, S., Moshitch-Moshkovitz, S., Dominissini, D., Mansour, A. A., Kol, N., Salmon-Divon, M., Hanna, J. H. (2015). Stem cells. m6A mRNA methylation facilitates resolution of naive pluripotency toward differentiation. Science, 347(6225), 1002-1006. doi:10.1126/science,1261417
Gibson, D. G. (2011). Enzymatic assembly of overlapping DNA fragments. Methods Enzymol, 498, 349-361. doi:10.1016/B978-0-12-385120-8.00015-2
Graf, U., Casanova, E. A., & Cinelli, P. (2011). The Role of the Leukemia Inhibitory Factor (LIF) Pathway in Derivation and Maintenance of Murine Pluripotent Stem Cells. Genes (Basel), 2(1), 280-297. doi:10.3390/genes2010280
Grosjean, H. (2005). Fine-Tuning of RNA Functions by Modification and Editing Topics in current genetics, Retrieved from http://dx.doi.org/10.10Q7/b95147 Retrieved from http://dx.doi.org/10.10Q7/b95147
He, C. (2010). Grand challenge commentary: RNA epigenetics? Nat Chem Biol, 6(12), 863-865. doi: 10.1038/nchembio.482
Hooper, C., Killick, R., & Lovestone, S. (2008). The GSK3 hypothesis of Alzheimer's
disease. JNeurochem, 104(6), 1433-1439. doi:10.1111/j.l471-4159.2007.05194.x
Huang, H., & He, X. (2008). Wnt/beta-catenin signaling: new (and old) players and new insights. Curr Opin Cell Biol, 20(2), 119-125. doi:10.1016/j.ceb.2008.01.009
52


Ishikawa, F., Shimazu, H., Shultz, L. D., Fukata, M., Nakamura, R., Lyons, B., .
Harada, M. (2006). Purified human hematopoietic stem cells contribute to the generation of cardiomyocytes through cell fusion. FASEB J, 20(7), 950-952. doi:10.1096/fj.05-4863fje
Jansson, L., Kim, G. S., & Cheng, A. G. (2015). Making sense of Wnt signaling-linking hair cell regeneration to development. Front CellNenrosci, 9, 66. doi: 10.3389/fncel.2015.00066
Jia, G., Fu, Y., Zhao, X., Dai, Q., Zheng, G., Yang, Y., He, C. (2011). N6-
methyladenosine in nuclear RNA is a major substrate of the obesity-associated FTO. Nat Chem Biol, 7(12), 885-887. doi:10.1038/nchembio.687
Jope, R. S., Yuskaitis, C. J., & Beurel, E. (2007). Glycogen synthase kinase-3 (GSK3): inflammation, diseases, and therapeutics. Neurochem Res, 32(4-5), 577-595. doi: 10.1007/s 11064-006-9128-5
Kadonaga, J. T. (2004). Regulation of RNA polymerase II transcription by sequence-specific DNA binding factors. Cell, 116(2), 247-257. Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/14744435
Keller, L., Xu, W., Wang, H. X., Winblad, B., Fratiglioni, L., & Graff, C. (2011). The obesity related gene, FTO, interacts with APOE, and is associated with Alzheimer's disease risk: a prospective cohort study. J Alzheimer s Dis, 23(3),
461-469. doi:10.3233/JAD-2010-101068
Klein, P. S., & Melton, D. A. (1996). A molecular mechanism for the effect of lithium on development. Proc Natl Acad Sci USA, 93(16), 8455-8459. Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/8710892
Klippel, A., Reinhard, C., Kavanaugh, W. M., Apell, G., Escobedo, M. A., & Williams, L. T. (1996). Membrane localization of phosphatidylinositol 3-kinase is sufficient to activate multiple signal-transducing kinase pathways. Mol Cell Biol, 76(8), 4117-4127. Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/8754810
Korinek, V., Barker, N., Morin, P. J., van Wichen, D., de Weger, R., Kinzler, K. W., Clevers, H. (1997). Constitutive transcriptional activation by a beta-catenin-Tcf complex in APC-/- colon carcinoma. Science, 275(5307), 1784-1787. Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/9065401
53


Lee, M., Kim, B., & Kim, V. N. (2014). Emerging roles of RNA modification: m(6)A and U-tail. Cell, 158(5), 980-987. doi:10.1016/j.cell.2014.08.005
Li, F., Zhao, D., Wu, J., & Shi, Y. (2014). Structure of the YTH domain of human
YTHDF2 in complex with an m(6)A mononucleotide reveals an aromatic cage for m(6)A recognition. Cell Res, 24(12), 1490-1492. doi:10.1038/cr.2014.153
Liu, J., Yue, Y., Han, D., Wang, X., Fu, Y., Zhang, L., He, C. (2014). A METTL3-METTL14 complex mediates mammalian nuclear RNA N6-adenosine methylation. Nat Chem Biol, 10(2), 93-95. doi:10.1038/nchembio,1432
Liu, N., Dai, Q., Zheng, G., He, C., Parisien, M., & Pan, T. (2015). N(6)-
methyladenosine-dependent RNA structural switches regulate RNA-protein interactions. Nature, 575(7540), 560-564. doi:10.1038/naturel4234
Loh, Y. H., Wu, Q., Chew, J. L., Vega, V. B., Zhang, W., Chen, X., Ng, H. H. (2006). The Oct4 and Nanog transcription network regulates pluripotency in mouse embryonic stem cells. Nat Genet, 38(A), 431-440. doi:10.1038/ngl760
Loos, R. J., & Yeo, G. S. (2014). The bigger picture of FTO: the first GWAS-identified obesity gen q. Nat Rev Endocrinol, 70(1), 51-61. doi:10.1038/nrendo.2013.227
Martello, G., Sugimoto, T., Diamanti, E., Joshi, A., Hannah, R., Ohtsuka, S., Smith, A. (2012). Esrrb is a pivotal target of the Gsk3/Tcf3 axis regulating embryonic stem cell self-renewal. Cell Stem Cell, 77(4), 491-504. doi:10.1016/j.stem.2012.06.008
Meijer, L., Flajolet, M., & Greengard, P. (2004). Pharmacological inhibitors of glycogen synthase kinase 3. Trends Pharmacol Sci, 25(9), 471-480. doi:10.1016/j.tips.2004.07.006
Meredith, G. D., DTppolito, A., Dudas, M., Zeidner, L. C., Hostetter, L., Faulds, K., Phi el, C. J. (2015). Glycogen synthase kinase-3 (Gsk-3) plays a fundamental role in maintaining DNA methylation at imprinted loci in mouse embryonic stem cells. Mol Biol Cell, 26(11), 2139-2150. doi:10.1091/mbc.E15-01-0013
Meyer, K. D., Saletore, Y., Zumbo, P., Elemento, O., Mason, C. E., & Jaffrey, S. R.
(2012). Comprehensive analysis of mRNA methylation reveals enrichment in 3' UTRs and near stop codons. Cell, 149(1), 1635-1646. doi:10.1016/j.cell.2012.05.003
54


Mitsui, K., Tokuzawa, Y., Itoh, H., Segawa, K., Murakami, M., Takahashi, K., .
Yamanaka, S. (2003). The homeoprotein Nanog is required for maintenance of pluripotency in mouse epiblast and ES cells. Cell, 773(5), 631-642. Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/12787504
Murray, J. T., Campbell, D. G., Morrice, N., Auld, G. C., Shpiro, N., Marquez, R., Cohen, P. (2004). Exploitation of KESTREL to identify NDRG family members as physiological substrates for SGK1 and GSK3. Biochem J, 3H4(?\ 3), 477-488. doi: 10.1042/B J20041057
Nakagawa, M., Koyanagi, M., Tanabe, K., Takahashi, K., Ichisaka, T., Aoi, T., .
Yamanaka, S. (2008). Generation of induced pluripotent stem cells without Myc from mouse and human fibroblasts. Nat Biotechnol, 26(1), 101-106.
doi:10.1038/nbtl374
Okamoto, K., Okazawa, H., Okuda, A., Sakai, M., Muramatsu, M., & Hamada, H.
(1990). A novel octamer binding transcription factor is differentially expressed in mouse embryonic cells. Cell, 60(3), 461-472. Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/1967980
Pan, G., & Thomson, J. A. (2007). Nanog and transcriptional networks in embryonic stem cell pluripotency. Cell Res, 77(1), 42-49. doi:10.1038/sj.cr.7310125
Pan, G. J., Chang, Z. Y., Scholer, H. R., & Pei, D. (2002). Stem cell pluripotency and transcription factor Oct4. Cell Res, 72(5-6), 321-329. doi:10.1038/sj.cr.7290134
Patel, M., & Yang, S. (2010). Advances in reprogramming somatic cells to induced pluripotent stem cells. Stem Cell Rev, 6(3), 367-380. doi:10.1007/sl2015-010-9123-8
Peifer, M., Pai, L. M., & Casey, M. (1994). Phosphorylation of the Drosophila adherens junction protein Armadillo: roles for wingless signal and zeste-white 3 kinase. Dev Biol, 166(2), 543-556. doi: 10.1006/dbio. 1994.1336
Pitman RT, F. J., Stone AL, Devito JT, Puri N. (2013). FTO Knockdown Decreases Phosphorylation of Tau in Neuronal Cells; A Potential Model Implicating the Association of FTO with Alzheimers Disease. J Alzheimer s Dis Parkinsonism, 3(125). doi: 10.4172/2161-0460.1000125
55


Pomerantz, J., & Blau, H. M. (2004). Nuclear reprogramming: a key to stem cell function in regenerative medicine. Nat Cell Biol, 6(9), 810-816. doi:10.1038/ncb0904-810
Popkie, A. P., Zeidner, L. C., Albrecht, A. M., D'Ippolito, A., Eckardt, S., Newsom, D.
E., Phiel, C. J. (2010). Phosphatidylinositol 3-kinase (PI3K) signaling via glycogen synthase kinase-3 (Gsk-3) regulates DNA methylation of imprinted loci. J Biol Chem, 285(53), 41337-41347. doi:10.1074/jbc.M110.170704
Salomonis, N., Schlieve, C. R., Pereira, L., Wahlquist, C., Colas, A., Zambon, A. C., Conklin, B. R. (2010). Alternative splicing regulates mouse embryonic stem cell pluripotency and differentiation. Proc Natl Acad Sci USA, 107(23), 10514-10519. doi:10.1073/pnas.0912260107
Sanchez-Ripoll, Y., Bone, H. K., Owen, T., Guedes, A. M., Abranches, E.,
Kumpfmueller, B., Welham, M. J. (2013). Glycogen synthase kinase-3 inhibition enhances translation of pluripotency-associated transcription factors to contribute to maintenance of mouse embryonic stem cell self-renewal. PLoS One, 5(4), e60148. doi: 10.1371/joumal.pone.0060148
Sato, N., Sanjuan, I. M., Heke, M., Cichida, M., Naef, F., & Brivanlou, A. H. (2003).
Molecular signature of human embryonic stem cells and its comparison with the mouse. Dev Biol, 260(2), 404-413. Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/12921741
Smith, A. G. (2001). Embryo-derived stem cells: of mice and men. Anna Rev Cell Dev Biol, 17, 435-462. doi:10.1146/annurev.cellbio.17.1.435
Storm, M. P., Bone, H. K., Beck, C. G., Bourillot, P. Y., Schreiber, V., Damiano, T., Welham, M. J. (2007). Regulation of Nanog expression by phosphoinositide 3-kinase-dependent signaling in murine embryonic stem cells. J Biol Chem, 282(9), 6265-6273. doi: 10.1074/jbc.M610906200
Tai, C. L, & Ying, Q. L. (2013). Gbx2, aLIF/Stat3 target, promotes reprogramming to and retention of the pluripotent ground state. J Cell Sci, l26(Pt 5), 1093-1098. doi :10.1242/jcs.l 18273
Takahashi, K., & Yamanaka, S. (2006). Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. Cell, 126(4), 663-676. doi: 10.1016/j.cell.2006.07.024
56


Wang, X., Lu, Z., Gomez, A., Hon, G. C., Yue, Y., Han, D., He, C. (2014). N6-methyladenosine-dependent regulation of messenger RNA stability. Nature, 505(7481), 117-120. doi:10.1038/naturel2730
Wang, X., Zhao, B. S., Roundtree, I. A., Lu, Z., Han, D., Ma, H He, C. (2015). N(6)-methyladenosine Modulates Messenger RNA Translation Efficiency. Cell, 161(6), 1388-1399. doi: 10.1016/j.cell.2015.05.014
Weinberger, L., Ayyash, M., Novershtern, N., & Hanna, J. H. (2016). Dynamic stem cell states: naive to primed pluripotency in rodents and humans. Nat Rev Mol Cell Biol, 77(3), 155-169. doi:10.1038/nrm.2015.28
Woodgett, J. R. (1990). Molecular cloning and expression of glycogen synthase kinase-3/factor A. EMBO J, 9(8), 2431-2438. Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/2164470
Wray, J., Kalkan, T., Gomez-Lopez, S., Eckardt, D., Cook, A., Kemler, R., & Smith, A. (2011). Inhibition of glycogen synthase kinase-3 alleviates Tcf3 repression of the pluripotency network and increases embryonic stem cell resistance to differentiation. Nat Cell Biol, 73(7), 838-845. doi:10.1038/ncb2267
Wu, D., & Pan, W. (2010). GSK3: a multifaceted kinase in Wnt signaling. Trends BiochemSci, 35(3), 161-168. doi: 10.1016/j.tibs.2009.10.002
Ying, Q. L., Wray, J., Nichols, J., Batlle-Morera, L., Doble, B., Woodgett, J., Smith, A. (2008). The ground state of embryonic stem cell self-renewal. Nature, -753(7194), 519-523. doi:10.1038/nature06968
Yost, C., Torres, M., Miller, J. R., Huang, E., Kimelman, D., & Moon, R. T. (1996). The axis-inducing activity, stability, and subcellular distribution of beta-catenin is regulated in Xenopus embryos by glycogen synthase kinase 3. Genes Dev, 70(12), 1443-1454. Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/8666229
Zeng, X., Tamai, K., Doble, B., Li, S., Huang, H., Habas, R., He, X. (2005). A dualkinase mechanism for Wnt co-receptor phosphorylation and activation. Nature, 435(7069), 873-877. doi:10.1038/nature04185
Zheng, G., Dahl, J. A., Niu, Y., Fedorcsak, P., Huang, C. M., Li, C. J., He, C. (2013). ALKBH5 is a mammalian RNA demethylase that impacts RNA metabolism and mouse fertility. Mol Cell, 49(1), 18-29. doi: 10.1016/j.molcel.2012.10.015
57


Equations
Equation 1:
APPENDIX
pmoles= (mass of DNA in ng) x (1000 pg/ng)
(# of sense strand bp) x (650 Daltons)
Buffers and Reagents
LC/MS Buffer consists of 25mM of NaCl and 2.5mM ZnCh.
Cellular Mediums
N2A media consists of 50% DMEM (10% BGS, 1% Penicillin Streptomycin, 1% L-Glutamine), 50% Opti-MEM, 0.5% Pen-strep, and 0.5% L-Glutamine.
HEK293T media consists of DMEM, 10% BGS, 1% Penicillin Streptomycin, and 1% L-Glutamine.
ESC Media consists of DMEM, 15% FBS, 1% Pen-Strep, 1% L-Glutamine, 1% Sodium Pyruvate, 1% Non-essential Amino Acids. 2-mercaptoethanol (P-me) and LIF were added fresh each time (luL of 55mM P-me per lmL of media and luL ESGRO LIF per lmL media).
IDT GBlock Sequences FTO V5:
ATCATTTTGGCAAAGATGGGTAAGCCTATCCCTAACCCTCTCCTCGGTCTCGA
TTCTACGAAGCGCGTCCAGACCGCGGAGGAACGAGAGCGGGAAGCTAAGAA
ACTGAGGCTCCTTGAGGAGCTTGAAGACACTTGGCTTCCTTACCTGACCCCCA
AAGATGATGAGTTCTATCAGCAGTGGCAGCTGAAATACCCTAAACTGGTTTT
CCGAGAGGCCGGCAGCATACCAGAGGAGCTGCATAAGGAGGTCCCCGAGGC
CTTTCTCACACTGCATAAGCATGGCTGCTTGTTTCGGGACGTGGTGAGGATCC
AAGGCAAAGATGTGCTCACCCCAGTGTCTCGCATCCTCATCGGGGACCCAGG
CTGCACCTACAAGTACTTGAACACCAGACTCTTCACGGTGCCCTGGCCCGTG
AAGGGCTGC ACGGTC A AGT AC AC AGAGGCTGAGATCGCCGCTGC AT GT C AGA
CCTTCCTAAAGCTCAATGACTACCTCCAGGTGGAGACCATCCAGGCCTTGGA
AGAACTGGCTGTCAGAGAGAAGGCCAATGAAGACGCTGTGCCACTGTGCATG
GC AGAGTTCCCC AGGGCCGGCGT GGGGCCGTCCTGCGAT GAT GAAGT GGACC
TTAAGAGCAGAGCAGCCTACAACGTGACTTTGCTAAACTTCATGGATCCTCA
GAAGATGCCCTACTTGAAAGAGGAGCCCTATTTCGGCATGGGGAAGATGGCG
GT GAGCTGGC AT C ACGAT GAGA AC CTGGT GGAC AGGT C AGC CGT GGC AGT GT
ACAGCTATAGCTGCGAAGGCTCTGAGGATGAAAGTGAGGACGAGTCCAGCTT
CGAAGGCAGAGATCCTGATACTTGGCATGTTGGTTTTAAGATCTCTTGGGACA
58


TCGAGACACCAGGATTAACAATCCCTCTTCACCAGGGAGACTGCTATTTCATG
CTGGATGACCTCAATGCCACCCACCAGCACTGTGTTTTGGCTGGCTCACAGCC
TCGGTTTAGTTCCACTCACCGTGTGGCAGAGTGCTCAACAGGCACCTTGGATT
ATATCTTAGAACGCTGTCAGTTGGCGCTGCAGAATGTCCTCAATGACTCAGAC
GATGGCGACGTCTCGTTGAAATCCTTTGATCCTGCAGTTTTGAAACAAGGAG
AGGA A AT C CAT A AT GAGGT GG AGTTTGAGT GGC T GAGGC AGTTC T GGTTTC A
AGGCAATCGATACAAACTTTGCACCGATTGGTGGTGTGAGCCCATGACTCAC
CTGGAGGGGCTGTGGA AGAAGAT GGAGAGC ATGAC AAAT GCGGT GCTCCGT
GAAGTT AAAAGAGAGGGGCTCCCGGT GGAAC AA AGGAGT GAGATTCTGTCT
GCCATCCTGGTCCCGCTCACCGTGCGCCAGAACCTGAGGAAGGAGTGGCATG
CCAGGTGCCAGTCCCGAGTCGTCCGGACTTTACCAGTACAGCAGAAACCAGA
CTGCCGGCCATATTGGGAGAAGGATGACCCTTCCATGCCTCTGCCCTTTGACC
TCACAGACGTGGTTTCCGAGCTCAGAGGCCAGCTGCTGGAAGCAAGATCCTA
GAATTCCTCGAGGATA
METTL3 Flag:
ATCATTTTGGCAAAGATGGACTACAAGGATGACGACGATAAGGATTACAAGG
ATGACGACGATAAGTCGGACACGTGGAGCTCTATCCAGGCCCATAAGAAACA
GCTGGACTCGCTTCGCGAGAGATTGCAGCGGCGACGGAAGCAGGACTCTGGG
CACTTGGATTTAAGGAACCCAGAAGCGGCACTGTCCCCAACCTTCCGTAGTG
ATAGTCCCGTGCCTACTGCCCCTACCTCTAGCGGCCCTAAGCCCAGCACAAC
ATCTGTGGCCCCTGAACTAGCTACAGACCCTGAGTTAGAGAAGAAGTTGCTA
CACCACCTCTCAGATCTGGCCTTGACCTTGCCCACTGATGCTGTTTCCATCCG
TCTTGCCATCTCTACGCCAGATGCACCTGCCACTCAAGATGGGGTAGAAAGC
CTTCTCCAGAAATTTGCCGCCCAGGAGTTGATTGAGGTAAAGCGAGGTCTCCT
CCAAGATGATGCACATCCTACTCTTGTAACTTACGCTGACCACTCCAAGCTGT
CTGCCATGATGGGGGCTGTGGCAGAAAAGAAAGGTCTTGGAGAGGTAGCAG
GGACCATCGCAGGGCAGAAACGGCGTGCAGAACAGGATTTGACTACAGTGA
CCACCTTTGCCAGCTCTTTAGCATCTGGTCTGGCCTCTTCAGCATCAGAACCA
GCTAAGGAGCCGGCTAAGAAGTCAAGGAAGCACGCTGCCTCCGATGTTGATC
TGGAGATAGAAAGCCTTTTGAACCAACAGTCAACGAAAGAACAGCAGAGCA
AGAAGGTCAGTCAGGAGATCCTAGAGCTATTAAATACCACAACAGCCAAGG
AACAGTCCATTGTTGAAAAGTTTCGCTCTCGAGGTCGGGCCCAGGTGCAAGA
AT TT T GT GAT TAT GGGAC C A AGGA AGAGT GC AT GA A AGC C AGT GAC GC T GAC
CGGCCTTGTCGCAAGCTGCACTTCAGACGAATTATCAATAAGCACACTGATG
AATCTTTAGGTGACTGCTCTTTCCTTAACACATGTTTCCACATGGACACCTGC
AAATATGTTCACTATGAAATTGATGCTTGTGTTGATTCTGAGAGTCCTGGCAG
C AAGGAGC AT AT GCC A AGCC AGGAGCTTGCTCTT AC AC AG AGT GTT GGGGGT
GACTCCAGTGCTGATCGACTCTTTCCACCTCAGTGGATCTGTTGTGATATCCG
CTACCTGGACGTCAGTATCTTGGGCAAATTTGCAGTTGTGATGGCTGACCCAC
CTTGGGATATTCACATGGAGCTACCGTATGGGACATTAACAGATGATGAGAT
GCGCAGGCTCAATATACCAGTGCTACAGGATGACGGCTTTCTTTTCCTCTGGG
T C AC AGGAAGGGCC AT GGAATTGGGC AGAGAAT GTCTGAACCTCTGGGGTT A
T GA AC GGGT GG AT GA A AT C AT C T GGGT GA AG AC T A AT C AGC T GC AGC GC AT C
ATTAGGACGGGCCGGACGGGTCACTGGTTAAACCACGGGAAGGAACACTGCT
59


TGGTTGGTGTTAAGGGAAATCCTCAAGGATTCAACCAGGGCCTGGACTGCGA
TGTGATTGTAGCTGAGGTTCGTTCCACCAGTCATAAACCAGATGAAATATATG
GCATGATTGAGAGACTGTCCCCTGGCACCCGCAAGATTGAGTTATTTGGACG
ACCACACAATGTGCAGCCCAACTGGATTACTCTTGGAAACCAACTGGATGGG
ATACACCTACTAGACCCAGATGTGGTTGCCAGGTTTAAGCAAAGGTATCCGG
ACGGCATCATCTCTAAACCTAAGAATTTATAGAATTCCTCGAGGATA
FTO V5 S259 271A:
ATCATCCTCGCAAAAATGGGCAAGCCCATACCCAATCCACTCCTGGGTCTGG
ACTCAACTAAGCGGGTACAAACCGCAGAGGAGCGCGAAAGAGAAGCCAAAA
AGCTGCGATTGCTTGAGGAGCTCGAAGACACCTGGCTCCCCTATCTTACCCCA
AAGGACGATGAGTTCTATCAACAGTGGCAACTCAAGTATCCCAAACTCGTGT
TTCGAGAGGCCGGAAGTATCCCAGAAGAACTCCACAAAGAAGTACCTGAGG
CTTTTCTTACTCTTCACAAACATGGATGCCTGTTCAGGGACGTGGTAAGGATA
CAAGGTAAAGATGTTCTTACACCAGTATCTCGCATCCTCATCGGTGATCCAGG
TTGTACCTACAAATACCTCAACACAAGACTCTTCACCGTGCCCTGGCCCGTGA
AGGGAT GT ACT GT A A A AT AC AC AG AGGC C GAG AT AGC AGC T GC TT GT C AG AC
ATTCTTGAAGTTGAACGATTACCTTCAAGTCGAAACCATCCAAGCACTGGAA
GA AC T GGC C GT T C GGGAG A AGGC A A AC GA AG AT GC C GT AC CAT T GT GT AT GG
CTGAATTTCCCCGAGCCGGTGTGGGTCCAAGTTGCGATGATGAGGTTGATCTT
AAGTCCCGCGCAGCTTATAATGTGACTCTCCTCAATTTCATGGACCCTCAGAA
AATGCCATATCTTAAGGAGGAACCCTATTTTGGAATGGGGAAAATGGCCGTC
AGTTGGCATCACGATGAGAATTTGGTCGATCGATCCGCTGTAGCAGTCTACA
GCT AT GCCTGT GAGGGAGC AGAGGACGAAGCTGAGGATGAAGC ATCCTTT GA
AGGTCGCGATCCCGATACATGGCATGTTGGTTTCAAGATAAGTTGGGACATT
GAGACTCCAGGGCTTACTATCCCCCTGCACCAGGGGGACTGTTATTTTATGCT
GGATGATTTGAATGCAACCCACCAACACTGCGTCCTTGCAGGATCCCAGCCA
CGGTTCTCATCAACTCATCGAGTAGCCGAGTGCTCTACCGGCACACTTGATTA
CATTCTTGAGAGATGTCAGCTGGCACTTCAGAACGTTCTTAACGACAGCGAT
GATGGAGACGTAAGCTTGAAGTCTTTCGACCCTGCCGTGCTTAAGCAGGGTG
AAGAGATACACAATGAGGTTGAGTTTGAATGGTTGAGGCAATTCTGGTTTCA
AGGAAACCGCTACAAGCTGTGTACAGACTGGTGGTGTGAGCCTATGACTCAT
CTGGAGGGACTGTGGAAAAAAATGGAATCTATGACTAACGCAGTGCTCCGAG
AAGTAAAGAGGGAAGGGTTGCCAGTGGAACAACGATCTGAGATTCTGTCCGC
TATTCTCGTACCCCTTACCGTAAGGCAGAATTTGCGAAAAGAATGGCACGCT
AGGTGTCAGTCCCGCGTTGTGCGAACACTTCCCGTCCAGCAGAAACCTGACT
GTAGGCCTTACTGGGAGAAGGACGACCCATCCATGCCTCTGCCATTCGATCT
GACAGACGTGGTATCTGAATTGAGGGGCCAGCTTCTGGAGGCCCGCTCCTAG
AACTCCTCTAGGATA
60


Full Text

PAGE 1

REGULATION OF m 6 A mRNA METHYLATION AND STEM CELL PLURIPOTENCY THROUGH GSK 3 by KELSIE JO FAULDS B.S., Indiana University Purdue University Indianapolis, 2013 A thesis submitted to the Faculty of the Graduate School of the University of Colorado in partial fulfillment of the requirements for the degree of Master of Science Integrative Biology Program 2016

PAGE 2

ii 2016 KELSIE JO FAULDS ALL RIGHTS RESERVED

PAGE 3

iii This thesis for the Master of Science degree by Kelsie Jo Faulds has been approved for the Integrative Biology Program by John Swallow, Chair Christopher Phiel, Advisor Amanda Charlesworth Xiaojun Ren July 30 th 2016

PAGE 4

iv Faulds, Kelsie Jo (M.S., Biology) Regulation of m 6 A mRNA Methylation and Stem Cell Pluripotency through GSK 3 Thesis directed by Assistant Professor Christopher Phiel. ABSTRACT Glycogen Synthase Kinase 3 (Gsk 3) is a critical serine/threonine kinase known to regulate a diverse array of cellular functions including gene expression, cell differentiation, and cellular proliferation. Two different isoforms are present in mammalian ce lls Gsk 3 and Gsk 3 ", and they are almost exclusively negative regulator s through phosphorylation of their target substrates. Two key pathways known to be affected by Gsk 3 activity are the insulin and Wnt signaling pathways. Both pathways are constituti vely active in Gsk 3 / ; Gsk 3 # / embryonic stem cells ( ESCs). These mouse ESCs deficient in Gsk 3 have been shown to remain in a pluripotent state capable of indefinite self renewal, even in the absence of leukemia inhibitory factor (LIF). Gsk 3 inhibit ion has also been shown to promote the formation of induced pluripotent stem cells (iPSCs). N 6 methyladenosine ( m 6 A ) is the methyl ation of adenosine at the nitrogen 6 position, and is the most abundant internal mRNA modification. Although it was discovered more than forty years ago, very little is know about the function and regula tion of this modification. A n RNA methyltransferase, Mettl3, and an RNA demethylase, FTO, have been discovered recently, showing that the m 6 A modification s are both dyna mic and reversible. It was also revealed that ESCs lacking Mettl3 remain in a highly pluripotent state and are unable to undergo differentiation suggesting that m 6 A

PAGE 5

v also plays a key role in stem cell pluripotency The phenotypic similarities between Gsk 3 / Gsk 3 # double knockout (DKO) ESCs and Mettl3 / ESCs, led us to hypothesize that Gsk 3 is play ing a direct role in the regulation of m 6 A. A direct connection between Gsk 3 and the m 6 A modification on mRNA would have profound consequences for understanding how different Gsk 3 dependent signaling pathways regulate the balance between pluripotency and differentiation in embryonic stem cells. The form and content of this abstract are approved. I recommend its publication. Approved: Christopher Phiel

PAGE 6

vi TABLE OF CONTENTS CHAPTER I. INVOLVEMENT OF GSK 3 IN M 6 A REGULATION .. .1 Gsk 3 Overview.... ... ..1 Pluripotency in Mouse Em bryonic Stem Cells4 Effect of LIF on Stem Cell Pluripotency .....6 Effect of Gsk 3 Inhibition on St e m Cell Pluripotency.....7 m 6 A mRNA Modification .. 7 N 6 methyladenosine ( m 6 A ) mRNA modification effect on stem cell pluripotency .9 Specific Ai ms...10 Quantify levels of m 6 A methylation in wild type .10 Involvement of Gsk 3 in F TO Phosphorylation....10 Materials and Methods.10 Observing Prote in Expression 10 Protei n Isolation.10 West er n Blotting11 Overexpression of FTO and Mettl3 in Mammalian Cells .12 Gibson Assembly Cloning.12 N2A and HEK293T Mammalian Cell Transfection..14 mESC Tran sfection using PEI...15 Quantification of m 6 A in Mamm alian Cells via LCMS/MS.16 RNA Isolation16

PAGE 7

vii mRNA Enrichment 16 mRNA Digestion ...17 Do t Blot..17 Quantification of Endogenous FTO and Mettl3 18 RNA Isolation18 cDNA Synthesis .18 qPCR ..18 Detection of F TO Phosphorylation in Mammalian Cells .. 19 Overexpre ss ion of FTO V5...19 V5 Immuno precipitation19 Protein Stai ning and LCMS/MS20 Phosphoprot e in Enrichment...20 Result s..20 Over Expression of FTO and Met tl3 in Mammalian Cells...21 Levels of Endogenous FTO in Mammalian Cells..24 Effect of Gsk 3 Inhibition on FTO Protein Expression .27 Quantification of m 6 A levels in mESCs ... .29 Effect of Mettl3 and FTO Overexpression on Pluripotency Genes in mESCs...31 Characterization of Axin / and Axin +/ mESCs .32 Effect of PI3K Pathway on m 6 A levels .35 Phosphoryla tion of FTO36 II. DISCUS SION ..42

PAGE 8

viii Conclusi ons ..42 Final Words45 III. FUTURE D IRECTIONS.47 REFEREN CES50 APPENDIX ..58 A. Equatio ns..58 B. Buffer Reagents ...58 C. Cellular M ediums .58 D. IDT g Block Sequences. ...58

PAGE 9

ix LIST OF FIGURES Figure 1. Verification of Successful Gibson Assembly Cloning ..23 2. Verification of Plasmid Expression in Mous e Embryonic Stem Cells..24 3. FTO Protein Expression in WT and Gsk 3 DKO m ESCs Cultured in Complete ESC Media i n the Presence of LIF .26 4. FTO Expression in m ESCs Cultured in Complete ESC Medi a in the Absence of LIF for 14 D ays .26 Figure 5 FTO Gene Expression in m ESCs Cultured in Complete ESC Medi a in the Absence of LIF for 14 D ays ...27 Figure 6 Effect of Gsk 3 Inhibition on FTO Protein Expression in WT ESCs 29 Figure 7 Quantification of m 6 A in WT and Gsk 3 DKO cells.30 Figure 8. Esrrb Gene Expression in m ESCs with Overexpression of Mettl3 or FTO ...32 Figure 9. Characterization of Axin / and Axin +/ mESCs..34 Figure 10 Quantification of m 6 A in WT and p110* cells.36 Figure 11 Phospho Protein Enrichment Schematic..39 Figure 12 Phospho Protein Enrichment40 Figure 13 FTO V5 Protein Overe xpression in m ESCs .40 Figure 14 FTO V5 Protein LC MS/MS... .41

PAGE 10

x LIST OF ABBREVIATIONS 3' UTR 3' Untranslated Region AGi Ascorbic Acid and a Gsk 3 inhibitor supplement Alkbh5 AlkB Homolog 5 APC Adenomatous Polyposis Coli BMP2 Bone Morphogenetic Protein 2 BMP4 Bone Morphogenetic Protein 4 BPD Bipolar Disorder CKI! Casein Kinase I alpha Erk1 Extracellular Regulated Kinase 1 Erk2 Extracellular Regulated Kinase 2 ESC Embryonic Stem Cells Esrrb Estrogen Related Receptor Beta FGF4 Fibroblast Growth Factor 4 FTO Fat Mass and Obesity Associated Protein GFP Green Fluorescence Protein Gsk 3 Glycogen Synthase Kinase GWAS Genome Wide Associati on Study DEPC Diethylpyrocarbonate DKO Double Knockout DMEM Dulbecco's Modified Eagle Medium HEK293T Human Embryonic Kidney Cells hESC Human Embryonic Stem Cells

PAGE 11

xi HOTAIR HOX Transcript Antisense RNA iPSC Induced Pluripotent Stem Cells Klf4 KrŸppel like factor 4 LC MS/MS Liquid Chromatography Tandem Mass Spectrometry LiCl Lithium LIF Leukemia Inhibitory Factor LNC RNA Long non coding RNA KO Knockout m 6 A N 6 methyladensin e m 6 A seq N 6 methyladensin e sequencing MEK Mitogen Activated and Extracellu lar Regulated Kinase Kinase mESC Mouse Embryonic Stem Cells Mettl3 Methyl Transferase like 3 miRNA MicroRNA mRNA messenger RNA N2A Neuroblastoma Cells ncRNA Non coding RNA NSC Neural Stem Cells Opti MEM Minimum Essential Media p110* Myristoylated for m of p110 subunit PBS Phosphate Buffered Saline PEI Polyethylenimine PI(3,4,5)P3 Phosphatidylinositol 3, 4, 5 triphosphate

PAGE 12

xii PI3K Phosphatidylinositol 3 Kinase qPCR Quantitative PCR RIP RNA Immunoprecipitation rRNA Ribosomal RNA snoRNA Small Nucleolar RNA SNP Single Nucleotide Polymorphism STAT3 Signal Transducer and Activator of Transcription 3 Tcf3 T cell factor 3 TdT Terminal Deoxynucleotidyl Transferase tRNA Transfer RNA YTHDF2 YTH Domain Family 2

PAGE 13

1 CHAPTER I INVOLVEMENT OF GSK 3 IN REGULATION OF m 6 A DEMETHYLASE, FTO Gsk 3 Overview Glycogen Synthase Kinase 3 (Gsk 3) is a kinase that is a key component in numerous intracellular pathways, with over 100 known substrates (Beurel, Grieco, & Jope, 2015) It is a highly conserved proline directed serine/threonine protein kinase (Hooper, Killick, & Lovestone, 2008) th at has two different isoforms, Gsk 3 and Gsk 3 ", shown to regulate diverse cellular functions (Wu & Pan, 2010) such as structure, gene expression, mobility, and ap optosis (Jope, Yuskaitis, & Beurel, 2007) Gsk 3 and Gsk 3 are encoded by two independent ge nes (Woodgett, 1990) yet have highly similar kinase domains (98% identity) (Doble, Patel, Wood, Kockeritz, & Woodgett, 2007) These isoforms exhibit functional redundancy in most pathways; each isoform is able to compensate for absence of the ot her (Bartman et al., 2014; Huang & He, 2008) T ypically a negative regulator Gsk 3 is rare among kinases in that it is constitutively active in its basal state, and is ubiquitously expressed. Both Gsk 3 and Gsk 3 have a preferred consensus phosphorylation motif of S/T X X X S/T (Fiol, Mahrenholz, Wang, Roeske, & Roach, 1987) Most Gsk 3 substrates require pre phosphorylation of target substrates at a carboxy terminal serine or threonine before Gsk 3 phosphorylates the target substrate (Hooper et al., 2008) Gsk 3 is widely expressed and highly acti ve in resting cells but is inhibited in response to cellular signals, such as hormones and growth factors (Doble et al., 2007) Gsk 3 itself is regulated by four key mechanisms: phosphorylation, subcellular localization, formation of protein complexes containing Gsk 3, and the phosphorylation

PAGE 14

2 state of Gsk 3 target substrates (Jope et al., 2007) Inhibition or genetic deletion of Gsk 3 isoforms leads to changes in gene expression (Bartman et al., 2014) alterations in DNA methylation (Meredith et al., 2015) and c hanges in stem cell pluripotency (Sanchez Ripoll et al., 2013) The involvement of Gsk 3 in the Wnt and insulin signaling pa thways has been well established (Cross, Alessi, Cohen, Andjelkovich, & Hemmings, 1995; Peifer, Pai, & Casey, 1994; Yost et al., 1996) In Gsk 3 # / # ; Gsk 3 # # / # mouse embryonic stem cells (mESCs), both pathways are constitutively active and ligand independent (Doble et al., 2007) In the insulin signaling pathway, insulin binding its receptor activates phosphoinositol 3 kinase ( PI3K ) which in turn activates Akt (Ding, Chen, & McCormick, 2000) Akt then phosphorylates serine 21 and serine 9 in free cytoplasmic Gsk 3 and Gsk 3 (Cros s et al., 1995; Klippel et al., 1996) respectively, and these phosphorylated amino termini fold back and inhibit Gsk 3 kinase activity by acting as a pseudosubstrate (Frame, Cohen, & Biondi, 2001) This results in de phosphorylation of downstream substra tes and elicits an increase in glycogen and protein synthesis (Doble & Woodgett, 2003) Gsk 3 also has a pivotal role in Wnt signaling, being a key component of the multi protein catenin destruction complex (Clevers & Nusse, 2012) In the absence of Wnt, Gsk 3 is active and able to keep cytoplasmic catenin at low levels through phosphorylation. Once phosphorylated by the destruction complex comprised of Axin, Gsk 3, CKI!, and APC catenin is ubiquitinated and targeted for degradation by the proteasome (Aberle, Bauer, Stappert, Kispert, & Kemler, 1997) When Wnt binds its receptor, Frizzled, Gsk 3 is physicall y displaced from the destruction complex (Zeng et

PAGE 15

3 al., 2005) catenin is able to accumulate and translocate to the nucleus, leading to association with LEF/TCF family of DNA binding proteins (Korinek et al., 1997) and the transcriptio n of Wnt target genes (Jansson, Kim, & Cheng, 2015) The inhibition of Gsk 3 relieves the suppression of these target genes (Wu & Pan, 2010) Gsk 3 dysregulation has been found to be associated with various disease states, such as obesity, inflammation, neurological disorders, neurodegenerative disorders and diabetes (Wu & Pan 2010) Therefore, inhibiting or knocking out Gsk 3 will help provide insight into the precise role for Gsk 3 in these diverse diseases. Therefore, it is not surprising that several Gsk 3 small molecule inhibitors have been discovered, and are used to probe the biological function of Gsk 3, although none of these inhibitors can discriminate between the two isoforms (Coghlan et al., 2000) Examples of commonly used inhibitors include lithium chloride (LiCl), SB 415286 and CHIR99021. SB 415286 and CHIR99021 inhibit Gs k 3 through ATP competition (Bain et al., 2007; Coghlan et al., 2000; Murray et al., 2004) while LiCl functions by displacing magnesium, a required cofactor for Gsk 3 function (Klein & Melton, 1996) It is noted that LiCl has been a common treatment for bipolar disorder for over 60 years (Meijer, Flajolet, & Greengard, 2004) yet it remains to be determined whether the therapeutic effects of lithium are due to Gsk 3 inhibition or a Gsk 3 independent mechanism. While small molecule inhibitors are wide ly used to probe the function of Gsk 3, no small molecule is specific, raising the possibility of off target and dose dependent effects, making the interpretation of data more difficult. For this reason, our lab has used a variety of methods that rely on either genetic deletion of Gsk 3 or tonic inhibition of Gsk 3 via the ectopic activation of specific signaling pathways. For example, stable

PAGE 16

4 expression of the p110! catalytic subunit of PI3K (termed p110*) in wild type mouse ESCs leads to the phosphorylati on and inhibition of Gsk 3 and constitutive activation of the insulin signaling pathway (Popkie et al., 2010) Gsk 3 double knockout ( Gsk 3 # / # ; Gsk 3 # # / # ) mouse embryonic stem cells (Doble et al., 2007) allow for more effective downstream functional studies without the potential for off target inhibitor effects. Pluripotency in Mouse Embryonic Stem Cells Mouse embryonic stem (ES) cells are derived from the inner cell mass (ICM) of pre implantation blastocysts (Evans & Kaufman, 1981) and are characteristically pluripotent; each cell has the capability to differentiate into all cell types derived from the three embryonic germ layers: ectoderm, mesoderm, and endoderm (Burdo n, Smith, & Savatier, 2002; G. J. Pan, Chang, Scholer, & Pei, 2002) ESCs are capable of indefinite self renewal in vitro under appropriate culturing conditions (G. Pan & Thomson, 2007) Given the ability of pluripotent stem cells to differentiate into virtually any cel l type, intense research efforts have been focused on somatic cell reprogramming and its potential in the treatment of many devastating diseases (Salomonis et al., 2010) Despite these efforts, there remain holes in our knowledge about the precise mechanisms involved in maintaining stem cells in a pluripotent state (G. Pan & Thomson, 2007) Development of the embryo is controlled by coordinated action of signaling pathways, extrinsic factors, and transcription factors (Sanchez Ripoll et al., 2013) Somatic cell reprogramming has previously been accomplished by nuclear transfer into oocytes (Pomerantz & Blau, 2004) or by fusion with ES cells (Ishikawa et al., 2006) This indicated that embryonic cells contained factors that could confer pluripotency to

PAGE 17

5 somatic cells (Patel & Yang, 2010) In a seminal series of experiments, Takahashi & Yamanaka demonstrated that overexpression of specific transcription factors (Oct4, Sox2, Klf4, c Myc) are capable of reverting differentiated cells into stem cells, termed induced pluripotent stem cells (iPSCs) ( (Nakagawa et al., 2008; Takahashi & Yamanaka, 2006) Transcription factors activate or repress expression of downstream genes when exposed to environmental and developmental signals (Kadonaga, 2004) These cells exhibit the characteristic cell surface markers, express the same genes, and have the same differentiation potential as ES cells (Takahashi & Yamanaka, 2006) The so called Yamanaka factors (Oct4, Sox2, Klf4, c Myc), have been studied in depth to better understand how they act as master regulators of pluripotency. Oct4, also known as Oct3, is a member of the POU (Pit Oct Unc) transcript ion factor family and is expressed almost exclusively in ES cells (Okamoto et al., 1990) Oct4 often binds in partnership with Sox 2. Studies show that Oct4, Sox2, and Nanog, another transcription factor shown to promote pluripotency (Mitsui et al., 2003) bind to many of the same promoter sequences and target common core signaling pathways that are int ricately connected in governing pluripotency (Loh et al., 2006) One key transcriptional target of Nanog is Esrrb (Estrogen Related Receptor ) (Festuccia et al., 2012) Esrrb is required for suppressing different iation and lies downstream of Gsk 3 and Tcf3 (Martello et al., 2012) These transcription factors and networks work synergistically in a highly regulated manner to control and maintain stem cell pluripotency. Effect of LIF/STAT Pathway on Stem Cell Pluripotency Under early commonly used cell culturing conditions, ES cells tended to spontaneously differentiate rather than undergo continuous self renewal. Leukemia

PAGE 18

6 inhibitory factor (LIF) was discovered to be a key factor that could promote the maintenance of self renewal of m ouse ES cells in vitro (G. Pan & Thomson, 2007) LIF is a member of the interleukin 6 cytokine family and binds to a heterodimeric receptor, consisting of the LIF receptor and gp130. Binding of LIF to its receptor activates downstream signaling pathways thr ough gp130, such as STAT3 (signal transducer and activator of transcription 3), PI3K, and Ras/Erk pathways (Cartwright et al., 2005) Activation of the STAT3 pathway leads to dimerization and translocation of STAT3 into the nucleus, where it binds promoters and enhancers of target genes (Graf, Casanova, & Cinelli, 2011) When the STAT3 pathway is disrupted, ES c ells undergo differentiation. Alternatively, artificial activation of the STAT3 pathway can maintain self renewal of ES cells, even in the absence of LIF (Tai & Ying, 2013) The LIF/STAT3 signaling pathway is one of the only known pathways involved in m ESC pluripotency (Smith, 2001) However, this pathway is expendable in ES cells before gastrulation, suggesting other signaling cascades are vital for ESC renewal (Sato et al., 2003) Both the activation of the STAT3 and the PI3K pathway positively regulates self renewal. Alternatively, the activation of the Ras/Erk pathway leads to ES cell differentiation into endoderm lineage. As LIF activates all three pathways, b alance must be fine tuned in order to achieve LIF mediated maintenance of ESC self renewal (Storm et al., 2007) LIF is often supplemented with Bone Morphogen et ic Protein 2 or 4 (BMP2/4) in culture medium to better sustain pluripotency (Sanchez Ripoll et al., 2013) Effect of Gsk 3 Inhibition on Stem C ell Pluripotency Inhibition of Gsk 3 has also been shown to enhance and sustain stem cell pluripotency (Sanchez Ripoll et al., 2013) It was discovered that simultaneous inhibition

PAGE 19

7 of Gsk 3 and mitogen activated protein kinase kinase ( MEK, also known as MAPKK), was sufficient to achieve ground state pluripotency. The combination of these two inhibitors was deemed the 2i cocktail (Ying et al., 2008) Furthermore, mESCs that are devoid of both Gsk 3 isoforms are resistant to differentiation (Doble et al., 2007; Sanchez Ripoll et al., 2013) Two signaling pathways regulated by Gsk 3 activity, Wnt (Wray et al., 2011) and insulin (Sanchez Ripoll et al., 2013) have both been implicated in the maintenance of stem cell pluripotency, yet the precise role for Gsk 3 in these pathways remains unclear. N 6 methyladenosine mRNA modification There are over 100 known RNA nucleotide modifications, many of which play important regulatory roles, similar to that of dynamic DNA and protein modifications (He, 2010) N 6 methyladensoine (m 6 A) is the methylation of the N 6 position of adenosine and is a post transcriptional mRNA modification (Grosjean, 2005) It is the most abundant and dynamic internal eukaryotic mRNA modification. m 6 A is roughly 0.1% 0.4% of total adenosine residues in mRNA (Meyer et al., 2012) Through m 6 A seq, it was revealed that m 6 A modifications cluster around the stop codon, within long internal exon s (Dominissini et al., 2012) and within the 3' untranslated region (Meyer et al., 2012) m 6 A seq was performed using a human hepatocellular carcinoma cell line and identified roughly 12,000 m 6 A sites within 7,000 coding genes and 250 non coding; conversely, many transcripts were com pletely devoid of m 6 A (Dominissini et al., 2012) m 6 A is highly evolutionarily conserved between the mouse and human, with many of the same orthologous mRNAs methylated, suggesting important biological function fo r m 6 A modification (Dominissini et al., 2012)

PAGE 20

8 The addition of m 6 A is catalyzed by Mettl3 (methyl transferase like 3) and Mettl14 (Lee, Kim, & Kim, 2014) which are components of a larger meth yltransferase complex (J. Liu et al., 2014) ; Mettl3 is believed to be the primary catalytic component of this complex. The m 6 A modification is reversible, and is regulated by RNA demethylases. Two m 6 A demethylases have been identified, FTO and Alkbh5 (Jia et al., 2011; Zheng et al., 2013) FTO, the fat mass and obesity associated protein, was one of the first genes identified via a genome wide association study (GWAS) to contain a single nucleotide polymorphism (SNP ) associated with o besity in humans (Loos & Yeo, 2014) SNPs in the first intron a re associated with increased bo dy mass index and increased risk for diabetes (Keller et al., 2011) The association is thought to be mediated by insulin signaling, but the true mechanism still remains largely unknown. It has also not been explained whether aberrant m 6 A levels result from the presence of the SNP associated with obesity. Four out of five YTH domain family proteins have been confirmed for the selective binding of the m 6 A modification through a conserved hydrophobic pocket (Li, Zhao, Wu, & Shi, 2014) YTHDF2 was one of the first proteins found to recognize and bind m 6 A (Wang et al., 2014) Binding of YTHDF2 has been shown to regulate RNA decay through localization of the methylated mRNAs to the P bodies, where mRNA is then degraded (Wang et al., 2015) Knockdown of YTHDF2 results in roughly a thirty percent increase in mRNA half life of methylated targets when c ompared to non targets (Wang et al., 2014) This could serve to adjust the expression of regulatory genes. YTHDF1 directly promotes translation of m 6 A mRNAs (Wang et al., 2015) m 6 A has also been shown to alter the local structure of mRNA and long noncoding RNA

PAGE 21

9 ( lncRNA ) It has been shown to be essential for development and cell viability, yet its mechanisms are still poorly understood (N. Liu et al., 2015) N 6 methyladenosine ( m 6 A ) mRNA modification effect on stem cell pluripotency Thousands of mRNAs show conserved m 6 A modifications, including those encoding transcription factors required for maintaining pluripotency. mRNAs encoding Na nog, Klf4, and Myc all contain m 6 A tags (Batista et al., 2014) Methylatio n of these transcription factor encoding mRNAs could lead to a reduced mRNA half life. Mettl3 was recently identified as a regulator of termi nation of na•ve pluripotency through a small interfering RNA screen (Geula et al., 2015) In pre implantation embryos, pluripotent stem cells are referred to as 'naive', and they become 'primed' during post implantation development through activation of differentiation markers and repression of pluripotency genes (Weinberger, Ayyash, Novershtern, & Hanna, 2016) Genetic deletion of Mettl3 leads to severe decrease of m 6 A (Batista et al., 2014) After being grown in differentiation media for twenty one days, Mett l3 / mESCs failed to up regulate developmental markers and repress pluripotency genes, such as Nanog and Esrrb (Geula et al., 2015) Furthermore, differentiation defects could be rescued through introduction of WT Mettl3 allele (Batista et al., 2014) This suggests that levels of m 6 A dynamically effect stem cell pluripotency. Specific Aims The main objective of this research project is to study the relationship between Gsk 3 and stem cell pluripotency by a novel mechanism: the regulation of the N 6 methyladenosine ( m 6 A ) modification on mRNA. We postulate that the m 6 A modification is regulated by Gsk 3 through phosphorylation of the protein FTO. FTO is a known m 6 A

PAGE 22

10 demethylase and when phosphorylated, the protein would be marked for ubiqutination and degradation. This is m echanistically similar to the role of Gsk 3 in the regulation of catenin. Inhibition of Gsk 3 would result in accumulated FTO protein levels, leading to reduced m 6 A levels and increased stem cell pluripotency. Identifying the regulatory role of m 6 A and FTO through Gsk 3 may provide a strong mechanistic understanding of the involvement of Gsk 3 in stem cell differentiation. Involvement of Gsk 3 in m 6 A Regulation Aim #1: Quantify levels of m 6 A methylation in wild type and Gsk 3 DKO mouse embryonic st em cells using liquid chromatography, mass spectrometry. Aim #2: Determine phosphorylation status of FTO through liquid chromatography, mass spectrometry and phosphoenrichment. Materials and Methods Observing Protein Expression: Protein Isolation 1. Cel l media was removed with vacuum and ce lls were washed with 500ul 1x PBS. 2. Cells were lysed with 350ul IP lysis buffer with 1% NP 40 and Sigma Protease Inhibitor Cocktail at 1:1000 using rubber policeman. 3. Lysates were incubated on ice for 30 minutes, vortexi ng thoroughly every 10 minutes. 4. Lysates were centrifuged at 14,000 RPM for 15 minutes at 4 ¡ C in order to pellet cellular debris. 5. Supernatant was transferred to a fresh microcentrifuge tube, u sed immediately, or stored at 2 0 ¡ C.

PAGE 23

11 Western Blotting For FTO westerns, nitrocellulose membrane was blocked in 5% milk/TBST for 1 hour at room temperature while rocking Primary FTO antibody (PhosphoSolutions Reference#: 597 FTO) was added to the membrane at 1:1000 in 10mL of 1% milk/TBST. Membrane was incubated in primary antibody overnight at 4¡C while rocking Membrane was then washed with TBST (1x for 1 5 min and 2x for 5 min) and Anti Mouse sec ondary antibody (GE Healthcare Reference #: NA931V) was added at 1:1 0,000 in 10mL of 1% milk/TBST for 30 minutes at room temperature while rocking. Membrane was washed with T BST (3x for 5 minutes) and then ECL (Amersham ECL) was added to membrane for 5 minutes. Membrane w as blotted dry and then imaged on ChemiDoc XRS+ (Biorad). For t ubulin westerns, membrane was blocked in 4% BSA/TBST for 1 hour at room temperature while rocking Primary t ubulin antibody (Cell Signaling Reference#: A11126) was added at 1:1000 in 10mL of 4% BSA/TBST. For secondary antibody, Anti Mouse was added at 1: 20,000 in 10mL of 4% BSA/TBST. Similar procedure was followed as used in FTO westerns. For Gsk 3 !/" westerns, membrane was blocked in 5% BSA/TBST for 1 hour at room temperature while rocking Primary Gsk 3 !/" antibo dy (Calbioc hem Reference #: 368662) was added to membrane at 1:1000 in 10mL 5% BSA/TBST. For secondary antibody, Anti Mouse was added at 1:20,000 in 10mL 5% BSA/TBST. Similar procedure was followed as used in FTO westerns. For V5 westerns, membrane was blocked in 5% milk /TBST for 1 hour at room temperature while rocking. Primary V5 HRP conjugated antibody (Invitrogen Reference

PAGE 24

12 #: R961 25) was added to m embrane at 1:1000 in 10mL 5% milk /TBST No secondary antibody needed. S imilar imaging procedure was followed as used in FTO westerns For Flag wes terns, membrane was blocked in 3% milk /TBST for 1 hour at room temperature while rocking. Primary Flag antibody ( Sigma Reference #: F3165 ) was added to membrane at 1:1000 in 10mL 3% milk /TBST. For secondary antibody, Anti Mouse was added at 1:20,000 in 10m L 3% milk /TBST. Similar procedure was followed as used in FTO westerns. Over Expression of FTO and Mettl3 in Mammalian Cells Gibson Assembly Cloning of FTO V5 AND METTL3 FLAG into pCAGEN 1. Mammalian e xpression vector of interest pCAGEN was linearized using 2 uL of EcoR1 restricti on enzyme, 2uL EcoR1 Buffer, 2 ug of circular pCAGEN and 14 uL dH 2 0, to make the final reaction volume 20 uL The digest reaction was incubated at 37¡C for 15 minutes. 2. 5' phosphate groups on pCAGEN were removed in order to prevent plasmid recircularization. 1 uL of antarctic phosphatase (NEB) was added to the digest reaction. Samples were incubated at 37¡C for 15 minutes. 3. The effectiveness of the digest reaction was confirmed by running the digested p roduct on a 1 % agarose gel. The circular plasmid was added as a control. 4. After validation of successful digestion, the remaining linear plasmid was purified using the QIAquick Gel Extraction Kit from QIAGEN.

PAGE 25

13 a. 1 volume of isopropanol was added to remainin g digest reaction. Solution was added to spin column in a collection tube. Tube was spun at 10,000 rpm for 1 minute and the flow through was discarded. b. The wash was performed by adding 750 uL of PE Buffer to the spin column. Tube was spun at 10,000 rpm for 1 minute and the flow through was discarded. c. Empty column was re spun at 10,000 rpm for 1 minute. d. The spin column was placed in a fresh collection tube. 30 uL Buffer EB was added to the spin column and the tube was spun at 10,000 rpm for 1 minute to elute purified digest product. 5. The synthesized gBlock gene fragments (IDT sequences contained in Appendix ) were resuspended according to IDT protocol. a. The tube was centrifuged for 5 sec at 3000 xg. b. Sterile TE buffer (pH 7.5) was added to a concentration of 10ng/uL. c. Solution was homogenized by vortexing and incubated at 50 ¡ C for 20 minutes. d. Sample was placed on ice for immediate use. (Eventually stored at 20¡C). 6. A 3 fold molar increase of DNA fragments containing 15 bp overlaps and 50 ng of linear plasmid was combined for the assembly ( 5 fold molar excess of fragment was used if the DNA was less than 200 bp ). DNA fragments were converted into pmoles using Equation 1.

PAGE 26

14 7. The Gibson assembly was prepared on ice by combining 50ng linear pCAGEN vector 3 fold mol ar excess fragments, and 10 uL Gibson Assembly Master Mix. Milli Q H 2 0 was added to make a total volume of 20 uL. 8. Samples were incubated at 50¡C for 15 minutes (samples that contained more than 3 fragments were incubated at 50¡C for 30 minutes). After incu bation, samples were immediately placed on ice or stored at 20¡C. 9. NEB DH 5 alpha competent E. coli cells (included in Gibson Assembly Kit) were transformed with 2 uL of assembly reaction. Overnight cultures were made from colonies on LB + ampicillin plates Plasmids we re purified via the Ge neJET Plasmid Miniprep Kit ( Thermo Scientific) according to protocol 10. To confirm if fragments were successfully cloned into pCAGEN, restriction digests were performed and products were run out on a 1% agarose gel. N2A and HEK293T Mammalian Cell Transfection Using PEI 1. Day 1: Cells were plated at 1 .0x10 6 cells per well in 6 well plates in cell specific media (Appendix). 2. Day 2: Media was not changed in 6 well plates. 2.0 ug of total DNA (1800 ng plasmid of interest + 200 ng pMax GFP) was added to 100 uL Opti MEM per transfection No DNA was added to untransfected control well. In a separate tube, 5 uL of PEI was added to 95 uL Opti MEM per transfection. Tube was tapped to mix and incubated at room temperature for 5 minutes 100 uL PEI:Opti MEM was transferred to DNA:Opti MEM tubes. Tubes were tapped to mix, centrifuged at lowest speed for collection, and incubated at room

PAGE 27

15 temperature for 20 minutes. Mixture was added to cells drop wise. Cells were incubated at 37¡C with 5% CO 2 overnight. 3. Day 3: To determine if transfection was successful, presence of green fluorescence from pMax GFP was observed using fluorescence microscopy. mESC Transfection Using PEI 1. Mouse ESCs were washed, trypsinized and resuspended in Opti MEM. 10 uL of resuspension was added to 10 uL trypan blue dye. The total number of ESCs was counted using the Cell Countess (Invitrogen) 2. 1 x 10 6 cells were aliquotted into 2 mL microcentrifuge tubes one per well for a six well plate. Tubes were centrifuged for 2 m inutes at 1500rpm. Supernatant was carefully aspirated. 3. Cell pellets were resuspended in 300 uL Opti MEM. 4. 2 ug of total DNA was added to the resuspended cells (200 ng pMax GFP and 1800 ng plasmid of interest). No DNA was added to untransfected control cell s. Cells were mixed by careful pipetting. 5. 100 uL of PEI was added to the resuspended cells. Cells were mixed by pipetting. 6. Cells were incubated for 30 minutes at room temperature. Mixture was pipetted every 10 minutes. 7. The transfection reaction was plat ed drop wise on freshly prepared ge latin coated 6 well plates with 2mL warm and complete ESC media (Appendix) 8. Transfection was incubated overnight at 37 ¡ C and visualized the next day us ing the fluorescence microscope to confirm GFP expression.

PAGE 28

16 Quantifi cation of m 6 A Levels in Mammalian Cells RNA Isolation RNA was isolated using D irect zol RNA Miniprep by Zymo. 500uL of TRIzol was added per well of a 6 well plate to begin lysing process (1mL of TRIzol was added per 10cm plate). RNA isolation followed kit protocol. All isolated RNA was quantif ied using Nanodrop 2000 ( ThermoScientific ) mRNA Enrichment 1. 50 ul of oligo d(T) magnetic beads were aliquotted to fresh microcentrifuge tubes, one per RNA sample. 2. 200 ul of Lysis/Binding Buffer (miRVANA RNA Isolation Kit) was added to each tube and samples were vortexed and mixed on rotator for 2 minutes at room temperature. 3. 5ug of isolated total RNA was added to magnetic beads. Tubes were placed on rotator overni ght at 4 ¡ C. 4. Tubes were placed on magnet plate for one minute and supernatant was saved as "oligo dT other" for further analysis. 5. 100 ul RNase free H 2 O was added to tubes, vortexed, and placed back on magnet, discarding H 2 O. Wash was repeated two times. 6. In order to elute RNA from beads, 20 ul cold 10mM Tris HCl at pH 7.5 was added to beads and the tube was incubated at 80 ¡ C for 2 minutes. 7. Tube was returned to magnet and RNA was immediately placed in new tube on ice.

PAGE 29

17 8. RNA was quantified using the Quibit HS RNA Assay Kit ( Thermo Fisher Scientific ) and stored in the 20 ¡ C. mRNA Digestion 1ug of poly A mRNA was digested by 4ul nuclease P1 (2 U) in 40 ul of LCMS/MS buffer (Appendix) at 37 ¡ C for 1 hour. After incubation, 3ul of ammonium bicarbonate (1 M) and 0.5 ul alkaline phosphatase (0.5 U) was added. An additional incubation at 37 ¡ C for 1 hour was performed. To confirm digestion, samples were run out on a 1% agarose gel with an undigested RNA sample as a control. Samples were transported to Anschutz Medical Campus for analysis using LCMS/MS. Levels of adenosine and methyl adenosine were reported. Dot Blot Nitrocellulose membrane was rehydrated in H 2 0 for 3 minutes. The membrane was then placed in the Bio Dot Microfiltration Apparatus (BioRad). Each well H 2 0 and flushed by gentle vacuum. 5ul of H 2 O was added with 5ug of total RNA. RNA was allowed to bind membrane via gravity until all solution had flown through. The m embrane was removed from the apparatus and cross linked using UV light (Stratalinker). The membrane was placed back in the apparatus and blocked for 10 minutes using sterile TBST with 5% milk. Primary Anti N6 methyladenosine antibody ( Milipore Reference #: ABE572 ) was added to membrane at 1:500 in at room temperature for 1 hour in 5%milk/TBST Membran e was then washed four times with TBST. Fo r secondary antibody, Anti Rabbit was added at 1:5,000 for 30 minutes at room temperature in 5% milk /TBST. The membra ne was washed four times with TBST and imaged using Pierce ECL Western Blotting Substrate.

PAGE 30

18 Quantification of Endogenous FTO and Mettl3 in Mammalian Cells RNA Isolation RNA isolated using mirVana mirRNA Isolation Kit by Life Technologies followed kit proto col. When RNA was to be isolated using Direct zol RNA Miniprep by Zymo, 500uL TRIzol was added per well of a 6 well plate to begin lysing process (1mL of TRIzol was added per 10cm plate). RNA isolation followed kit protocol. All isolated RNA was quantif ied using Nanodrop 2000 ( ThermoScientific ) cDNA Synthesis cDNA was synthesized using High Capacity Reverse Transcriptase kit ( Applied Biosystems ) according to manufacturers protocol. Total RNA, 1ug 2ug, was used to synthesize cDNA. The amount of input R NA used was kept constant for each set of RNA samples qPCR To quantify gene expression, three biological replicates were created for each cell or treatment type. Total RNA was isolated from cells and cDNA was synthesized using 1u g 2ug RNA. All cDNA samp les were diluted to 8.89ng/ul using DEPC H 2 O A master mix for each probe was made by combining 2x Taq M an Mix (with UNG), 20x Taq M an probe, and DEPC H 2 0. Master mix components were multiplied by total number of wells designated for each probe. After 19.38u L of master mix was added to each designated well, 5.63 uL of diluted cDNA was added to plate in triplicates in order to have three technical replicates of each sample Plates were spun down for 30 seconds at 2,000 RPM to ensure all components were combine d at the bottom of the plate, and then placed in

PAGE 31

19 StepOne qPCR Machine (Applied Biosystems) Data was collected by running the Comparative C T ( $$C T ) program, which followed the cycling parameters: qPCR Program: 2 min 50¡C x 1 cycle 10 min 95¡C x 1 cycle [15 sec 95¡C 1 min 60¡C] x30 cycles Detection of FTO Phosphorylation in Mammalian Cells Overexpression of exogenous FTO V5 WT and Gsk 3 DKO mESCs were transfected with 2000 ng of FTO containing a V5 epitope tag, referred to as FTO V5, accordi ng to protocol previously described. Total protein was isolated and successful transfection was confirmed through western blot using a primary antibody to the V5 epitope tag. V5 Immunoprecipitation Remaining protein lysate, 300 ul, was added to 2 ul of V5 agarose beads (Bethyl Laboratories Reference #: S190 119). Lysates were incubated with beads for 2 hours at room temperature while rotating. Lysates were centrifuged at 3000 x g for 60 seconds at 4¡C, in order to pellet beads. Pellet was washed 4 times wi th IP lysis buffer and Sigma Protease Inhibitor Cocktail. Protein was eluted by adding 40 ul of 1x Tris tricine sample buffer and incubated for 5 minutes at 100 ¡ C. Beads were pelleted by centrifugation at 14,000 rpm for one minute. Supernatant was transfe rred to a fresh micro centrifuge tube and stored at 20 ¡ C until use. Successful immunoprecipitation was confirmed through western blot using an antibody to the V5 epitope tag. Protein staining and LCMS/MS

PAGE 32

20 V5 immunoprecipitated protein samples were run out on 7.5% polyacrylamide Mini PROTEAN TGX Precast Gel (BioRad). The polyacrylamide gel was then stained with Imperial Protein Stain (ThermoScientific). FTO V5 stained protein band was identified and excised. Samples were transported to Anschutz Medical Campu s for analysis using LCMS/MS. Phosphoprotein enrichment Total protein was isolated from WT and Gsk 3 DKO mESCs that were transfected with FTO V5. Samples were enriched for phosphoproteins using the Pro Q Diamond Phosphoprotein Enrichment Kit (Invitrogen R eference #: P33358) according to manufacturer's protocol for nondenatured protein lysates. Results Several studies have shown that i nhibition of Gsk 3 increase s stem cell pluripotency, even in the absence of LIF but the exact mechanism s and pathways involved remain to be determined. The same differentiation resistant phenotype is seen in mESCs lacking the RNA methyltransferase, Mettl3, leading us to hypothesize that there may be a mechanistic connection between Gsk 3 inhibition and regulation of RNA m ethylation that dictates pluripotency. It was shown in Mettl3 KO ESCs that reduced levels of m 6 A mRNA methylation leads to an increase in the half life of those mRNAs, which notably includes many pluripotency related genes. These same pluripotency genes ar e also increased in Gsk 3 DKO ESCs. Therefore, we hypothesized that Gsk 3 is regulating the m 6 A mRNA modification. Because Gsk 3 is almost exclusively a negative regulator, we proposed Gsk 3 is regulating m 6 A through controlling the levels of FTO protein v ia phosphorylation, much as it regulates catenin in the Wnt pathway.

PAGE 33

21 Phosphorylation of FTO would subsequently lead to ubiquitin mediated degradation in WT ESCs. Therefore, when Gsk 3 is inhibited or genetically deleted, FTO would accumulate, and m 6 A lev els would decrease. This decrease of m 6 A would result in the increased half life of specific mRNAs, leading directly to enhanced pluripotency. Over Expression of FTO and Mettl3 in Mammalian Cells In order to determine the precise mechanism by which Gsk 3 affects m 6 A, we wanted to overexpress both the m 6 A demethylase, FTO, and the m 6 A methyltransferase, Mettl3, into mouse embryonic stem cells. We first needed to clone these protein coding sequences into a mammalian expression vector. Gibson Assembly clonin g (Gibson, 2011) was used to insert each of these sequences into mammalian expression vector, pCAGEN. gBlock gene fragments (IDT) are double stranded, sequence verified nucleotide fragments that were synthesized to be identical to FTO and Mettl3 protein and contained amin o terminal V5 and Flag epitope tags, respectively (sequences in Appendix). An epitope tag was used to facilitate the detection of each protein by using epitope specific antibodies, as well as to distinguish between endogenous and exogenous protein. Gibson Assembly requires that each fragment contain 15 20 bp overlaps that correspond with the expression vector. Subsequently, 15 bp overlaps complementary to pCAGEN linearized with EcoRI were added to each end of the synthesized DNA fragments. Gibson assembly m astermix contains three key enzymes, an exonuclease, DNA ligase, and DNA polymerase to create a sealed double stranded plasmid, with the gBlock inserted in proper orientation. OneShot chemically competent cells were transformed with Gibson Assembly product and plasmid DNA was isolated through mini preps (GeneJet). A restriction digest was performed to screen clones in order to ensure proper insertion of the

PAGE 34

22 gBlock. Clones with proper restriction enzyme digest bands (Figure 1A and 1B) were subjected to Sange r sequencing provided by Eton Bioscience to further confirm correct cloning. After successful cloning of Mettl3 and FTO, we wanted to confirm that these constructs would express in mammalian cells. Mouse embryonic stem cells were transfected with 1800ng of plasmid DNA and 200 ng of GFP using polyethylenimine (PEI) as a transfection agent (Bartman, Egelston, Ren, Das, & Phiel, 2015) Mouse embryonic stem cells were chosen in order to study the effect of manipulating m 6 A levels on pluripotency. Therefore, mESCs were an ideal model. Successful transfection was vis ualized through presence of GFP. In order to verify successful overexpression of these plasmids in mESCs, protein was isolated and subjected to western blot against an untransfected control protein lysate. Antibodies to V5 and Flag epitope tags were used (Figure 2A and 2B). Both constructs produced robust protein expression, indicating we were able to overexpress these proteins in mouse embryonic cells.

PAGE 35

23 Figure 1. Verification of Successful Gibson Assembly Cloning ( A) BglII restriction digest of pCAGEN FTO V5 to ensure that transcripts were inserted correctly into mammalian expression vector pCAGEN. 900bp fragments were expected in correct clones. (B) EcoRV restriction digest of pCAGEN Mettl3 Flag to ensure proper cloning. 800bp fragmen ts were expected in correct clones.

PAGE 36

24 Levels of Endogenous FTO in Mammalian Cells Our hypothesized mechanism proposes that Gsk 3 regulates FTO through phosphorylation, resulting in ubiquintation and degradation of FTO. Therefore, we wanted to quantify levels of endogenous FTO in order to determine if FTO protein levels were indeed higher in Gsk 3 DKO mESCs due to the inability of FTO to be phosphorylated by Gsk 3 and subsequently marked for degra dation. Under normal ESC culturing conditions, with the addition of LIF, no difference was seen between levels of protein in WT compared to Gsk 3 DKO mESCs (Figure 3). These results were expected because the addition of LIF maintains WT ESCs in a pluripote nt state. Gsk 3 DKO ESCs Figure 2. Verification of Plasmid Expression in Mouse Embryonic Stem Cells ( A) Western blot using an Anti V5 antibody to detect expression of FTO V5 pCAGEN (B) Western blot using Anti Flag antibody to detect expression of pCAGEN Mettl3 Flag.

PAGE 37

25 are able to maintain high pluripotency levels regardless of LIF addition. Therefore, we concluded that optimized cell culturing conditions was necessary in order to separate pluripotency mechanisms from the effects of LIF addition. A previous study indicated that Gsk 3 DKO ESCs were able to retain pluripotency even after removing LIF for 14 days (Doble et al., 2007) We decided to implement a similar regimen, culturing WT and Gsk 3 DKO mESCs in complete ESC media ( Appendix) in the absence of LIF for fourteen days. Cells were washed and treated with new media daily. On day 14, protein was isolated and quantified. We then performed a western blot to assess levels of FTO and tubuli n (Figure 4). A robust decrease of FTO was seen in WT ESCs when compared to Gsk 3 DKO ESCs. tubulin served as a loading control to indicate relative levels of protein. This data strongly supports our hypothesis that Gsk 3 DKO ESCs have accumulated levels of FTO protein through lack of FTO degradation. In order to rule out possible effects on FTO protein due to changes in gene expression, we examined FTO gene expression in these same cells. In addition to protein, total RNA was also isolated (Zymo) and cDNA was synthesized (Applied Bi osystems). FTO gene expression was quantified through qPCR (Figure 5). Results indicate that relative gene expression remain constant, with a minor decrease in the Gsk 3 DKO cells. This is consistent with our hypothesis that regulation of FTO occurs post t ranscriptionally.

PAGE 38

26 Figure 3 FTO Protein Expression in WT and Gsk 3 DKO m ESCs Cultured in Complete ESC Media i n the Presence of LIF. Protein band sizes are indicated on left side. tubulin western served as a loading control Figure 4 FTO Expression in m ESCs Cultured in Complete ESC Medi a in the Absence of LIF for 14 D ays. FT O protein expression was observed in WT and Gsk 3 DKO m ESCs that were grown in the absence of LIF for 14 days. The tubulin western was us ed as a protein loading control.

PAGE 39

27 Effect of Gsk 3 Inhibition on FTO Protein Expression Because we determined that FTO protein levels were significantly reduced in WT mESCs when compared to Gsk 3 DKO mESCs, we wanted to determine if treating WT ESCs with a Gsk 3 inhibitor would also be sufficient to prevent degradation of FTO protein in the absence of LIF In order to determine the effects of Gsk 3 inhibition on FTO levels, WT cells were grown without LIF for fourteen days as previousl y described. WT cells were treated with various c oncentrations of known Gsk 3 small molecule inhibitors, LiCl and SB 415286 on day 14 and 15. On day 16, protein was isolated from !" !#$" !#%" !#&" !#'" (" (#$" )*"+,-./(%" 012"+,-./(%"" !"# $%&# Figure 5 FTO Gene Expression in m ESCs Cultured in Complete ESC Medi a in the Absence of LIF for 14 D ays. FT O gene expression was observed in WT and Gsk 3 DKO m ESCs that were grown in the absence of LIF for 14 days using qPCR

PAGE 40

28 WT cells and FTO and tubulin western blots were performed to access levels of protein present. Results indicated that FTO p rotein levels increased with increased concentrations of SB415286, with the most robust expression seen in cell s treated with 15M SB415286 (Figure 6A). The LiCl treated cells showed a similar trend in increasing FTO expression levels with increasing LiCl concentrations, with the most robust expression seen in cells treated with 10mM LiCl (Figure 6B). These data show that Gsk 3 inhibition can mimic the effects on FTO protein expression that we observed in Gsk 3 DKO ESCs.

PAGE 41

29 Quantification of m 6 A levels in mESCs Our hypothesized mechanism suggests that Gsk 3 regulates FTO through phosphorylation. It has already been well established that FTO is the m 6 A demethylase. If Gsk 3 is knocked out and FTO protein accumulates, the overall levels of m 6 A should be reduced. Therefore, we wanted to quantify levels of m 6 A fr om Gsk 3 DKO and WT cells. WT and Gsk 3 DKO cells were grown without LIF for 14 days. On day 14, total RNA Figure 6 Effect of Gsk 3 Inhibition on FTO Protein Expression in WT ESCs. WT mESCs were cultured in complete ESC media in the absence of LIF for 16 days. On days 14 and 15, cells were treated with increased concentrations of (A) SB 415,286 or (B) LiCl. Protein was isolated on day 16 to observe the effect of Gsk 3 inhibition on FTO expression in a dose dependent ma nner. The tubulin westerns were used as a protein loading control.

PAGE 42

30 was isolated from both cell types and was enriched for mRNA using oligo d(T) magnetic beads. Each mRNA sample was then quantified via Quibit and 500 ng of mRNA was digested into single nucleotides using nuclease P1. Samples were sent to the Anschutz Proteomics Core and nucleotide bases were quantified via LC MS/MS. Results indicated that there is approximately a 50% decrease of N 6 methyladenosine in Gs k 3 DKO mESCs. This strongly supports our hypothesis that Gsk 3 activity is regulating the levels of m 6 A in mESCs. "! "#"$! "#"%! "#"&! "#"'! "#"(! "#")! "#"*! "#"+! ,-!./01!2#$'! 234!./01!2#$'! !"#$"%&#'()*+,-,.( Figure 7 Quantification of m 6 A in WT and Gsk 3 DKO cells WT and Gsk 3 DKO mouse embryonic cells were cultured in complete ESC me dia in the absence of LIF for 14 days. On day 14, total RNA was isolated. mRNA was enriched and digested into single nucleotides. Samples were analyzed using LCMS/MS in order to quantify both N6 methyladenosine and unmethylated adenosine.

PAGE 43

31 Effect of M ettl3 and FTO Overexpression on Pluripotency Genes in mESCs We next wanted to quantify the expression of pluripotency genes when we overexpressed either FTO or Mettl3 in mESCs. Because decreased m 6 A is associated with increased pluripotency and increased mRNA stability we expected to see an increase in gene expression when we overexpressed FTO and a decrease in gene expression when we overexpressed Mettl3. We chose to observe Esrrb (estrogen receptor ") mRNA because it is known to be affect ed by m 6 A methylation. We grew WT and Gsk 3 DKO mESCs in the presence of complete ESC media with LIF. We then transfected FTO V5 into WT mESCs and Mettl3 Flag into Gsk 3 DKO mESCs. Total RNA was isolated 48 hours after transfection and cDNA was synthesized Quantitative PC R analysis shows that Esrrb mRNA levels stayed rela tively constant after either treatment. We do see a minimal increase in Esrrb in WT with FTO (Figure 8A) and a minimal decrease in Gsk 3 DKO with Mettl3 (Figure 8B), although neither is si gnificant. We uncovered that 48 hour overexpression is not enough time to create a large impact on gene expression. We determined that a stable cell overexpressing Mettl3 or FTO would be a more sufficient way to determine gene expression levels.

PAGE 44

32 Characterization of Axin / and Axin +/ mESCs Because Gsk 3 is a key component in numerous intracellular pathways, we wanted to investigate the effect of those pathways on m 6 A levels and FTO regulation Gsk 3 is inhibited through activation of the Wnt and Insulin signaling path ways and b oth Fi gure 8. Esrrb Gene Expression in m ESCs with Overexpression of Mettl3 or FTO ( A) Esrrb expression was observed in WT and WT + FTO mESCs grown in complete ESC media with LIF addition. (B) Esrrb expression was observed in Gsk 3 DKO and Gsk 3 DKO + Mettl3 mES Cs grown in complete ESC media with LIF addition.

PAGE 45

33 pathways have also been implicated in stem cell pluripotency. We wanted to determine if activation of either the Wnt or Insulin pathways had an effect on levels of m 6 A in mESCs. We first wanted to look at Wnt signaling using Axin / and Axin +/ mESCs that we received from Frank Costantini, whose lab originally cloned and characterized Axin, but had not previously been characterized. Deletion of Axin would result in a c onstitutively active, ligand independent Wnt signaling. In order to determine if Axin was knocked out, we examined levels of catenin protein. Axin is a key component of the catenin destruction complex in the Wnt pathway, along with Gsk 3, so catenin protein levels should be elevated in Axin / similar to that of Gsk 3 DKO cells. Results from western blotting experiments indicated that catenin protein levels are not elevated in the Axin / and Axin +/ mESCs (Figure 9A). Expression appears to be lower than that of WT mESCs. This indicates that the catenin destruction complex is still intact and catenin is being rapidly degraded. Next we wanted to quantify gene expression levels of a gene known to be affected directly by the Wnt pathway. Activation of the Wnt pthway elevates expression of Axin2, so we would anticipate higher levels of Axin2 in Axin / and Axin +/ mESCs. RNA was isolated from WT, Axin / and Axin +/ and cDNA was synthesized. QPCR was p erformed and Axin2 gene expression was quantified in the Axin / and Axin +/ using WT as a control. Increases in Axin2 are moderate and are not indicative of Axin being genetically deleted (Figure 9B). These results indicate that Axin is still functioning properly and cells were not used for further experimentation. Taken together, we speculate that since the Axin / ESCs were derived more than 20 years ago, tubes may have been mislabeled and we were sent the wrong clones.

PAGE 46

34 Figure 9. Characteriz ation of Axin / and Axin +/ mESCs ( A) catenin protein expression was observed in WT, Axin / and Axin +/ and Gsk 3 DKO m ESCs tubulin western was used as a protein loading control. (B) AXIN 2 expression levels were quantified in WT, Axin / and Axin +/ mESCs.

PAGE 47

35 Effect of PI3K Pathway on m 6 A levels Because Gsk 3 plays an integral part in the insulin/PI3K pathway, we wanted to determine if activation of the pathway would result in an effect on m 6 A levels. Therefore, we wanted to quantify levels of m 6 A from p110* mESCs and WT mESCs. While Gsk 3 is fully functional in p110* cells, the p110 subunit is myristoylated, leading to constitutive activation of the insulin pathway and inhibition of Gsk 3. WT and p110* cells were grown without LIF for 14 days. On day 14, total RNA was isolated from both cell types and was enriched for mRNA using oligo d(T) magnetic beads. Each mRNA sample was then quantified via Quibit and 500 ng of mRNA was digested into single nucleotides using nuclease P1. Samples w ere sent to the Anschutz Proteomics Core and nucleotide bases were quantified via LC MS/MS. Results indicated that there is no difference in levels of N 6 methyladenosine in p110* cells compared to WT (Figure 10) This suggests that there is no effect of in sulin signaling on m 6 A, therefore regulation does not likely occur through this pathway.

PAGE 48

3 6 Phosphorylati on of FTO Up to this point, we have presented important evidence suggesting that Gsk 3 activity is important for regulating FTO protein levels as well as m 6 A levels. However, most of the evidence of a role for Gsk 3 in regulating FTO has been circumstantial. Therefore we sought to obtain more definitive evidence that FTO is phosphorylated by Gsk 3. We noted that mouse FTO contains a Gsk 3 consensus motif, 24 5 S CEG S EDE S EDE S 257 within its amino a cid sequence. In addition, mass spectrometry data revealed phosphorylation on these serine residues in mouse cells ( http://www.cellsignal.com/common/content/content.jsp?id=phosphositeplus ) Hence, we "! "#%! "#'! "#)! "#+! $! $#%! $#'! $#)! 5$$"6! ,-! *+,-,( Figure 10 Quantification of m 6 A in WT and p110* cells WT and p110* mouse embryonic cells were cultured in complete ESC me dia in the absence of LIF for 14 days. On day 14, total RNA was isolated. mRNA was enriched and digested into single nucleotides. Samples were analyzed using LCMS/MS in order to quantify both N 6 methyladenosine and unmethylated adenosine.

PAGE 49

37 focused on that c onsensus sequence as the putative Gsk 3 phosphorylation site. Since there is no phospho specific antibody for these sites on FTO, we were unable to perform a simple western blot. Instead, we approached this question by utilizing a kit that selectively bind s phosphorylated proteins to a proprietary resin, allowing for an enrichment of all phosphorylated proteins. We could then use antibodies to FTO (endogenous) or epitope tag (overexpressed) to evaluate the phosphorylation status of FTO in WT and Gsk 3 DKO E SCs. A Phospho Protein enrichment kit (Molecular Probes) was used to enrich for phosphorylated proteins from ESCs. We isolated total protein from WT and Gsk 3 DKO mESCs where FTO protein levels are similar (Figure 3) and subjected each lysate to phospho e nrichment (Figure 11 ). We also saved the flow through for further analysis of unphosphorylated proteins. Both the enriched and flow through samples were quantified and analyze d by western blotting (Figure 12 A). Endogenous FTO is observed in both WT and Gsk 3 DKO phospho enriched samples. We expected protein in WT due to Gsk 3 phosphorylation, but protein may be present in Gsk 3 because FTO is being primed' and therefore is being phosphorylated by another kinase. We also saw FTO protein in both samples of t he flow through, although Gsk 3 DKO cells has much more robust expression of protein in the flow through. Because the levels of endogenous FTO are low, we decided to overexpress FTO V5 and then subject the samples to phospho enrichment. We transfected WT a nd Gsk 3 DKO mESCs with FTO V5 and isolated total protein, then performed V5 immunoprecipitation on a WT and Gsk 3 DKO sample to confirm expression. Next we performed phospho enrichment on each sample, with untransfected WT cells used as a control. Lysates were then subjected to western blotting

PAGE 50

38 with a V5 specific antibody (Figure 12 B). For phospho enriched samples, robust FTO was seen in WT cells, but no protein was detected in Gsk 3 DKO samples. This indicates that FTO is phosphorylated in WT mESCs, but n ot in Gsk 3 DKO mESCs. We next sought to determine the precise sites of phosphorylation on FTO. Our approach was to overexpress a tagged version of FTO in WT and Gsk 3 DKO ESCs, then immunoprecipitate FTO, and perform mass spectrometry to identify phospho rylated residues. Therefore, we overexpressed FTO V5 through PEI transfection into both WT and Gsk 3 DKO mESCs, and then immunoprecipitated FTO V5 using V5 magnetic beads. Western blotting was performed to ensure that the FTO V5 was being expressed and tha t the immunoprecipitation was acco mplished successfully (Figure 13 ). We were then able to run protein lysates through SDS PAGE, stain the gel using Imperial Protein Stain, and excise the band from the gel. Samples were transported to Anschutz Proteomics Co re for analysis via LC/MS. Results indicated that 730 proteins were observed in the samples, therefore nonspecific binding occurred during immunoprecipitation. FTO was indeed one of the observed proteins, but we only obtained 42% coverage of the complete p rotein sequence in WT cells (Figure 14 A), while coverage in Gsk 3 DKO ESCs was a meager 14% (Figure 14 B). No phosphorylation was detected in either sample. Although we have yet to determine the precise site(s ) of phosphorylation on FTO, based on LC/MS data we can narrow down possible sites to those that were not covered, 58% of the protein. In addition, we did not obtain any coverage of the Gsk 3 consensus motif in either sample, meaning that the data does not rule out the possibility that FTO is phosphory lated by Gsk 3 on this consensus motif. Further studies will be necessary to fully test this hypothesis.

PAGE 51

39 Figure 11 Phospho Protein Enrichment Schematic Phospho enrichment enriches for all phosphorylated proteins, while unphosphorylated proteins are discarded in the flow through.

PAGE 52

40 Figure 13 FTO V5 Protein Overe xpression in m ESCs. FT O V5 protein expression was observed through a V5 specific antibody in WT and Gsk 3 DKO mESCs. Figure 12 Phospho Protein Enrichment (A) Levels of endogenous FTO were analyzed from WT and Gsk 3 DKO mESCs from phospho enrichment and phosphorylated depleted flow through using an antibody specific to FTO. (B) Levels of overexpressed FTO V5 were analyzed from WT and Gsk 3 DKO mESCs from phospho enrichment and V5 immunoprecipitation. Untransfected WT was used as a negative control.

PAGE 53

41 A B Figure 14 FTO V5 Protein LC MS/MS LC/MS FTO coverage seen in ( A) WT mESCs and (B) Gsk 3 DKO mESCs. Yellow highlight indicated amino acid sequence coverage.

PAGE 54

42 CHAPTER II DISCUSSION Conclusions Our data is consistent with our hypothesis that Gsk 3 contributes to the regulation of stem cell pluripotency through the regulation of FTO and subsequently, m 6 A mRNA modification. Due to highly similar phenotypic characteristics of Gsk 3 DKO and Mettl3 KO ESCs, we hypothesized that low levels of m 6 A contributes to increased stem cell pluripotency. We postulated that Gsk 3 negatively regulates the m 6 A modification through phosphorylation of FTO, the m 6 A demethylase, resulting in ubiquitination and degradation. FTO phosphorylation would result in low levels of cytoplasmic FTO, and subsequently increased levels of m 6 A, causing a more rapid degradation of m 6 A modified mRNAs in wild type cells. Pluripotency genes with m 6 A modifications would be degraded through selective binding of YTHDF2, poising ESCs for differentiation. In order to maintain pluripotency in wild typ e stem cells, serum and LIF must be used in culturing conditions. Alternatively, when is Gsk 3 is absent, phosphorylation is reduced and FTO levels are elevated, resulting in reduced m 6 A levels and increased pluripotency. When initially looking at wild ty pe and Gsk 3 DKO mESCs, FTO protein levels were relatively con stant. It was determined that culturing WT ESCs in the presence of LIF artificially enhanced pluripotency therefore FTO levels remained high. Cell culturing conditions needed to be optimized in order to observe accurate FTO levels. ESCs cultured in complete ESC media in the absence of LIF for fourteen days allowed for optimal observation of FTO protein expre ssion (developed by Jennifer Egelston, Phiel Lab). When WT and Gsk 3 DKO mESCs were grown under these optimized conditions,

PAGE 55

43 FTO expression was greatly reduced in WT ESCs when compared to Gsk 3 DKO ESCs. This data supports our initial hypothesis that in WT ESCs, FTO protein levels are indeed regulated by Gsk 3. In addition, we looked at gene expression levels of FTO in WT and Gsk 3 DKO cells grown under optimized conditions. Levels of FTO mRNA were relatively constant, with a slight decrease seen in Gsk 3 DK O mESCs. This supports our hypothesis that the mechanism behind regulation of FTO occurs post translationally, rather than at the transcriptional level. Furthermore, we were able to rescue FTO protein expression in WT mESCs with addition of a Gsk 3 inhibit or, supporting our hypothesis that Gsk 3 is contributing to the degradation of FTO The addition of 10 mM LiCl or 15uM SB for two days was optimal for rescue of FTO. In order to confirm that Gsk 3 DKO cells had increased pluripotency, we compared gene expr ession levels of transcription factors implicated in maintaining pluripotency. We observed increased expression of Nanog, Essrb, and Oct4 in Gsk 3 DKO ESCs compared to WT ESCs, confirming that Gsk 3 DKO cells have increased pluripotency even in the absence of LIF for fourteen days (data not shown, J. Egelston, Phiel Lab). We next wanted to quantify m 6 A in both WT and Gsk 3 DKO cells. Since FTO protein levels are increased in Gsk 3 DKO ESCs, we expected to observe changes in levels of m 6 A modifications on m RNA. T otal RNA was isolated from WT and Gsk 3 DKO m ESCs cultured in complete ESC media in the absence of LIF for 14 days. mRNA was enriched from total RNA using magnetic oligo dT beads. Collected mRNA was digested into single nucleotides using nuclease P1 in order to perform Liquid Chromatography Tandem Mass Spectrometry (LC MS/MS). LC MS/MS data showed

PAGE 56

44 roughly a 50% reduction in Gsk 3 DKO ESCs compared to WT ESCs substantiating our hypothesis that inhibition of Gsk 3 result s in reduced m 6 A mRNA methylatio n levels through the regulation of FTO. To confirm that FTO is indeed being phosphorylated, we wanted to subject samples to phospho enrichment utilizing a kit that selectively binds phosphorylated proteins to a proprietary resin We subjected WT and Gsk 3 DKO mESCs to phospho enrichment in order to look at endogenous FTO protein. FTO protein is observed in both WT and Gsk 3 DKO phospho enriched samples. We believe this is due to FTO being primed' by another kinase before Gsk 3 is able to ph osphorylate its target. W e saw a much more robust protein expression in Gsk 3 DKO flow through, than in WT ESCs, i ndicating that much of the F TO protein in Gsk 3 DKO cells is unphosphorylated. We also overexpress ed FTO V5 construct in WT and Gsk 3 DKO cells and subject th ose samples to phospho enrichment. For phospho enriched samples, robust FTO was seen in WT cells, but no protein was detected in Gsk 3 DKO samples. This indicates that FTO is phosphorylated in WT mESCs, but not in Gsk 3 DKO mESCs. Next we wanted to determine the precise residues within FTO where phosphorylation occurs. We again overexpressed FTO V5, immunoprecipitated the protein, and subjected the samples to Liquid Chromatography Tande m Mass Spectrometry (LC MS/MS). Unfortunately only 42% of coverage of FTO was achieved in WT ESCs and only 14% in Gsk 3 DKO ESCs. Phosphorylation was not detected in WT or Gsk 3 DKO ESCs but neither sample included coverage of the Gsk 3 consensus motif. We can narrow down our phosphorylation target site to that of the 58% of

PAGE 57

45 coverage not determined. This still leaves the Gsk 3 consensus site as possible target. Further studies will be required. Final Words Gsk 3 is tremendously important kinase involved in regulation of numerous intracellular pathwa ys. Uncovering another layer of Gsk 3 complexity through u nderstanding of the mechanism behind m 6 A regulation could have large impacts on current knowledge of devastating diseases. When d ysregulation of Gsk 3 or m 6 A occurs similar disease phenotypes are p roduced FTO variants have now been associated with Alzheimer's disease, independent of FTO effect on diabetes. Knockdown of FTO decreases tau phosphorylation a protein associated with fibrillar lesions in neurodegenerative disorders (Pitman RT, 2013) Remarkably over activity of Gsk 3 has been shown to lead to increased amyloid production and inflammatory responses, hallmark characteristics of AD (Hooper et al., 2008) Gsk 3 and FTO could be working through the same pathway, ultimately affecting Alzheimer's disease through mRNA m ethylation. Another key disease is type II diabetes. Overexpression of Gsk 3 increases phosphorylation and down regulation of insulin receptor substrate 1 Inhibition of Gsk 3 helps overcome the resistance to insulin and promotes the conversion of glucose to glycogen (Eldar Finkelman & Krebs, 1997) FTO was identified in a human GWAS study linking FTO with higher body mass index and type II diabetes. A direct link between diabetes and FTO has yet to be determined (Loos & Yeo, 2014) T he missing link could be Gsk 3 s regulation of m 6 A Similar stem cell pluripotency characteristics disease phenotypes, and suppor ting data have led us to the

PAGE 58

46 conclusion that there is a strong association between FTO and Gsk 3. In depth und erstanding of this mechanism could lead to potential downstream therapeutics. Our main focus as we move forward is determining the specific phosph orylation site(s) in FTO and to determine if the mechanism behind m 6 A is similar in humans to that observed in mouse ESCs

PAGE 59

47 CHAPTER III FUTURE DIRECTIONS Our lab has established a connection between Gsk 3 and m6A. Further characterization is still required to validate our mechanism. Our first focus is determining the specific site at which FTO is phosphorylated. We have provided evidence that indicates FTO is phosphorylated in WT mESCs and phosphorylation is lost in Gsk 3 DKO mESCs, but we have yet to provide conclusive evidence that Gsk 3 is responsible for the phosphorylation. This may be determined by attempting LC MS/MS in hopes to achieve better coverag e of the FTO protein. This would show that the phosphorylation is present at the Gsk 3 consensus site in WT and absent in the Gsk 3 DKO cells. Future directions will also include further characterization of m 6 A mRNAs via methyl seq. We will use oligo d( T) beads and m 6 A specific antibodies to enrich for mRNAs that contain the m 6 A tag in WT, p110*, and Gsk 3 DKO m ESCs. We will use methyl seq in order to identify specific mRNAs that are affected by deletion of Gsk 3 and the myristoylation of the p110 subuni t This will help us to determine if known regulators of stem cell pluripotency are indeed affected by loss of Gsk 3. A better understanding of methylated genes being up regulated or down regulated in Gsk 3 DKO mESCs may also give us a better understanding of each components role in various disease states. Because m 6 A is associated with decreased mRNA stability through selective binding of YTHDF2 o ur lab will perform mRNA half life studies by treating WT and Gsk 3 DKO cells with alpha amanitin an inhibitor of RNA polymerase II after removing LIF from cell media for fourteen days. In Gsk 3 DKO mESCs, where m 6 A is greatly reduced, mRNA half life should be greatly increased. We will do qPCR in order to

PAGE 60

48 evaluate levels of mRNA expre ssion of gene s know n to regulate stem cell p luripotency and genes that were identified using methyl seq Studies have already shown that Mettl3 KO cells have roughly 30% decrease in half life in these methylated pluripotency genes. We hope to see the same decrease in Gsk 3 D KO mESCs. We want to precisely determine which Gsk 3 pathway is affecting levels of m 6 A. We will initially look at the Wnt and PI3K pathways because both pathways have also been implicated in stem cell pluripotency. Our lab will develop an Axin a key co mpenent in the Wnt pathway, knockout cell line utilizing CRISPR guide RNAs specific to Axin Characterization of Axin KO cells that we previously provided showed no increase in catenin protein expression and no increase in Axin2 gene expression. We concl uded that Axin was still fully functional in these cells. We will then use Axin / and p110* cells previously described, to investigate how inhibition of Gsk 3 through activation of upstream signaling events affects m 6 A levels in mRNA We will work to quantify levels of m 6 A methylation in Axin KO cells. We did not see a change in m6A levels in p110*, but this pathway may still have some correlation with the regulation of m6A. Further investigation in required. Lastly, we will look at FTO and m 6 A level s in different human cell types. Gsk 3 is implicated in a plethora of human diseases. Insight into levels of m 6 A in various human cell types could help determine if these disease states are altered by Gsk 3 inhibition and levels of m 6 A. We would also want to determine if the mechanism is the same in human cells. Human FTO protein lacks the same Gsk 3 consensus site, although much of the rest of the protein is conserved (87%). A single serine in the consensus site is mutated to a

PAGE 61

49 proline. The site still prov ides a viable Gsk 3 target but further experiments will be imperative.

PAGE 62

50 REFERENCES Aberle, H., Bauer, A., Stappert, J., Kispert, A., & Kemler, R. (1997). beta catenin is a target for the ubiquitin proteasome pathway. EMBO J, 16 (13), 3797 3804. doi:10.1093/emboj/16.13.3797 Bain, J., Plater, L., Elliott, M., Shpiro, N., Hastie, C. J., McLauchlan, H., Cohen, P. (2007). The selectivity of protein kinase inhibitors: a further update. Biochem J, 408 (3), 297 315. doi:10.1042/BJ20070797 Bartman, C. M., Egelston, J., Kattula, S., Zeidner, L. C., D'Ippolito, A., Doble, B. W., & Phiel, C. J. (2014). Gene Expression Profiling in Mouse Embryonic Stem Cells Reveals Glycogen Synthase Kinase 3 Dependent Targets of Phosphatidylinositol 3 Kinase and Wnt/beta Catenin Signaling Pathways. Front Endocrinol (Lausanne), 5 133. doi:10.3389/fendo.2014.00133 Bartman, C. M., Egelston, J., Ren, X., Das, R., & Phiel, C. J. (2015). A simple and efficient method for transfecting mouse embryonic stem cells using polyethylenimine. Exp Cell Res, 330 (1), 178 185. doi:10.1016/j.yexcr.2014.07.020 Batista, P. J., Molinie, B., Wang, J., Qu, K., Zhang, J., Li, L., C hang, H. Y. (2014). m(6)A RNA modification controls cell fate transition in mammalian embryonic stem cells. Cell Stem Cell, 15 (6), 707 719. doi:10.1016/j.stem.2014.09.019 Beurel, E., Grieco, S. F., & Jope, R. S. (2015). Glycogen synthase kinase 3 (GSK3): r egulation, actions, and diseases. Pharmacol Ther, 148 114 131. doi:10.1016/j.pharmthera.2014.11.016 Burdon, T., Smith, A., & Savatier, P. (2002). Signalling, cell cycle and pluripotency in embryonic stem cells. Trends Cell Biol, 12 (9), 432 438. Retrieved from 78859::;;;#<=>?#<@A#AFG:$%%%"+)' Cartwright, P., McLean, C., Sheppard, A., Rivett, D., Jones, K., & Dalton, S. (2005). LIF/STAT3 controls ES cell self renewal and pluripotency by a Myc dependent mechanism. Development, 132 (5), 885 896. doi:10.1242/dev.01670 Clevers, H., & Nusse, R. (2012). Wnt/beta catenin signaling and disease. Cell, 149 (6), 1192 1205. doi:10.1016/j.cell.2012.05.012

PAGE 63

51 Coghlan, M. P., Culbert, A. A., Cross, D. A., Corcoran, S. L., Yates, J. W., Pearce, N. J., Holder, J. C. (2000). Selective small molecule inhibitors of glycogen synthase kinase 3 modulate glycogen metabolism and gene transcription. Chem Biol, 7 (10), 793 803. Retrieved from 78859::;;;#<=>?#<@A#AFG:$$"&&"+% Cross, D. A., Alessi, D. R., Cohen, P., Andjelkovich, M., & Hemmings, B. A. (1995). Inhibition of glycogen synthase kinase 3 b y insulin mediated by protein kinase B. Nature, 378 (6559), 785 789. doi:10.1038/378785a0 Ding, V. W., Chen, R. H., & McCormick, F. (2000). Differential regulation of glycogen synthase kinase 3beta by insulin and Wnt signaling. J Biol Chem, 275 (42), 32475 3 2481. doi:10.1074/jbc.M005342200 Doble, B. W., Patel, S., Wood, G. A., Kockeritz, L. K., & Woodgett, J. R. (2007). Functional redundancy of GSK 3alpha and GSK 3beta in Wnt/beta catenin signaling shown by using an allelic series of embryonic stem cell lines Dev Cell, 12 (6), 957 971. doi:10.1016/j.devcel.2007.04.001 Doble, B. W., & Woodgett, J. R. (2003). GSK 3: tricks of the trade for a multi tasking kinase. J Cell Sci, 116 (Pt 7), 1175 1186. Retrieved from 78859::;;;#<=>?#<@A#AFG:$%)$(H)$ Dominissini, D., Moshitch Moshkovitz, S., Schwartz, S., Salmon Divon, M., Ungar, L., Osenberg, S., Rechavi, G. (2012). Topology of the human and mouse m6A RNA methylomes revealed by m6A seq. Natur e, 485 (7397), 201 206. doi: 78859::;;;#L:?#<@A#AFG:H%*($*H Evans, M. J., & Kaufman, M. H. (1981). Establishment in culture of pluripotential cells from mouse embryos. Nature, 292 (5819), 154 156. Retrieved from 78859::; ;;#<=>?#<@A#AFG:*%'%)+$ Festuccia, N., Osorno, R., Halbritter, F., Karwacki Neisius, V., Navarro, P., Colby, D., Chambers, I. (2012). Esrrb is a direct Nanog target gene that can substitute for

PAGE 64

52 Nanog function in pluripotent cells. Cell Ste m Cell, 11 (4), 477 490. doi:10.1016/j.stem.2012.08.002 Fiol, C. J., Mahrenholz, A. M., Wang, Y., Roeske, R. W., & Roach, P. J. (1987). Formation of protein kinase recognition sites by covalent modification of the substrate. Molecular mechanism for the syne rgistic action of casein kinase II and glycogen synthase kinase 3. J Biol Chem, 262 (29), 14042 14048. Retrieved from 78859::;;;#<=>?#<@A#AFG:%+%"HH& Frame, S., Cohen, P., & Biondi, R. M (2001). A common phosphate binding site explains the unique substrate specificity of GSK3 and its inactivation by phosphorylation. Mol Cell, 7 (6), 1321 1327. Retrieved from 78859::;;;#<=>?#<@A# AFG:$$'&"+&& Geula, S., Moshitch Moshkovitz, S., Dominissini, D., Mansour, A. A., Kol, N., Salmon Divon, M., Hanna, J. H. (2015). Stem cells. m6A mRNA methylation facilitates resolution of naive pluripotency toward differentiation. Science 347 (6225), 1002 1006. doi:10.1126/science.1261417 Gibson, D. G. (2011). Enzymatic assembly of overlapping DNA fragments. Methods Enzymol, 498 349 361. doi:10.1016/B978 0 12 385120 8.00015 2 Graf, U., Casanova, E. A., & Cinelli, P. (2011). The Role of the Leukemia Inhibitory Factor (LIF) Pathway in Derivation and Maintenance of Murine Pluripotent Stem Cells. Genes (Basel), 2 (1), 280 297. doi:10.3390/genes2010280 Grosjean, H. (2005). Fine Tuning of RNA Functions by Modi fication and Editing Topics in current genetics, Retrieved from 78859::GO#GC?#CJB:$"#$""*:>H($'* Retrieved from 78859::GO#GC?#CJB:$"#$""*:>H($'* He, C. (20 10). Grand challenge commentary: RNA epigenetics? Nat Chem Biol, 6 (12), 863 865. doi:10.1038/nchembio.482 Hooper, C., Killick, R., & Lovestone, S. (2008). The GSK3 hypothesis of Alzheimer's disease. J Neurochem, 104 (6), 1433 1439. doi:10.1111/j.1471 4159.2 007.05194.x Huang, H., & He, X. (2008). Wnt/beta catenin signaling: new (and old) players and new insights. Curr Opin Cell Biol, 20 (2), 119 125. doi:10.1016/j.ceb.2008.01.009

PAGE 65

53 Ishikawa, F., Shimazu, H., Shultz, L. D., Fukata, M., Nakamura, R., Lyons, B., Harada, M. (2006). Purified human hematopoietic stem cells contribute to the generation of cardiomyocytes through cell fusion. FASEB J, 20 (7), 950 952. doi:10.1096/fj.05 4863fje Jansson, L., Kim, G. S., & Cheng, A. G. (2015). Making sense of Wnt signal ing linking hair cell regeneration to development. Front Cell Neurosci, 9 66. doi:10.3389/fncel.2015.00066 Jia, G., Fu, Y., Zhao, X., Dai, Q., Zheng, G., Yang, Y., He, C. (2011). N6 methyladenosine in nuclear RNA is a major substrate of the obesity associated FTO. Nat Chem Biol, 7 (12), 885 887. doi:10.1038/nchembio.687 Jope, R. S., Yuskaitis, C. J., & Beurel, E. (2007). Glycogen synthase kinase 3 (GSK3): inflammation, diseases, and therapeutics. Neurochem Res, 32 (4 5), 577 595. doi:10.1007/s11064 006 9128 5 Kadonaga, J. T. (2004). Regulation of RNA polymerase II transcription by sequence specific DNA binding factors. Cell, 116 (2), 247 257. Retrieved from 78859::;;;#<=>?#<@A#AFG:$'*'''&( Keller, L., Xu, W., Wang, H. X., Winblad, B., Fratiglioni, L., & Graff, C. (2011). The obesity related gene, FTO, interacts with APOE, and is associated with Alzheimer's disease risk: a prospective cohort study. J Alzheimers Dis, 23 (3), 461 469. doi:10.3233/JAD 2010 101068 Klein, P. S., & Melton, D. A. (1996). A molecular mechanism for the effect of lithium on development. Proc Natl Acad Sci U S A, 93 (16), 8455 8459. Retrieved from 78859::;;;#<=>?#<@A#AFG:+*$"+H% Klippel, A., Reinhard, C., Kavanaugh, W. M., Apell, G., Escobedo, M. A., & Williams, L. T. (1996). Membrane localization of phosphatidylinositol 3 kinase is sufficient to activate multi ple signal transducing kinase pathways. Mol Cell Biol, 16 (8), 4117 4127. Retrieved from 78859::;;;#<=>?#<@A#AFG:+*('+$" Korinek, V., Barker, N., Morin, P. J., van Wichen, D., de Weger, R., Kinzler, K. W., Clevers, H. (1997). Constitutive transcriptional activation by a beta catenin Tcf complex in APC / colon carcinoma. Science, 275 (5307), 1784 1787. Retrieved from 78859::;;;#<=>?#<@A#AFG:H")('"$

PAGE 66

54 Lee, M., Kim, B., & Kim, V. N. (2014). Emerging roles of RNA modification: m(6)A and U tail. Cell, 158 (5), 980 987. doi:10.1016/j.cell.2014.08.005 Li, F., Zhao, D., Wu, J., & Shi, Y. (2014). Structure of the YTH d omain of human YTHDF2 in complex with an m(6)A mononucleotide reveals an aromatic cage for m(6)A recognition. Cell Res, 24 (12), 1490 1492. doi:10.1038/cr.2014.153 Liu, J., Yue, Y., Han, D., Wang, X., Fu, Y., Zhang, L., He, C. (2014). A METTL3 METTL14 complex mediates mammalian nuclear RNA N6 adenosine methylation. Nat Chem Biol, 10 (2), 93 95. doi:10.1038/nchembio.1432 Liu, N., Dai, Q., Zheng, G., He, C., Parisien, M., & Pan, T. (2015). N(6) methyladenosine dependent RNA structural switches regulate RN A protein interactions. Nature, 518 (7540), 560 564. doi:10.1038/nature14234 Loh, Y. H., Wu, Q., Chew, J. L., Vega, V. B., Zhang, W., Chen, X., Ng, H. H. (2006). The Oct4 and Nanog transcription network regulates pluripotency in mouse embryonic stem c ells. Nat Genet, 38 (4), 431 440. doi:10.1038/ng1760 Loos, R. J., & Yeo, G. S. (2014). The bigger picture of FTO: the first GWAS identified obesity gene. Nat Rev Endocrinol, 10 (1), 51 61. doi:10.1038/nrendo.2013.227 Martello, G., Sugimoto, T., Diamanti, E., Joshi, A., Hannah, R., Ohtsuka, S., Smith, A. (2012). Esrrb is a pivotal target of the Gsk3/Tcf3 axis regulating embryonic stem cell self renewal. Cell Stem Cell, 11 (4), 491 504. doi:10.1016/j.stem.2012.06.008 Meijer, L., Flajolet, M., & Greengard, P. (2004). Pharmacological inhibitors of glycogen synthase kinase 3. Trends Pharmacol Sci, 25 (9), 471 480. doi:10.1016/j.tips.2004.07.006 Meredith, G. D., D'Ippolito, A., Dudas, M., Zeidner, L. C., Hostetter, L., Faulds, K., Phiel, C. J. (2015). Glyc ogen synthase kinase 3 (Gsk 3) plays a fundamental role in maintaining DNA methylation at imprinted loci in mouse embryonic stem cells. Mol Biol Cell, 26 (11), 2139 2150. doi:10.1091/mbc.E15 01 0013 Meyer, K. D., Saletore, Y., Zumbo, P., Elemento, O., Mason C. E., & Jaffrey, S. R. (2012). Comprehensive analysis of mRNA methylation reveals enrichment in 3' UTRs and near stop codons. Cell, 149 (7), 1635 1646. doi:10.1016/j.cell.2012.05.003

PAGE 67

55 Mitsui, K., Tokuzawa, Y., Itoh, H., Segawa, K., Murakami, M., Takahashi K., Yamanaka, S. (2003). The homeoprotein Nanog is required for maintenance of pluripotency in mouse epiblast and ES cells. Cell, 113 (5), 631 642. Retrieved from 78859::;;;#<=>?#<@A#AFG:$%*+*("' Murray, J. T., Campbell, D. G., Morrice, N., Auld, G. C., Shpiro, N., Marquez, R., Cohen, P. (2004). Exploitation of KESTREL to identify NDRG family members as physiological substrates for SGK1 and GSK3. Biochem J, 384 (Pt 3), 477 4 88. doi:10.1042/BJ20041057 Nakagawa, M., Koyanagi, M., Tanabe, K., Takahashi, K., Ichisaka, T., Aoi, T., Yamanaka, S. (2008). Generation of induced pluripotent stem cells without Myc from mouse and human fibroblasts. Nat Biotechnol, 26 (1), 101 106. d oi:10.1038/nbt1374 Okamoto, K., Okazawa, H., Okuda, A., Sakai, M., Muramatsu, M., & Hamada, H. (1990). A novel octamer binding transcription factor is differentially expressed in mouse embryonic cells. Cell, 60 (3), 461 472. Retrieved from 78859::;;;#<=>?#<@A#AFG:$H)*H+" Pan, G., & Thomson, J. A. (2007). Nanog and transcriptional networks in embryonic stem cell pluripotency. Cell Res, 17 (1), 42 49. doi:10.1038/sj.cr.7310125 Pan, G. J., Ch ang, Z. Y., Scholer, H. R., & Pei, D. (2002). Stem cell pluripotency and transcription factor Oct4. Cell Res, 12 (5 6), 321 329. doi:10.1038/sj.cr.7290134 Patel, M., & Yang, S. (2010). Advances in reprogramming somatic cells to induced pluripotent stem cell s. Stem Cell Rev, 6 (3), 367 380. doi:10.1007/s12015 010 9123 8 Peifer, M., Pai, L. M., & Casey, M. (1994). Phosphorylation of the Drosophila adherens junction protein Armadillo: roles for wingless signal and zeste white 3 kinase. Dev Biol, 166 (2), 543 556. doi:10.1006/dbio.1994.1336 Pitman RT, F. J., Stone AL, Devito JT, Puri N. (2013). FTO Knockdown Decreases Phosphorylation of Tau in Neuronal Cells; A Potential Model Implicating the Association of FTO with Alzheimer's Disease. J Alzheimers Dis Parkinson ism, 3 (125). doi:10.4172/2161 0460.1000125

PAGE 68

56 Pomerantz, J., & Blau, H. M. (2004). Nuclear reprogramming: a key to stem cell function in regenerative medicine. Nat Cell Biol, 6 (9), 810 816. doi:10.1038/ncb0904 810 Popkie, A. P., Zeidner, L. C., Albrecht, A. M ., D'Ippolito, A., Eckardt, S., Newsom, D. E., Phiel, C. J. (2010). Phosphatidylinositol 3 kinase (PI3K) signaling via glycogen synthase kinase 3 (Gsk 3) regulates DNA methylation of imprinted loci. J Biol Chem, 285 (53), 41337 41347. doi:10.1074/jbc. M110.170704 Salomonis, N., Schlieve, C. R., Pereira, L., Wahlquist, C., Colas, A., Zambon, A. C., Conklin, B. R. (2010). Alternative splicing regulates mouse embryonic stem cell pluripotency and differentiation. Proc Natl Acad Sci U S A, 107 (23), 105 14 10519. doi:10.1073/pnas.0912260107 Sanchez Ripoll, Y., Bone, H. K., Owen, T., Guedes, A. M., Abranches, E., Kumpfmueller, B., Welham, M. J. (2013). Glycogen synthase kinase 3 inhibition enhances translation of pluripotency associated transcription factors to contribute to maintenance of mouse embryonic stem cell self renewal. PLoS One, 8 (4), e60148. doi:10.1371/journal.pone.0060148 Sato, N., Sanjuan, I. M., Heke, M., Uchida, M., Naef, F., & Brivanlou, A. H. (2003). Molecular signature of human embryonic stem cells and its comparison with the mouse. Dev Biol, 260 (2), 404 413. Retrieved from 78859::;;;#<=>?#<@A#AFG:$%H%$*' $ Smith, A. G. (2001). Embryo derived stem cells: of mice and men. Annu Rev Cell Dev Biol, 17 435 462. doi:10.1146/annurev.cellbio.17.1.435 Storm, M. P., Bone, H. K., Beck, C. G., Bourillot, P. Y., Schreiber, V., Damiano, T., Welham, M. J. (2007). R egulation of Nanog expression by phosphoinositide 3 kinase dependent signaling in murine embryonic stem cells. J Biol Chem, 282 (9), 6265 6273. doi:10.1074/jbc.M610906200 Tai, C. I., & Ying, Q. L. (2013). Gbx2, a LIF/Stat3 target, promotes reprogramming to and retention of the pluripotent ground state. J Cell Sci, 126 (Pt 5), 1093 1098. doi:10.1242/jcs.118273 Takahashi, K., & Yamanaka, S. (2006). Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. Cell, 1 26 (4), 663 676. doi:10.1016/j.cell.2006.07.024

PAGE 69

57 Wang, X., Lu, Z., Gomez, A., Hon, G. C., Yue, Y., Han, D., He, C. (2014). N6 methyladenosine dependent regulation of messenger RNA stability. Nature, 505 (7481), 117 120. doi:10.1038/nature12730 Wang, X., Zhao, B. S., Roundtree, I. A., Lu, Z., Han, D., Ma, H., He, C. (2015). N(6) methyladenosine Modulates Messenger RNA Translation Efficiency. Cell, 161 (6), 1388 1399. doi:10.1016/j.cell.2015.05.014 Weinberger, L., Ayyash, M., Novershtern, N., & Hanna, J. H. (2016). Dynamic stem cell states: naive to primed pluripotency in rodents and humans. Nat Rev Mol Cell Biol, 17 (3), 155 169. doi:10.1038/nrm.2015.28 Woodgett, J. R. (1990). Molecular cloning and expression of glycogen synthase kinase 3/factor A. EMB O J, 9 (8), 2431 2438. Retrieved from 78859::;;;#<=>?#<@A#AFG:%$)''*" Wray, J., Kalkan, T., Gomez Lopez, S., Eckardt, D., Cook, A., Kemler, R., & Smith, A. (2011). Inhibition of glycogen synthase kinase 3 alleviates Tcf3 repression of the pluripotency network and increases embryonic stem cell resistance to differentiation. Nat Cell Biol, 13 (7), 838 845. doi:10.1038/ncb2267 Wu, D., & Pan, W. (2010). GSK3: a multifaceted kinase in Wnt signa ling. Trends Biochem Sci, 35 (3), 161 168. doi:10.1016/j.tibs.2009.10.002 Ying, Q. L., Wray, J., Nichols, J., Batlle Morera, L., Doble, B., Woodgett, J., Smith, A. (2008). The ground state of embryonic stem cell self renewal. Nature, 453 (7194), 519 52 3. doi:10.1038/nature06968 Yost, C., Torres, M., Miller, J. R., Huang, E., Kimelman, D., & Moon, R. T. (1996). The axis inducing activity, stability, and subcellular distribution of beta catenin is regulated in Xenopus embryos by glycogen synthase kinase 3 Genes Dev, 10 (12), 1443 1454. Retrieved from 78859::;;;#<=>?#<@A#AFG:+)))%%H Zeng, X., Tamai, K., Doble, B., Li, S., Huang, H., Habas, R., He, X. (2005). A dual kinase mechanism for Wnt co receptor phosphorylation and activation. Nature, 438 (7069), 873 877. doi:10.1038/nature04185 Zheng, G., Dahl, J. A., Niu, Y., Fedorcsak, P ., Huang, C. M., Li, C. J., He, C. (2013). ALKBH5 is a mammalian RNA demethylase that impacts RNA metabolism and mouse fertility. Mol Cell, 49 (1), 18 29. doi:10.1016/j.molcel.2012.10.015

PAGE 70

58 APPENDIX Equations Equation 1: pmoles= (mass of DNA in n g) x (1000 pg/ng)_______ (# of sense strand bp) x (650 Daltons ) Buffers and Reagents LC/MS Buffer c onsists of 25mM of NaCl and 2.5 mM ZnCl 2 Cellular Mediums N2A media consists of 50% DMEM (10% BGS, 1% Penicillin Streptomycin, 1% L Glutamine), 50% Opti MEM, 0.5% Pen strep, and 0.5% L Glutamine. HEK293T media consists of DMEM, 10% BGS, 1% Penicillin Streptomycin, and 1% L Glutamine. ESC Media consists of DMEM, 15% FBS, 1% Pen Strep, 1% L Glutamine, 1% Sodium Pyruvate, 1% Non essential Amino Acids. 2 mercaptoethanol (" me) and LIF were added fresh each time (1uL of 55mM me per 1mL of media and 1uL ESGRO LIF per 1mL media). IDT G Block Sequences FTO V5: ATCA TTTTGGCAAAGATGGGTAAGCCTATCCCTAACCCTCTCCTCGGTCTCGA TTCTACGAAGCGCGTCCAGACCGCGGAGGAACGAGAGCGGGAAGCTAAGAA ACTGAGGCTCCTTGAGGAGCTTGAAGACACTTGGCTTCCTTACCTGACCCCCA AAGATGATGAGTTCTATCAGCAGTGGCAGCTGAAATACCCTAAACTGGTTTT CCGAGAGGCCGGCAGCATACCAGAGGAGCTGCATAAGGAGGTCCCCGAGGC CTTTCTCACACTGCATAAGCATGGCTGCTTGTTTCGGGACGTGGTGAGGATCC AAGGCAAAGATGTGCTCACCCCAGTGTCTCGCATCCTCATCGGGGACCCAGG CTGCACCTACAAGTACTTGAACACCAGACTCTTCACGGTGCCCTGGCCCGTG AAGGGCTGCACGGTCAAGTACACAGAGGCTGAGATCGCCGCTGCATGTCAGA CCTTCCTAAAGCTCAATGACTACCTCCAGGTGGAGACCATCCAGGCC TTGGA AGAACTGGCTGTCAGAGAGAAGGCCAATGAAGACGCTGTGCCACTGTGCATG GCAGAGTTCCCCAGGGCCGGCGTGGGGCCGTCCTGCGATGATGAAGTGGACC TTAAGAGCAGAGCAGCCTACAACGTGACTTTGCTAAACTTCATGGATCCTCA GAAGATGCCCTACTTGAAAGAGGAGCCCTATTTCGGCATGGGGAAGATGGCG GTGAGCTGGCATCACGATGAGAACCTGGTGGACAGGTCAGCCG TGGCAGTGT ACAGCTATAGCTGCGAAGGCTCTGAGGATGAAAGTGAGGACGAGTCCAGCTT CGAAGGCAGAGATCCTGATACTTGGCATGTTGGTTTTAAGATCTCTTGGGACA

PAGE 71

59 TCGAGACACCAGGATTAACAATCCCTCTTCACCAGGGAGACTGCTATTTCATG CTGGATGACCTCAATGCCACCCACCAGCACTGTGTTTTGGCTGGCTCACAGCC TCGGTTTAGTTCCACTCACCGTGTGGCAGAGTGCTC AACAGGCACCTTGGATT ATATCTTAGAACGCTGTCAGTTGGCGCTGCAGAATGTCCTCAATGACTCAGAC GATGGCGACGTCTCGTTGAAATCCTTTGATCCTGCAGTTTTGAAACAAGGAG AGGAAATCCATAATGAGGTGGAGTTTGAGTGGCTGAGGCAGTTCTGGTTTCA AGGCAATCGATACAAACTTTGCACCGATTGGTGGTGTGAGCCCATGACTCAC CTGGAGGGGCTGTGGAAGAAGATGGAGAGC ATGACAAATGCGGTGCTCCGT GAAGTTAAAAGAGAGGGGCTCCCGGTGGAACAAAGGAGTGAGATTCTGTCT GCCATCCTGGTCCCGCTCACCGTGCGCCAGAACCTGAGGAAGGAGTGGCATG CCAGGTGCCAGTCCCGAGTCGTCCGGACTTTACCAGTACAGCAGAAACCAGA CTGCCGGCCATATTGGGAGAAGGATGACCCTTCCATGCCTCTGCCCTTTGACC TCACAGACGTGGTTTCCGAGCTCAGAG GCCAGCTGCTGGAAGCAAGATCCTA GAATTCCTCGAGGATA METTL3 Flag : ATCATTTTGGCAAAGATGGACTACAAGGATGACGACGATAAGGATTACAAGG ATGACGACGATAAGTCGGACACGTGGAGCTCTATCCAGGCCCATAAGAAACA GCTGGACTCGCTTCGCGAGAGATTGCAGCGGCGACGGAAGCAGGACTCTGGG CACTTGGATTTAAGGAACCCAGAAGCGGCACTGTCCCCAACCTTCCGTAGTG ATAGTCCCGTGCCTACTGCCCCTACCTCTAGCGGCCCTAAGCCCAGCA CAAC ATCTGTGGCCCCTGAACTAGCTACAGACCCTGAGTTAGAGAAGAAGTTGCTA CACCACCTCTCAGATCTGGCCTTGACCTTGCCCACTGATGCTGTTTCCATCCG TCTTGCCATCTCTACGCCAGATGCACCTGCCACTCAAGATGGGGTAGAAAGC CTTCTCCAGAAATTTGCCGCCCAGGAGTTGATTGAGGTAAAGCGAGGTCTCCT CCAAGATGATGCACATCCTACTCTTGTAACTTACGCTGACCA CTCCAAGCTGT CTGCCATGATGGGGGCTGTGGCAGAAAAGAAAGGTCTTGGAGAGGTAGCAG GGACCATCGCAGGGCAGAAACGGCGTGCAGAACAGGATTTGACTACAGTGA CCACCTTTGCCAGCTCTTTAGCATCTGGTCTGGCCTCTTCAGCATCAGAACCA GCTAAGGAGCCGGCTAAGAAGTCAAGGAAGCACGCTGCCTCCGATGTTGATC TGGAGATAGAAAGCCTTTTGAACCAACAGTCAACGAAA GAACAGCAGAGCA AGAAGGTCAGTCAGGAGATCCTAGAGCTATTAAATACCACAACAGCCAAGG AACAGTCCATTGTTGAAAAGTTTCGCTCTCGAGGTCGGGCCCAGGTGCAAGA ATTTTGTGATTATGGGACCAAGGAAGAGTGCATGAAAGCCAGTGACGCTGAC CGGCCTTGTCGCAAGCTGCACTTCAGACGAATTATCAATAAGCACACTGATG AATCTTTAGGTGACTGCTCTTTCCTTAACACATGTT TCCACATGGACACCTGC AAATATGTTCACTATGAAATTGATGCTTGTGTTGATTCTGAGAGTCCTGGCAG CAAGGAGCATATGCCAAGCCAGGAGCTTGCTCTTACACAGAGTGTTGGGGGT GACTCCAGTGCTGATCGACTCTTTCCACCTCAGTGGATCTGTTGTGATATCCG CTACCTGGACGTCAGTATCTTGGGCAAATTTGCAGTTGTGATGGCTGACCCAC CTTGGGATATTCACATGGAGCTACCGTA TGGGACATTAACAGATGATGAGAT GCGCAGGCTCAATATACCAGTGCTACAGGATGACGGCTTTCTTTTCCTCTGGG TCACAGGAAGGGCCATGGAATTGGGCAGAGAATGTCTGAACCTCTGGGGTTA TGAACGGGTGGATGAAATCATCTGGGTGAAGACTAATCAGCTGCAGCGCATC ATTAGGACGGGCCGGACGGGTCACTGGTTAAACCACGGGAAGGAACACTGCT

PAGE 72

60 TGGTTGGTGTTAAGGGAAATCCT CAAGGATTCAACCAGGGCCTGGACTGCGA TGTGATTGTAGCTGAGGTTCGTTCCACCAGTCATAAACCAGATGAAATATATG GCATGATTGAGAGACTGTCCCCTGGCACCCGCAAGATTGAGTTATTTGGACG ACCACACAATGTGCAGCCCAACTGGATTACTCTTGGAAACCAACTGGATGGG ATACACCTACTAGACCCAGATGTGGTTGCCAGGTTTAAGCAAAGGTATCCGG ACGGCATCATCTCTAAAC CTAAGAATTTATAGAATTCCTCGAGGATA FTO V5 S259_271A: ATCATCCTCGCAAAAATGGGCAAGCCCATACCCAATCCACTCCTGGGTCTGG ACTCAACTAAGCGGGTACAAACCGCAGAGGAGCGCGAAAGAGAAGCCAAAA AGCTGCGATTGCTTGAGGAGCTCGAAGACACCTGGCTCCCCTATCTTACCCCA AAGGACGATGAGTTCTATCAACAGTGGCAACTCAAGTATCCCAAACTCGTG T TTCGAGAGGCCGGAAGTATCCCAGAAGAACTCCACAAAGAAGTACCTGAGG CTTTTCTTACTCTTCACAAACATGGATGCCTGTTCAGGGACGTGGTAAGGATA CAAGGTAAAGATGTTCTTACACCAGTATCTCGCATCCTCATCGGTGATCCAGG TTGTACCTACAAATACCTCAACACAAGACTCTTCACCGTGCCCTGGCCCGTGA AGGGATGTACTGTAAAATACACAGAGGCCGAGATAGCAGCTGCTT GTCAGAC ATTCTTGAAGTTGAACGATTACCTTCAAGTCGAAACCATCCAAGCACTGGAA GAACTGGCCGTTCGGGAGAAGGCAAACGAAGATGCCGTACCATTGTGTATGG CTGAATTTCCCCGAGCCGGTGTGGGTCCAAGTTGCGATGATGAGGTTGATCTT AAGTCCCGCGCAGCTTATAATGTGACTCTCCTCAATTTCATGGACCCTCAGAA AATGCCATATCTTAAGGAGGAACCCTATTTTGGAATGGG GAAAATGGCCGTC AGTTGGCATCACGATGAGAATTTGGTCGATCGATCCGCTGTAGCAGTCTACA GCTATGCCTGTGAGGGAGCAGAGGACGAAGCTGAGGATGAAGCATCCTTTGA AGGTCGCGATCCCGATACATGGCATGTTGGTTTCAAGATAAGTTGGGACATT GAGACTCCAGGGCTTACTATCCCCCTGCACCAGGGGGACTGTTATTTTATGCT GGATGATTTGAATGCAACCCACCAACACTGCGTC CTTGCAGGATCCCAGCCA CGGTTCTCATCAACTCATCGAGTAGCCGAGTGCTCTACCGGCACACTTGATTA CATTCTTGAGAGATGTCAGCTGGCACTTCAGAACGTTCTTAACGACAGCGAT GATGGAGACGTAAGCTTGAAGTCTTTCGACCCTGCCGTGCTTAAGCAGGGTG AAGAGATACACAATGAGGTTGAGTTTGAATGGTTGAGGCAATTCTGGTTTCA AGGAAACCGCTACAAGCTGTGTACAGACT GGTGGTGTGAGCCTATGACTCAT CTGGAGGGACTGTGGAAAAAAATGGAATCTATGACTAACGCAGTGCTCCGAG AAGTAAAGAGGGAAGGGTTGCCAGTGGAACAACGATCTGAGATTCTGTCCGC TATTCTCGTACCCCTTACCGTAAGGCAGAATTTGCGAAAAGAATGGCACGCT AGGTGTCAGTCCCGCGTTGTGCGAACACTTCCCGTCCAGCAGAAACCTGACT GTAGGCCTTACTGGGAGAAGGACGA CCCATCCATGCCTCTGCCATTCGATCT GACAGACGTGGTATCTGAATTGAGGGGCCAGCTTCTGGAGGCCCGCTCCTAG AACTCCTCTAGGATA