Citation
The Use of shear-thinning hyaluronic and hydrogels to improve outcomes following acute kidney injury

Material Information

Title:
The Use of shear-thinning hyaluronic and hydrogels to improve outcomes following acute kidney injury
Creator:
Levine, Ani D.
Place of Publication:
Denver, CO
Publisher:
University of Colorado Denver
Publication Date:
Language:
English

Thesis/Dissertation Information

Degree:
Master's ( Master of science)
Degree Grantor:
University of Colorado Denver
Degree Divisions:
Department of Bioengineering, CU Denver
Degree Disciplines:
Bioengineering
Committee Chair:
Jacot, Jeffrey
Committee Members:
Soranno, Danielle E.
Magin, Chelsea

Notes

Abstract:
Acute kidney injury (AKI) is common in hospitalized patients, increases their morbidity and mortality, and predisposes them to chronic kidney disease (CKD). Herein, we utilized our ischemia-reperfusion model to investigate the efficacy of hyaluronic acid (HA) hydrogels in mitigating AKI to CKD disease progression. We hypothesized that HA hydrogels absorb proinflammatory cytokines or alternatively, they alter kidney gene expression. From our preliminary results, there is no evidence of cytokine absorption, and there is evidence of some changes in gene expression.

Record Information

Source Institution:
University of Colorado Denver
Holding Location:
Auraria Library
Rights Management:
Copyright Ani D. Levine. Permission granted to University of Colorado Denver to digitize and display this item for non-profit research and educational purposes. Any reuse of this item in excess of fair use or other copyright exemptions requires permission of the copyright holder.

Downloads

This item is only available as the following downloads:


Full Text

PAGE 1

THE USE OF SHEAR THINNING HYALURONIC ACID HYDROGELS TO IMPROVE OUTCOMES FOLLOWING ACUTE KIDNEY INJURY by ANI D LEVINE B.S ., University of Albany , 2014 A thesis submitted to the Faculty of the Graduate School of the University of Colorado i n partial fulfillment of the requirements for the degree of Master of Science Bioengineering Program 2018

PAGE 2

ii This thesis for the Master of Science degree by Ani D Levine has been approved for the Bioengineering Program by Jeffrey Jacot, Chair Dan ielle E. Soranno, Advisor Chelsea Magin Date: May 12 , 2018

PAGE 3

iii L evine , Ani D (M.S., Bioengineering Program) The Use of Shear Thinning Hyaluronic Acid Hydrogels to Improve Outcomes Following Acute Kidney Injury Thesis directed by Assistant Professor Da nielle E. Soranno , M.D. ABSTRACT Acute kidney injury (AKI) is common in hospitalized patients , increases their morbidity and mortality, and predisposes them to chronic kidney disease (CKD) . Herein, we utilized our ischemia reperfusion model to investigat e the efficacy of hyaluronic acid (HA) hydrogels in mitigating AKI to CKD disease progression. We hypothesized that HA hydrogels absorb pro inflammatory cytokines or alternatively, they alter kidney gene expression. From our preliminary results, there is no evidence of cytokine absorption , and there is evidence of some changes in gene expression. The form and content of this abstract are approved. I recommend its publication. Approved: Danielle E. Soranno

PAGE 4

iv DEDICATION I dedicate this thesis to my par ents, Ellen and Barry Levine, who always pushed me to work harder, keep learning, and never give up. Without them I would not be here. Thank you.

PAGE 5

v ACKNOWLEDGEMENTS I would like to thank Lara Kirkbride Romeo and Nataliya Skyrpnyk. Their h elp and guidance has been invaluable to my success. All animals were used in accordance with IACUC protocol # 104116(11)1D

PAGE 6

vi TABLE OF CONTENTS CHAPTER I. INTRODUCTION 1 Significance 3 Intellectual Merit 3 Specific Aims 4 II. BACKGROUND 6 Acute Kidney Injury 6 Acute Kidney Injury to Chronic Kidney Disease Transition (AKI to CKD) .. 7 Animal Model of AKI to CKD 8 Markers of Acute Kidney Injury, Inflammation, and Long Term Kidney Injury 1 1 Hyaluronic Acid Hydrogels 1 3 Stem Cells to Treat Kidney Injury 1 7 III. MATERIALS AND METHODS 1 8 Materials 1 8 Surgical Equipment 1 8 Hydrogel Pre paration 1 9 Tissue Processing 2 0 Staining 2 0 S o l u t i o n s . . 2 1 O ther Laboratory Equipment 2 1

PAGE 7

vii Methods/Experimental Approach 2 1 Study design and animals 2 1 Surgical procedures 2 2 Hydrogel formation 2 2 Blood and tissue collection 2 2 Tissue preparation 2 3 Kidney function 2 3 Protein concentration 2 3 RNA isolation and Quantitative RT PCR 2 3 Collagen 3 staining 2 4 Picrosirius red staining 2 4 Statistics 2 4 Study approval 2 5 IV. RESULTS AND DISCUSSION 2 6 Results 2 6 Changes in Kidney Func tion after AKI 2 6 Post Injury Markers of Fibrosis 2 8 Cytokine Expression at the Kidney Gene and Protein Levels 2 9 Hydrogel Analysis for Cytokine Absorption 3 1 Discussion 3 2 V. CONCLUSION AND FUTURE DIRECTIONS 3 5 Conclusion 3 5

PAGE 8

viii Future Research 3 5 REFERENCES 3 7 APPENDIX A. Table o f Primer Sequences 4 4

PAGE 9

ix LIST OF TABLES TABLE 1. 4 4

PAGE 10

x LIST OF FIGURES FIGURE 1. Schematic of Study Timeline . 9 2. Overview of Material and Study Design 1 0 3. Synthesis of Guest (Ad25 HA) and Host (CD25 HA) Macromers 1 6 4. Estimated Kidney Function over Time 2 7 5. Markers of Kidney Injury at 5 and 1 4 Days 2 8 6. Gene Expression at 5 and 14 Days 2 9 7. Pro Inflammatory Cytokines at 5 and 14 Days 3 0 8. IL 6 Expression in Plasma and Proteins at 5 and 14 Days 3 1 9. Pro Inflammatory Cytok ine Expression in Hyaluronic Acid Hydrogel 3 2

PAGE 11

xi LIST OF ABBREVIATIONS AKI Acute Kidney Injury CKD Chronic Kidney Disease HA Hyaluronic Acid AdHA Adamantane Hyaluronic Acid C D HA cyclodextrin Hyaluronic Acid PEG Polyethylene Glycol IL10 Interleukin 10 Tumor Necrosis Factor alpha Transforming Growth Factor beta MCP1 Monocyte Chemoattractant Protein 1 SMA alpha Smooth Muscle Actin MSCs Mesenchymal Stem Cells S Cr Serum Creatinine BUN Blood Urea Nitrogen IR Ischemia Reperfusion AD Anchoring Domain DDD Docking and Dimerization Domain cAMP Cyclic Adenosine Monophosphate ELISA Enzyme linked Immunosorbent Assay Sal SC Saline Subc apsular HA SQ Hyaluronic Acid Subcutaneous HA SC Hyaluronic Acid Subc apsular NT No Treatment UUO Unilateral Ureteral Obstruction

PAGE 12

1 CHAPTER I INTRODUCTION Acute Kidney Injury (AKI) is characterized by the rapid loss of kidney function (Bellomo, Kellum, & Ronco, 2012) . AKI has been reported in 7% of hospitalized patients, although the true number is believed to be muc h higher (Chertow, Burdick, Honour, Bonventre, & Bates, 2005) . Recent epidemiological studies suggest that AKI occurs in 25% of critically ill hospitalized children and over 30% of critically ill neonates (Jetton et al., 2017; Kaddourah, Basu, Bagshaw, & Goldstein, 2017) . There is currently n o treatment for AKI other than supportive care . Hyaluronic acid (HA) hydrogels have t h e p o t e n t i a l t o b e u s e d a s a treatment method for AKI (Rodell, Rai, Faubel, Burdick, & Soranno, 2015) . HA is found in the body where is naturally sequesters growth factors in the extracellular matrix (ECM) (Hortensius & Harley, 2013; Raman, Sasisekharan, & Sasis ekharan, 2005; van der Smissen et al., 2013) . As a hydrogel , the structural properties of HA allow it to be shear thinning and rapidly self healing (Rodell, Kaminski, & Burdick, 2013) . This makes it easily injectable a n d a l l o w s i t t o s t a y l o c a l i z e d t o t h e s i t e o f i n j e c t i o n . We have previously demonstrated that hyaluronic acid (HA) hydrogels improve outcomes following kidney injury in murine models of both acute and chronic kidney disease , although the mechanisms are not yet understood (Rodell et al., 2015; Soranno et al., 2016) . The HA hydrogel proposed here has already been used to deliver interleukin 10 (IL 10) and anti in a murine model of c hronic kidney disease (CKD) with a reduction in fibrosis in all study groups (Rodell et al., 2015) . We have also utilized these hydrogels to deliver interleukin 10 (IL 10) in our murine model of AKI. Importantly, even the control groups that received HA alone, without additional therapeutics, demonstrated an

PAGE 13

2 improvement in functional and histological outcomes. We have also demonstrated that delivery of HA hydrogel alone, either under the kidney capsule or subcutane ously, decreases the degree of systemic inflammation associated with AKI although the mechanism is unknown (Rod ell et al., 2015; Soranno et al., 2016) . The overall goal of this project is to investigate the potential mechanism(s) by which HA hydrogels improve renal and systemic outcomes following AKI . We consider t w o potential mechanisms herein: 1) Do HA hydrogel s quench pro inflammatory cytokines?, and /or 2) Do HA hydrogels alter kidney gene expression? Utilizing our murine model of acute to chronic kidney disease, HA was injected either under the left kidney capsule or subcutaneously above the left kidney , three days after AKI via bilateral ischemia reperfusion injury and retrieved upon sacrifice for analysis. Enzyme linked Immunosorbent Assays (ELISA) were performed to determine if the hydrogel absorb ed pro inflammatory cytokines. Measures of k idney function wer e assessed after AKI with and without hydrogel treatment to test functional outcomes . With the success of this animal study, the next focus will be on using the hydrogel to deliver mesenchymal stem cells (MSCs) to t he injured kidneys. MSCs can be obtained from adipose tissue and have been shown to improve kidney regeneration (Cantaluppi et al., 2013; Humphreys & Bonventre, 2008; Xing et al., 2014) . Delivering MSCs clinically has proven to be a challenge due to decreased c ell viability and ineffective or harmful delivery method s (Hu et al., 2013; Humphreys & Bonventre, 2008; Tögel & Westenfelder, 2012) . By encapsulating MSCs in hydrogels , we hope to improve cell viability a nd target cells to the site of injury. We plan to test this treatment with t he future goal of using HA hydrogels coupled with MSCs as an effective treatment for patients suffering from AKI.

PAGE 14

3 Significance The s uccessful completion of this study could signi ficantly improve the care of patient s suffering from kidney disease. Acute kidney injury (AKI) is common and leads to chronic kidney disease ( C KD) (Hsu, 2012) . Kidney disease is the 9 th leadin g cause of death in the United States . It affects 26 million adults and care for patients with mild to severe CKD costs Medicare alone 49 billion dolla rs a year (Honeycutt et al., 2013) . In our prior studies, we have demonstrated that the use of HA hydrogels to treat AKI can improve kidney function and mitigate renal and systemic inflammation (Rodell et al., 2015; Soranno et al., 2016) . Therefore, we believe our research holds translational promise to lower the risk of morbidity and mortality, subsequently shortening the duration of hospital stays, and reducing the financial burde n to patients and insurance companies. Therefore, an effective treatment of AKI could also reduce the prevalence of CKD. CKD costs Medicare and Medicaid an estimated 49 billion dollars per year (Honeycutt et al., 2013) . Ideally, suc h a therapeutic option could reduce the number of deaths caused by kidney disease and its associated co morbidities each year and significantly decrease the number of people on the kidney transplant wait list. Intellectual Merit This research propos es a novel treatment for AKI which will reduce kidney injury and prevent the progression of CKD. There is currently no treatment for AKI and current clinical practices only work to control sequelae . HA hydrogels are just beginning to be understood for their u se as a treatment in clinical settings. This research will allow for a greater understanding of injectable biomaterial for therapeutic treatment of diseases.

PAGE 15

4 S pecific Aims Specific Aim One: To determine kidney gene expression, kidney function , and kidney histological changes following A cute K idney Injury . Hypothesis: We hypothesize that kidney function will be impaired, pro inflammatory cytokines will be upregulated and histological changes will be observed after bilateral ischemia reperfusion in mice. Ap proach: M ice underwent bilateral ischemia reperfusion injury or sham operation . Serum creatinine and BUN was tested 1 day after injury to make su re animals in the AKI group had adequate injury (s erum Cr > 0.7 mg/dL or BUN > 70 mg/dL) (Soranno et al., 2016) . A KI a nim als that did not meet this threshold were excluded from the study . Markers of kidney inflammation and fibrosis (KIM1, NGAL, MCP 6) were assessed in the serum, urine and tissue 5 and 14 days after injury. Specific Aim Two: Optimi ze subcapsular delivery of injectable Hyaluronic Acid (HA) hydrogels to treat kidney disease . Hypothesis: We hypothesize that injecting HA hydrogels dorsally using a 28G insulin syringe will be most effective for sub capsular delivery. Approach: Utilizing Adamantane Hyaluronic Acid ( AdHA ) and cyclodextrin Hyaluronic Acid (Cd HA ) synth esized as previously described, s elf assembling, injectable guest host hydrogels were mixed and sterilized under a cell culture hood on the day of injection to prevent degradation before use (Loebel, Rodell, Chen, & Burdick, 2017) . The injection process was

PAGE 16

5 optimized by comparing multiple syringe types and injection methods to determine the most effective, most accurate and least injurious method. Specific Aim Three: To determine the effect hydrogel delivery has on kidney gene expression, functional, and histological changes following AKI. Hypothesis 1: We hypothesize that injectable HA hydrogels reduce inflammation by absorbing the pro inflammatory cytoki nes MCP 6 . Hypothesis 2: We hypothesize that injectable HA hydrogels reduce inflammation by altering renal gene expression to downregulate production of pro inflammatory cytokines . Approach: M ice underwent bilateral ischemia reperfusion in jury or sham operation. Three days after the procedure HA hydro gel was injected under the kidney capsule of sham operated mice, and mice with AKI . The hydro gel was recovered upon sacrifice , 5 days after the procedure and markers of renal function , kidney g ene expression, histological changes and absorption of cytokines by the hydrogel were compared.

PAGE 17

6 CHAPTER II B ACKGROUND Acute kidney Injury (AKI) increases the risk of mortality by up to 50% in at risk populations and pre disposes patients to the develop ment of chronic kidney disease (CKD) (Ali et al., 2007) . AKI is defined as an increase in serum creatinine (SCr) greater than 0.3 mg/d L within 48 hours; or an incre ase in SCr to greater than 1.5 times baseline, which is known or presumed to have occurred within the prior 7 days; or a urine volume less than 0.5 mg/kg/hr for 6 hours AKI Guideline_C ass . There are no therapies available that can attenuate AKI or expedite recovery, making the only course of action supportive treatment (Bellomo et al., 2012) . Hyaluronic a cid hydrogels show promise as a potential treatment for kidney disease (Rodell et al., 2015) . This study focuses on the link between AKI and CKD, and why HA hydrogels are effective in abating the AKI to CKD transition . We hypothesize that hyaluronic acid hydrogels injected subcapsularly will absorb pro inflammatory cytokines, and reduce macrophage infiltration and apoptosis. Alternatively, hyaluronic acid hydrogels may reduce the production of pro inflammatory cytokines by altering renal gene expression . Acute Kidney Injury Acute kidney inj ury (AKI) affects more than 1.6 million people per year in the United States alone (Bellomo et al., 2012) . In critically ill neonates , those with AKI were 3 6 times more likely to die during their hospital stay and those who survived spent on average 10 more days in the intensive care unit (Jetton et al., 2017) . Prior epidemiological studies were limited by the lack of a consensus definition of AKI, however, the field has now settled on the Kidney Disease

PAGE 18

7 Improving Global Outcomes (KDIGO) criteria . AKI is characterized by the rapid loss of kidney function. It is diagno sed by the accumulation of the nitrogen metabolism end products urea and creatinine (Bellomo et al., 2012) , a nd/or a reduction in urine output . Clinically there are no specific therapies that can attenuate AKI or expedite recovery. Diagnosing AKI can be difficult since patients are asymptomatic until there is an extreme loss of function and many patients come to the hospital with existing AKI. When the diagnosis does occur clinically it is usually after another acute illness or in a high risk context, such as after sepsis or bleeding. Patients being treated for other health problems can get AKI from the use of n ephrotoxic drugs. With drugs contribut ing to roughly 20% of AKI seen in clinical settings, especially in critically ill patients (Bellomo et al., 2012) . Due to thes e factors, many studies focus on preventive care and clinical strategies to attenuate AKI (Chertow, Palevsky, & Greene, 2006) . Acute Kidney Injury to Chronic Kidney Disease Transition (AKI to CKD) AKI has been linked to an increased risk of chronic kidney disease (CKD) (Bellomo et al., 2012) . Chronic kidney disease is categorized the presence of kidney damage which causes decreased function. There are 5 stages of the disease with each higher stage leading to lower quality of life and increased chance of mortality. Treatment for stage 5, or end stage kidney disease, includes dialysis or kidney transplantation, both of which are costly and have poor long term outcomes. The aging population and the obesity epidemic increase the risk of CKD , making it an increasing public health burden (Webster, Nagler, Morton, & Masson, 2017) . With the development of an effe ct ive treatment for AKI, we hope to lower the risk of CKD and

PAGE 19

8 improve outcomes for patients. Our previous studies s how that h yaluronic acid hydrogels significantly decrease BUN, creatinine, and serum IL 6 28 days after AKI. This demonstrates that HA hydrog els have the potential to treat AKI (Rodell et al., 2015; Soranno, Lu, Weber, Rai, & Burdick, 2014) . Animal model of AKI to CKD We used a bi lateral ischemia reperfusion (IR) model of kidney injury (Figure 1) . IR is the tissue damage caused when blood supply returns to tissue after a period of ischemia or lack of oxygen (Kalogeris, Baines, Krenz, & Korthuis, 2012) . The peak of injury is 24 hours post IR, followed by a period of recovery. This model is ideal f or AKI because it suffici ently models the short and long term effects of AKI, as well as, the transition from AKI to CKD (Le Clef, Verhulst, . W e defined AKI as a serum creatinine > 0.7 mg/dL and /or blood urea nitrogen (BUN) > 70 mg/dL one day post surgery (Soranno et al., 2016 ) . Animals that did not reach this threshold were excluded from the study. We chose to focus on 5 and 14 day time points due to their relevance for studying acute injury (5 day) and the transition to chronic kidney disease (14 day). By day 5, animals with severe enough injury cannot completely functionally recover on their own giving us the opportunity to better understand the shor t term effect of hydrogel treatment. By day 14, animals have either recovered on their own or started the transition to CKD. This allows us to study a more long term effect the hydrogel treatment may have. An alternative model , u nilateral ureteral o bstruction (UUO) causes progressive injury making it an ideal model for studying progressive kidney diseases. Due to complete ureter al obstruction, changes in renal function could not be measured in the affected kidney (Soranno et al., 2016) , thus bilateral IR is superior for studying the functional outcome of hydrogel

PAGE 20

9 therapy. Treatment of 15 uL of HA hydrogel was injected either subcutaneo usly or under the kidney capsule of the left kidney 3 days post injury (Figure 2 B ) . Due to the size of murine kidneys, 15 uL is close to the upper limit of how much hydrogel can fit under the capsule without leaking out. Because of the inherent weakness of r eliance on the current de rigue ur biomarker of kidney function, serum Creatinine, most patients are not diagnosed with AKI until 2 3 days post injury , making the 3 day time point highly relevant. In a similar study on chitosan gel, animals were treated 1 0 minutes post IR (Gao et al., 2012) . Although they found success with this treatment, it is highly unlikely that a patient would be treated so quickly post injury in a clini cal setting making our method more clinically feasible .

PAGE 21

10 Our prior work demonstrated that unilateral treatment with HA hydrogel improved outcomes and had beneficial effects in both kidneys . This is clinically mo re feasible than delivering the HA hydrogel bilaterally . Subcutaneous delivery also showed beneficial effects

PAGE 22

11 although those effects were less substantial (Rodell et al., 2015) . These findings led us to focus on subcapsular delivery of hydrogel. Markers of A cute Kidney Injury , Inflammation, and Long Term Kidney Injury BUN, c reatinine , Kim1, and NGAL are indicators of ki dney function. With in our study, BUN and creatinine are used to determine if injury is significant enough for inclusion in the study while Kim1 and NGAL are more specific markers of injury . BUN measures how much urea nitrogen is removed from the blood by the kidneys. It is produced in the liver and is a waste product of protein digestion. BUN is an indication of overall renal health, but not a direct marker as it can be affected by dehydration , diet and catabolism . The normal range is 6 20 mg/dL which is significantly lower than our injury inclusion criteria of 70 mg/dL or higher (BUN) test 2018 ; Gowda et al., 2010) . Creatinine is a breakdown product of creatinine phosphate in muscle and is excreted in urine at a co nstant rate when the kidneys are functioning properly. It is a marker of dehydration. There is no average range because age, gender, muscle mass and medication use all play a role in the amount of creatinine present. Levels of serum creatinine can spike w hen kidney function is diminished . Kim1 is a known proximal tubule epithelial damage marker . It is the protein most highly upregulated in injured kidneys and it helps restore morphological integrity and function to the kidney after AKI . The proximal tubule is very sensitive to ischemic injury making Kim1 and ideal marker for analysis within our study (Han, Bailly, Abichandani, Thadhani, & Bonventre, 2002) . NGAL is produced by the distal tubule during kidney injury is secreted in the blood and urine after AKI. It is one of the most upregulated genes in early post ischemic kidneys making it a n ideal measure of injury. NGAL

PAGE 23

12 has been found in both animal subjects and clinically making it a relevant biomarker for translational research (Devarajan, 2008) . Col la gen 1, Col SMA are markers of long term kidney injury and cause fibrosis. Fibrosis is important because it is a hallmark of chronic kidney disease. Collagen is the main structural protein in animals . Collagen 1 is the most abundant collagen found in the human body. It is found in scar tissue and is the end product when tissue heals . Collagen 3 is associated with collagen 1 and is found in connective tissues . SMA is a marker of myofibroblast formation . It is strongly expressed only in the blood vessels of healthy kidneys. When expressed interstitially, SMA was associated with reduced renal function (Novakovic et al., 2012) . Studying these markers allows us to better understand the transition from AKI to CKD within our model. P ro inflammatory and pro fibrotic cytokines MCP 1, TGF 6 were measured to see the effect hydrogel treatment had on gene and protein expression in the left kidney. MCP 1 recruits monocytes, memory T cells, and dendritic cells to the site of inflammation (Carr, Roth, Luther, Rose, & Springer, 1994) . It is uniformly upregulated in ischemic AKI and is highly sensitive (Munshi et al., 2011) . TGF acrophages at higher levels in the presence of inflammatory stimuli (Massagué, 2012) . It plays a key role in wound healing and tissue repair by stimulating the production of matrix proteins and inhibiting their degradation. When found in very large amounts, TGF excessive tissue fibrosis (Branton & Kopp, 1999) . TNF during the acute phase of systemic inflammation (Locksley, Killeen, & Lenardo, 2001) . It can also be produced by renal cells including mesangial cells , glomerular epithelial cells and tubular

PAGE 24

13 epithelial cells. It is a mediator of the innate and adaptive immune response (Vielhauer & Mayadas, 2007) . IL 6 is secreted by T cells and macrophages to stimulate immune response after inflammation (Heinrich et al., 2003) . It mediates systemic sequelae and drives morbidity and mortality caused by AKI. In ischemic injury, IL 6 has been found in high levels both locally and systemically (Su, Le i, & Zhang, 2017, p. 6) . Hyaluronic Acid Hydrogels Hydrogels are polymers with a high water content that are biocompatible and can be manipulated to have specific mechanical and structural properties. They can be directly injected into tissues and are an ideal delivery vessel for drugs, cytokines, and stem cells. Their ability to be delivered locally allows treatment to be targeted, limiting systemic side effects. (Nimmo, Owen, & Shoichet, 2011; Soranno et al., 2014) . Properties can be manipulated in situ by changes in pH, temperature, and salinity allowing hydro gels to release cargo at specific locations and times based on the needs of treatment (Cohn, Lando, Sosnik, Garty, & Levi, 2006; Kim, Cho, Odkhuu, Park, & Song, 2013; Maitz, 2015; Pok et al., 2014; Soranno et al., 2014) . These characteristics make hydrogels an attractive option for a targe ted treatment for kidney injury. One challenge of using polymers for treatment is safe and effective delivery. To combat this problem, shear thinning hydrogels have been developed. These hydro gels become liquid with the application of shear stress, then return to solids once that stress is removed. This allows these hyd r o gels, and any cargo they encapsulate, to be injected via syringe into the desired location and then return to a solid so that they remain at the target site (Lu, Soranno,

PAGE 25

14 Rodell, Kim, & Burdick, 2013) . Shear th inning allows for minimally invasive and targeted delivery and can feasibly utilize techniques like ultrasound guided percutaneous renal biopsy a common outpatient procedure performed on patients. There are many biocompatible chemicals incl uding polyeth ylene glycol (PEG), chitosan and hyaluronic acid (HA) that have been used make hydrogels for therapeutic treatment and drug delivery (Gao et al., 2012; Lu et al., 2013; Soranno et al., 2014) . Hyaluronic acid is ideal candidate for treating kidney injury because: 1) HA is a naturally occurrin g glycosaminoglycan that is found throughout the body, most notably in connective tissue , 2) it naturally sequesters growth factors in the extracellular matrix, 3) HA can be chemically modified to form a hydrogel that can be directly injected into tissues, and 4 ) d ue to its prevalence in the human body it does not provoke an immune response (Burdick & Prestwich, 2011; Hortensius & Harley, 2013; Leach , Bivens, Patrick, & Schmidt, 2 0 0 2 ; Raman et al., 2005; Rodell et al., 2015; Soranno et al., 2016; van der Smissen et al., 2013) . Importantly , our prior studies have shown HA biomaterials reduce inflammation a nd fibrosis following injection under the kidney capsule (Rodell et al., 2015; Soranno et al., 2016) . Past hydrogels had problems with loss of cargo due to slow self heal ing after injection or required photo or redox initiated polymerization to for hydrogels making them difficult to use (Loebel et al., 2017) . Now we utilize shear thinning injectable hydrogels composed of hyaluronic acid (HA) modified by adamantane (Ad) and cyclodextrin (CD) . They form a guest host pair to enable hydrogel assembly, shear thinning behavior for injection, and controlled therapeutic delivery (Mealy, Rodell, & Bu rdick, 2015; Rodell et al., 2013; Soranno et al., 2016) . The guest host mechanism works when two or more chemicals form non covalent interactions.

PAGE 26

15 Specifically, for our gel, cyclodextrins hydrophobic interior cavities have a high affinity for obic moieties causing rapid self assembly with the association constant on the order of 1 X 10 5 M 1 . Due to these weak interactions, the hydrogel is able to separate components and briefly return to a liquid when acted upon by a shear force (Rodell et al., 2013) . Adamantane and cyclodextrin were chosen because of their wide use in the pharmaceutical industry and FDA approval making them ideal for a treatment eventually intended for human use (Rodell et al., 201 3) . These hydrogel s use the hydrophobic interactions of adamantane, as the guest, and cyclodextrin, as the host, to form a self assembling hyaluronic acid hydrogel. The polymer preparation described here uses controlled functionalization of HA and results in guest and host polymers with reproducible modifications and the potential for sca lable synthesis (Mealy et al., 2015; Rodell et al., 2013) . To strengthen the mechanical properties of the hydrogels, secondary covale nt cross linking is introduced to stabilize the network. Secondary cross linking reduces the rate of hydrogel erosion and concurrent cargo release (Loebel et al., 2017) . CD HA and Ad HA macromer s which were liquids were mixed in solut ion where they rapidly formed into a pseudoplastic hydrogel (Figure 2A) . biocompatibility make it the best choice for treatment. The HA hydrogel we used in our study ha d a 1:1 ratio of guest to host groups and 25% polymer modification for each group. A 3.5wt% hydrogel was chosen due to it having an optimal cross linking density. For hydrogels with 2.5wt% or lower the hydrogel did not fully form and hydrogels above 10wt % had components that were too viscous and did not combine

PAGE 27

16 well to form a hydrogel. Hydrogels with higher wt% required a greater force for shear thinning to occur, while greater polymer modification with guest and host groups decreased the required shear stress . Hydrogel degradation exponentially increased within the first ten days with 40% of the hydrogel lost by day 2 (Rodell et al., 2013) . Synthesis of guest and host components can be seen in Figure 3. A study was done where the HA hydrogel in conjunction with interleukin 10 was given to mice following acute kidney injury. Sora n no et al. found that mi ce treated with HA hydro gel alone had statistically lower serum creatinine and BUN, both indicators of AKI, than untreated mice. This lead to the conclusion that HA hydrogel alone may have a beneficial effect on kidney function recovery following ischemic AKI (Sor anno et al., 2016) . Numerous o ther groups who

PAGE 28

17 have utilized different injectable hydrogels have also shown an improvement in renal outcomes, even when delivered alone without any additional therapeutics (Gao et al., 2012; Lu et al., 2013; Maitz, 2015; Tsurkan et al., 2013) . Herein, we aim to determine the mechanism of the hydrogels protective effects, utilizing our shear thinning HA hydrogels. We hypoth esize that the hydrogels adsorb pro inflammatory cytokines, or alternatively, directly affect gene expression to reduce pro inflammatory cytokine synth e sis . Stem Cells to Treat Kidney Injury Mesenchymal s t e m c e l l s a r e m u l t i p o t e n t s t e m c e l l s t h a t c a n b e derived f r o m a d i p o s e t i s s u e a n d h a v e a n t i i n f l a m m a t o r y a n d a n t i f i b r o t i c p r o p e r t i e s (Zarjou, Sanders, Mehta, & Agarwal, 2012) . W i t h i n t h e b o d y , t h e y s e r v e a s a n i n t e r n a l r e p a i r s y s t e m ( " S t e m C e l l I n f o r m a t i o n " , 2016) . M S C s show promise for regenerating damaged tissues although harsh environment at the site of damage and stress from delivery lead to low survival rates (Lei, Gojgini, Lam, & Segura, 2011) . In vivo stem cells are found in niches comprised of extracellular matrix, proteins and supporting cells which provide biochemical and biophysical cues as to what function the stem cells should perform. To mimic these niches, hydrogel scaffolds can be used (Lei et al., 2011) . Increa sed stem cell survival and stem cell localization has been seen in multiple hydrogel scaffolds (Bakota, Wang, Danesh, & Hartgerink, 2011; Burdick & Prestwich, 2011; Lei et al., 2011) . Hydrogels can be tailored to optimize cell survival, proliferation, mobility, and delivery of treatment for each specific treatment (Lei et al., 2011; Marklein, Soranno, & Burdick, 2012) . In prior studies, treatment using stem cells encapsul ated in HA hydrogels have led to the complete repair of damage to the target area (Burdick & Prestwich, 2011) .

PAGE 29

18 CHAPTER III MATERIALS AND METHODS Materials Surgical Equipment Sofsilk 4 0 Vicryl 5 0 Small forceps Rat tooth forceps Scissors Driver Hemostat Clamps Clamp Applicator Altalube Scale Lab tape Peripads Lamp

PAGE 30

19 Heating pad s Q tips Betadine Alcohol swabs Gauze Thermometer Razor Buprenorphine/Saline 1:10 dilution Ketamine Xylazine Bupivacaine Hydrog el P reparation Tissue culture hood (e.g., Thermo Fisher Scientific 1300 Series Class II, Type A2 biological safety cabinet) Steri le, individually wrapped 0.5 ml syringes, 1/2 cc, with attached needle (27 gauge × 1/2 inch (e.g., BD, cat. no. 305620) UV lamp (e.g., EXFO OmniCure Series 1000 with a 320 390 filter) Hyaluronidase from bovine testes (Sigma Aldrich, cat. no. 3506; store at

PAGE 31

20 Tissue Processing Leica Biosystems MR2245 Microtome Leica Peloris II Tissue Processor Leica HistoCore Arcadia Tissue Embedder Paraffin wax Staining Leica Aperio ScanScope Citrate Buffer 750 uL Hydrogen Peroxide (30%) in 250 mL Methanol (0.3%) 1° A ntibody g oat anti type III collagen antibody (Southern Biotech, Birmingham, AL) 2° Antibody rabbit anti goat horseradish peroxidase (Dako, Carpinteria, CA) Background Sniper (Biocare Medical, Cat # SKU: BS966) Chromogen (DAB kit (Vector Labs, Cat # SK 4100)) Reagent Ref # S3309) Picro sirius Red Stain Kit (Abcam, Cat # ab150681) Cytoseal XYL (Richard Allan Scientific, Ref # 8312 4)

PAGE 32

21 Solutions 10% Formalin 70% 10 0% Ethanol Xylene Sterile PBS O ther Laboratory E quipment Sterile 1.5 , 2 , 15 and 50 ml conical (micro ) centrifuge tubes Micropipettes and tips Sterile syringes and needles Refrigerator set to 4 °C Microcentrifu ge (e.g., Eppendorf Refrigerated Microcentrifuge; Eppendorf, model no. 5417R) Vortex mixer (e.g., Fisher Scientific, cat. no. 02 215 414) Tube holder (e.g., Fisher Scientific, cat. no 11 676 363) Methods/Experimental Approach Study design and animals . 9 w eek old male BALB/c mice were procured for this study. Eight cohorts were studied (5 and 14 days, n= 3 9): AKI operation , sham operation, AKI operation with saline sub capsular , sham operation with saline sub capsular , AKI operation with HA sub capsular , sham operation with HA sub capsular , AKI operation with subcutaneous HA , sham operation

PAGE 33

22 with subcutaneous HA. Sub capsular i njections were done into the left kidney via retroperitoneal approach 3 days after the initial ischemia reperfusion or sham operations. Unt reated sham mice controlled for the surgical procedure. Sham mice treated with saline subcapsular, HA subcapsular, or subcutaneous HA control for any inflammation or injury from the delivery of the therapy. Animals were maintained for the study duration wi th food and water provided ad libitum . Surgical procedures . Ischemic AKI was induced by bilateral clamping of renal pedicle s for 28 min on a heating pad set to medium via abdominal approach . Sham surgery consisted of the same procedure without clamping the renal pedicle s . All mice were given 0.1 mL of ketamine/xylazine prior to surgery and 1.0 mL of buprenorphine upon completion. Mice were given soft chow for 1 day post surgery and left on a heating pad set to medium for 3 days post surgery. Hydrogel format ion. Sodium hyaluronic acid, 66 99 kDa (Lifecore, cat. no. HA 60K; store it Ad HA and CD HA were synthesized as previously described (Loebel et al., 2017) . Ad HA and CD HA were sterilized via UV light for 15 minutes on each side of the tube then individually dissolved in sterile PBS and combined. Physical cross linking occurred spontaneously upon mixing by manually stirring. This ensured a homogenous hydrogel which was then briefly centrifuged to remove entrapped air and transferred to the back of a syringe for injection. The polymer was freshly prepared prior to injection to prevent degradation . Blood and tissue collection . On postoperative day 1 , blood was collected via retro orbital venipunctu re and serum BUN and serum Cr were measured to confirm AKI. Five days and

PAGE 34

23 fourteen days following the AKI procedure, mice were sacrificed via cardiac puncture . Serum, urine, and tissue were collected for analysis at the time of death. Blood samples were ce ntrifuged at 4 ,000 g for 10 min , plasma was collected, and then was centrifuged again at 4 ,000 g for 1 min with final plasma collected for analysis. Tissue p reparation. At the time of animal sacrifice , the kidneys, liver, spleen, lung, heart, and gastrocn emius were collected. Half of each kidney was flash frozen in liquid nitrogen then stores at 80 °C until processing, while the other half of each kidney was collected, formalin fixed, and paraffin embedded. Kidney function. Kidney injury was evaluated wi th plasma creatinine (Pointe Scientific) and BUN ( DIUR 100) (BioAssay Systems, Hayward, CA, USA) per manufacturer instructions. Protein concentration tissue lysates by ELISA (R&D systems) as per manufacturer instructions. RNA isolation and q uantitative RT PCR. RNA was isolated from flash frozen kidney halves cDNA synthesis was performed, as described previously (Ch iba et al., 2016) . RNA extracted with RNA Bee reagent (TEL TEST, Inc., Friendswood, TX). RNA quantification and quality was determined using a NanoDrop 2000c instrument (Thermo Fisher Scientific, Waltham, MA). cDNA was amplified and labeled using SYBR Gre en Supermix PCR (Bio Rad, Hercules, CA). Gene expression is expressed as relative gene expression calculated using the 2^ ddCT method, as described (Schmittgen & Livak, 2008) . Gapdh mRNA was used as a loading control. Primer sequences can be found in Appendix A.

PAGE 35

24 Collagen 3 staining . Immunohistochemistry for collagen type III was performed on kidney tissue following standard protocols using goat anti type III collagen antibody (Southern Biotech, Birmingham, AL) (1:50) for 3 h at 4°C followed by rabbit anti goat horseradish peroxidase (Dako, Carpinteria, CA) (1:200) for 45 min. Slides were washed, dipped in hematoxylin, and dipped in running tap water. The slides were dehydrated, then mounted with ProLong Gold antifade r eagent (Invitrogen P36931) and left to dry overnight. Twenty cortical images at 20X magnification were obtained per sample and imaging software (Aperio) was used to analyze images for a positive pixel count hue wi d th of 0.7. The % positivity was calculated for each field. Picrosirius r ed staining . S taining was performed on kidney tissue. Four micron paraffin sections were deparaffinized and rehydrated in changes of xylene and ethanol . Slides were incubated for 1 hour in Sirius red F3B (Sigma), then washed in two changes of acidified water. They were dehydrated in ethanol and xylene and mounted with ProLong Gold antifade reagent (Invitrogen P36931). Imaging software (Image J) was used to calculate the percent area of cortical fibrosis of each sample defined by the intensity of red stain . Statistics . Data is reported as means ± standard deviations (SD). For in vitro characterization, comparison between groups was performed b y student's t test with two tailed criteria. For the histological analysis, statistical significance was determined by one way ANOVA with Bonferroni post hoc correction to account for multiple comparisons and post hoc testing for comparison between groups. For all studies, significance was determined at P < 0.05 using Graph Pad Prism 5 software.

PAGE 36

25 Study approval. All experiments were conducted with adherence to the National Institute of Health Guide for the Care and Use of Laboratory Animals. The animal proto col was approved by the Animal Care and Use Committee of the University of Colorado at Denver.

PAGE 37

26 CHAPTER IV RESULTS AND DISCUSSION Results Changes in Kidney Function after AKI We measured creatinine and BUN one day post procedure ( ischemia reperfusion or sham) surgery to determine if mice in the experimental AKI group received adequate kidney injury ( SCr > 0.7 mg/dL and/or BUN > 70 mg/dL ) for inclusion in the study. As expected, both creatinine and BUN levels for all AKI mice increased to above the thresh old on day one post injury. Average BUN and creatinine levels for AKI HA SQ and AKI HA SC were higher than AKI NT and AKI Sal SC at day one post injury (Figure 4 A D ). Serum c reatinine levels normalized by day 5 for all AKI groups although creatinine was sl ightly elevated for all AKI groups when compa red to all sham groups (Figure 4 A) . By day 14, there was no difference in creatinine levels between all sham and AKI mice (Figure 4 B). D ay 5 and d ay 14 mice treated with Sal SC, HA SQ and HA SC had no statistica lly significant difference in creatinine levels when compared to NT mice (Figure 4 A B ). Day 5 AKI mice recovered from the initial spike in BUN on day 1 , altho ugh BUN remained elevated at day 5 with no significant difference between NT, Sal SC, H A SQ, and H A SC groups (Figure 4 C). At d ay 14 , all AKI mice still had an elevated BUN when compared to sham (Figure 4 D ).

PAGE 38

27 Kidney gene expression of Kim1 and NGAL were measured to further investigate the effect of AKI . On day 5 and day 14 Kim1 was highly upregulated i n all AKI groups. There was no significant difference between AKI NT, AKI Sal SC, AKI HA SQ and AKI HA SC treatment groups . Kim1 expression remained constant between day 5 and day 14 sham groups but significantly decreased between day 5 and day 14 AKI gro ups ( Figure 5 A). NGAL expression increased in all AKI groups on day 5 and day 14 with no difference between NT, Sal SC, HA SQ and HA SC groups. On day 14, NGAL expression remained elevated with no statically relevant difference between AKI treatment group s (Figu re 5 B) .

PAGE 39

28 Post Injury Markers of Fibrosis SMA are markers of long term kidney injury and result in fibrosis . Expression of mRNA levels of Col 1 increased in all day 5 AKI groups with no statistical difference between NT, Sal SC, HA SQ and HA SC groups . At d ay 14 , Col 1 remained el evated in all AKI mice at the same level as day 5 when compared to sham mice in all treatment groups (Figure 6 A). Day 5 and day 1 4 Col 3 gene expression significantly increased in all AKI groups with no difference between NT, Sal SC, HA SQ and HA SC treatme nt groups . Sham and AKI mice at both time points had the same levels of Col3 gene expression (Figure 6 B ) . SMA expression increased for NT, Sal SC, HA SQ and HA SC AKI groups at both 5 and 14 days compared to NT, Sal SC, HA SQ and HA SC sham groups , although the re was no difference in expression when comparing both time points . There was no statistical differ ence between AKI treatment groups SMA at day 5 and day 14 (Figur e 6 C). Col1 and Col3 gene expression was 10 fold higher in NT, Sal SC, HA SQ and HA SC SMA within the sam e groups (Figure 6 A C).

PAGE 40

29 Cytokine Expression at the Kidney Gene and Protein Levels MCP 1 , TGF , TNF and IL 6 are pro inflammatory and pro fibrotic cytokines. MCP 1, TGF were measure on day 5 and day 14 mice at the mRNA and protein levels. IL 6 levels were measured in plasma and kidney tissue . mRNA level of MCP 1 was highly expressed in NT, Sal SC, HA SQ and HA SC AKI groups when compared to sham groups with no significant difference between 5 and 14 day samples . There was no significant di fference between NT, Sal SC, HA SQ and HA SC treatment group s for both sham and AKI mice (Figure 7 A). At the protein level, MCP 1 was highly expressed in all groups at day 5 and day 14. There was no si gnificant difference between NT, Sal SC, HA SQ and HA SC treatment groups . Protein expression remained constant between day 5 and day 14 sham mice, but day 14 expression of MCP 1 was higher than day 5 expression (Figure 7 D). At the mRNA level, TGF was upregulated in NT, Sal SC, HA SQ and HA SC AKI groups at day 5 and day 14 with no significant difference between groups (Figure 7 B). At the protein le vel, TGF AKI groups at day 5 and day 14 with higher expression at day 5 when compared to sham groups. At day 5, Sal SC and HA SQ AKI groups shows significantly higher TGF expression than the NT AKI group (Figure 7 E ). TNF was highly expressed in NT, Sal SC, HA SQ and HA SC AKI groups at the mRNA level at day 5 and 14 with slightly higher expression on day

PAGE 41

30 14 . There was no significant difference between NT, Sal SC, HA SQ and HA SC AKI or sham groups (Figure 7 C) . However, p rotein level s of TNF were not upregulated for any AKI groups (Figure 7 F ). Plasma IL 6 was slightly upregulated in NT, Sal SC, HA SQ and HA SC AKI groups at day 5 when compared to sham groups with no d ifference between AKI groups . B y day 14 there was no difference in IL 6 expression between all AKI and all sham groups (Figure 8 A). At the protein level, IL 6 was expressed in higher levels in NT, Sal SC, HA SQ and HA SC AKI groups at day 5 and day 14 . At day 5, the AKI Sal SC group showed statistically lower expression than the AKI NT group. At day 14, there was no statistical difference between AKI treatment groups (Figure 8 B) . MCP 1 and TGF 6 and TNF (Figures 7 8 ) .

PAGE 42

31 H ydrogel Analysis for Cytokine Absorption HA hydrogels have previously been shown to improve renal outcomes (Soranno et al., 2016) . We hypothesized that the HA hydrogels may improve outcomes by immune quenching, in other words, by absorbing pro inflammatory cytokines. To better understand this mechanism of action, hydro gel was excised from the left kidney of treated mice 2 days post injection , then dissolved in 1mg/mL hyaluronidase a nd frozen for analysis. For kidney samples where the hydro gel could not be located, the entire kidney capsule was collected and processed following the same method used for the hydro gel excision . The left kidney capsules of unmanipulated, healthy mice wer e also collected to control for any endogenous capsular cytokines . Based upon the high expression at the protein level ( Figure 7D, Figure 8 B ) , we chose to analyze the hydrogel for MCP 1 and IL 6. We found that for both sham and AKI mice, the hydro gel alon e had no MCP 1 or IL 6. However, for the samples where the capsule was collected, sham and AKI mice showed high levels of MCP 1 and low levels of IL 6 with no difference between NT, Sal SC, HA SQ and HA SC groups . There was no difference between sham and A KI for both MCP 1 and IL 6 (Figure 9 A B) . For MCP 1 expression there was significant difference between the normal

PAGE 43

32 unmanipulated left kidney capsules and the treated capsules in bo th sham and AKI groups (Figure 9 A). For IL 6, the normal unmanipulated healt hy capsules showed higher levels of IL 6 than sham and AKI hydrogel collected without the kidney capsule, but lower levels of IL 6 than sham and AKI hydrogel collected w ith the kidney capsule (Figure 9 B ). D iscussion T hese results confirm that our model of IR AKI is suitable to use to effectively study the efficacy of HA hydrogels . While these results do not show improvement in the AKI groups treated with HA hydrogel either subcapsularly or subcutaneously, they do reaffirm that the HA hydrogels are biocomp atible and safe for treatment of kidney disease. Importantly , these studies provide the foundation for embedding the HA hydrogels with MSCs for therapeutic treatment of AKI to preven t the progression of CKD. The main goal herein was to demonstrate the mech anism by which HA hydrogels reduce serum IL 6 and improve renal histological outcomes. Based on our findings it is unlikely that the HA hydrogel absorbs pro inflammatory

PAGE 44

33 cytokines. Although these results are preliminary, HA hydrogels may alter gene express ion. Further e xperiments are required to adequately power the study in order to be able to confirm this hypothesis. Previous research on the efficacy of treatment using HA hydrogels as a delivery mechanism found that the hydro gel had no adverse effect on kidney function and may show potential positive effects. These results are in line with our result that there was no negative effect of the hydro gel. One possible reason these studies showed positive effects was likely due to the length of the study. We focused on a short term (5 day) and early long term (14 day) time points while these studies looked at 28 or 35 days post injury. This allowed more time for fibrosis to develop and more time for kidney functional markers to adjust to the effects of hydro g el treatment (Rodell et al., 2015; Soranno et al., 2016, 2014) . Further, two studies used unilate ral ureteral obstruction (UUO) to model kidney injury. This model causes progressive injury with the peak of injury being at later time points when compared to ischemia reperfusion injury which peaks at 24 hours. This extended injury timeline allows for treatment to have a stronger effect when it is administered on day 3 post injury. With ischemia reperfusion injury, giving treatment on day 3 means the kidney has already begun to heal itself so the effects of the treatment are less visible at short time points (Rodell et al., 2015; Soranno et al., 2014) . Different strains of mice have different gene expression and subsequently a different time course for protein expression, and different pathways for fibrosis after IR AKI . In a study that used C 57BL/6 mice as compared to BALB/C mice used in our study, we found that IL 6

PAGE 45

34 significantly decreased in AKI mice treated with hydro gel at day 28. We did not find any noticeable difference in serum IL 6 at day 5 and day 14 in BALB/C AKI mice treated with h ydro gel . As well, we found serum creatinine to decrease at day 28, where we found no significant different in creatinine levels between all AKI groups after 5 and 14 days. This may be in part due to higher creatinine levels on post injury day 1 or due to differences between C57BL/6 and BALB/C mice (Soranno et al., 2016) . More likely, however, is that the day 14 and day 28 time points represent different pathophysiology along the AKI to CKD transition. Therefore, the next step will be to determine the results of t reatment at the 28 day time point. We found that the HA hydrogel did not absorb MCP 1 or IL 6 , but both cytokines were present in all collected capsules from treated mice. This leads us to believe that injection of the hydrogel caused local inflammation at the site of injection, where these cytokines were subsequently expressed. This is unsurprising because there is no way to inject treatment without some tissue damage. In other studies, hydrogel was injected directly into the cortex of the kidney (Gao et al., 2012) . This method causes more severe damage to an already injured kidney when compared to subcapsular injection. As well, treatment was given 10 minutes post IR, which may be more beneficial but not clinically feasible (Gao et al., 2012) .

PAGE 46

35 CHAPTER V CON CLUSION S AND FUTURE DIRECTIONS Conclusion Acute kidney injury is a common, costly and life threatening problem that has been associated with future occurrence of chronic kidney disease . The lack of treatment for these types of injuries leaves many people a t risk for higher morbidity and mortality, as well as predisposes them to developing chronic kidney disease . The above studies show the usefulness of hyaluronic acid hydrogels as an injectable treatment method. In our animal model, we have demonstrated tha t HA hydrogels have no negative effects on kidney function making them an ideal vessel for cargo delivery for treatment . When translated to human therapy, these hydrogels can be delivered via ultrasound guided percutaneous injection like that of a kidney biopsy. Furthermore, the hydrogels are tunable and can be synthesized to degrade and release their cargo over varying amounts of time. Due to these beneficial qualities, hyaluronic acid hydrogels injected under the kidney capsule have the potential to tre at acu te kidney injury and mitigate the effects of chronic kidney disease. With more research into a better understanding of how HA hydrogels work, these gels can become the future of kidney injury treatment. Future Research A study should focus on induc ing more severe AKI (SCre > 1.4 mg/dL, and/or BUN > 140 mg/dL) where mice cannot completely functionally recover on their own by day 5 making the difference from treatment on day 3 more evident. Six month to one year long studies should be

PAGE 47

36 done to access t he long term effects of treatment. The frequency and dosage of hydrog el injections can be adjusted to see if more or larger doses will have more positive effect. A future aim of this work would be to couple the HA hydrogel with stem cells to optimize tre atment and assist the kidney in healing and regrowth of cells. The appropriate hydro gel would stay localized to the injection site and release viable MSCs to both kidneys over time. As we have already seen in Rodell et al., single kidney sub capsular injec tion of hydrogel effects both kidneys and reduces systemic inflammation. Our preliminary data suggests that when MSCs are embedded within the HA hydrogel, the MSCs track to both kidneys while the hydrogel remains at the injection site , making this treatmen t ideal for the addition of MSCs. As well, HA hydrogel is an ideal vessel for safe and localized distribution of stem cells. This would require more studies on the localization and proliferation of stem cells after injection via HA hydrogels following AKI . Another study would be done to determine the efficacy and mechanism of action for the MSC/HA treatment method. HA hydrogels also have the potential to mitigate the effects of inflammation during kidney transplant rescue in the setting of rejection. Stu dies could be done on the efficacy of injecting HA hydrogel into a donor kidney prior to transplantation. As well, the hydrogel could be tagged with a fluorophore that, in the presence of significant inflammation, is released causing urine to change color instantly alerting the patient to potential rejection.

PAGE 48

37 REFERENCES Ali, T., Khan, I., Simpson, W., Prescott, G., Townend, J., Smith, W., & MacLeod, A. (2007). Incidence and Outcomes in Acute Kidney Injury: A Comprehensive Population Based Study. Journal of the American Society of Nephrology , 18 (4), 1292 1298. https://doi.org/10.1681/ASN.2006070756 Bakota, E. L., Wang, Y., Danesh, F., & Hartgerink, J. D. (2011). Injectable Multidomain Peptide Nanofiber Hydrogel as a Delivery Agent for Stem Cell Secretome. Biomacromolecules , 12 (5), 1651 1657. https://doi.org/10.1021/bm200035r Bellomo, R., Kellum, J. A., & Ronco, C. (2012). Acute kidney injury. The Lancet , 380 (9843), 756 766. https://doi.org/10.1016/S0140 6736(11)61454 2 Blood urea nitrogen (BUN) test About Mayo Clinic. (n.d.). Retriev ed March 27, 2018, from https://www.mayoclinic.org/tests procedures/blood urea nitrogen/about/pac 20384821 Branton, M. H., & Kopp, J. B. (1999). TGF beta and fibrosis. Microbes and Infection , 1 (15), 1349 1365. Burdick, J. A., & Prestwich, G. D. (2011). Hya luronic Acid Hydrogels for Biomedical Applications. Advanced Materials (Deerfield Beach, Fla.) , 23 (12), H41 H56. https://doi.org/10.1002/adma.201003963 Cantaluppi, V., Biancone, L., Quercia, A., Deregibus, M. C., Segoloni, G., & Camussi, G. (2013). Rationa le of mesenchymal stem cell therapy in kidney injury. American Journal of Kidney Diseases: The Official Journal of the National Kidney Foundation , 61 (2), 300 309. https://doi.org/10.1053/j.ajkd.2012.05.027 Carr, M. W., Roth, S. J., Luther, E., Rose, S. S., & Springer, T. A. (1994). Monocyte chemoattractant protein 1 acts as a T lymphocyte chemoattractant. Proceedings of the National Academy of Sciences of the United States of America , 91 (9), 3652 3656.

PAGE 49

38 Chertow, G. M., Burdick, E., Honour, M., Bonventre, J. V., & Bates, D. W. (2005). Acute Kidney Injury, Mortality, Length of Stay, and Costs in Hospitalized Patients. Journal of the American Society of Nephrology , 16 (11), 3365 3370. https://doi.org/10.1681/ASN.2004090740 Chertow, G. M., Palevsky, P. M., & Green e, T. (2006). Studying the Prevention of Acute Kidney Injury: Lessons from an 18th Century Mathematician. Clinical Journal of the American Society of Nephrology , 1 (5), 1124 1127. https://doi.org/10.2215/CJN.01200406 Chiba, T., Skrypnyk, N. I., Skvarca, L. Caestecker, M. P. (2016). Retinoic Acid Signaling Coordinates Macrophage Dependent Injury and Repair after AKI. , 27 (2), 495 508. https://doi.org/10.1681 /ASN.2014111108 Cohn, D., Lando, G., Sosnik, A., Garty, S., & Levi, A. (2006). PEO PPO PEO based poly(ether ester urethane)s as degradable reverse thermo responsive multiblock copolymers. Biomaterials , 27 (9), 1718 1727. https://doi.org/10.1016/j.biomateria ls.2005.10.035 Collagen. (2018, April 16). In Wikipedia . Retrieved from https://en.wikipedia.org/w/index.php?title=Collagen&oldid=836746399 Collagen, type III, alpha 1. (2017, August 30). In Wikipedia . Retrieved from https://en.wikipedia.org/w/index.php?ti tle=Collagen,_type_III,_alpha_1&oldid=798028 661 Creatinine. (2018, March 19). In Wikipedia . Retrieved from https://en.wikipedia.org/w/index.php?title=Creatinine&oldid=831207625 Devarajan, P. (2008). Neutrophil gelatinase associated lipocalin (NGAL). Scandi navian Journal of Clinical and Laboratory Investigation. Supplementum , 241 , 89 94. https://doi.org/10.1080/00365510802150158 hydrogel for enhancing the therap eutic benefits of adipose derived MSCs for acute kidney injury. Biomaterials , 33 (14), 3673 3681. https://doi.org/10.1016/j.biomaterials.2012.01.061

PAGE 50

39 Gowda, S., Desai, P. B., Kulkarni, S. S., Hull, V. V., Math, A. A. K., & Vernekar, S. N. (2010). Markers of renal function tests. North American Journal of Medical Sciences , 2 (4), 170 173. Han, W. K., Bailly, V., Abichandani, R., Thadhani, R., & Bonventre, J. V. (2002). Kidney Injury Molecule 1 (KIM 1): A novel biomarker for human renal proximal tubule injury. K idney International , 62 (1), 237 244. https://doi.org/10.1046/j.1523 1755.2002.00433.x U.S. Department of Health and Human Services, Centers for Disease Control and Prevention, & National Center for Health Statistics. (2015). Summary Health Statistics: Nati onal Health Interview Survey, 2015 . Retrieved from https://ftp.cdc.gov/pub/Health_Statistics/NCHS/NHIS/SHS/2015_SHS_Table_A 4.pdf Heinrich, P. C., Behrmann, I., Haan, S., Hermanns, H. M., Müller Newen, G., & Schaper, F. (2003). Principles of interleukin ( IL) 6 type cytokine signalling and its regulation. Biochemical Journal , 374 (Pt 1), 1 20. https://doi.org/10.1042/BJ20030407 Honeycutt, A. A., Segel, J. E., Zhuo, X., Hoerger, T. J., Imai, K., & Williams, D. (2013). Medical Costs of CKD in the Medicare Popu lation. Journal of the American Society of Nephrology , 24 (9), 1478 1483. https://doi.org/10.1681/ASN.2012040392 Hortensius, R. A., & Harley, B. A. C. (2013). The use of bioinspired alterations in the glycosaminoglycan content of collagen GAG scaffolds to r egulate cell activity. Biomaterials , 34 (31), 7645 7652. https://doi.org/10.1016/j.biomaterials.2013.06.056 Hsu, C. (2012). Yes, AKI Truly Leads to CKD. Journal of the American Society of Nephrology , 23 (6), 967 969. https://doi.org/10.1681/ASN.2012030222 Hu attenuate ischemic acute kidney injury by inducing regulatory T cells through splenocyte interactions. Kidney International , 84 (3), 521 531. https://doi.org/10 .1038/ki.2013.114 Humphreys, B. D., & Bonventre, J. V. (2008). Mesenchymal Stem Cells in Acute Kidney Injury. Annual Review of Medicine , 59 (1), 311 325. https://doi.org/10.1146/annurev.med.59.061506.154239

PAGE 51

40 Jetton, J. G., Boohaker, L. J., Sethi, S. K., Wazi (2017). Incidence and outcomes of neonatal acute kidney injury (AWAKEN): a multicentre, multinational, observational cohort study. The Lancet Child & Adolescent Health , 1 (3), 184 194. https://doi.org/10.1016/S2352 4642(17)30069 X Kaddourah, A., Basu, R. K., Bagshaw, S. M., & Goldstein, S. L. (2017). Epidemiology of Acute Kidney Injury in Critically Ill Children and Young Adults. New England Journal of Medicine , 376 (1), 11 20. https ://doi.org/10.1056/NEJMoa1611391 Kalogeris, T., Baines, C. P., Krenz, M., & Korthuis, R. J. (2012). Cell Biology of Ischemia/Reperfusion Injury. International Review of Cell and Molecular Biology , 298 , 229 317. https://doi.org/10.1016/B978 0 12 394309 5.00 006 7 Cass, A. (2014). KDIGO Guidelines on AKI. Lecture. Kim, Y. S., Cho, Y. G., Odkhuu, D., Park, N., & Song, H. K. (2013). A physical organogel electrolyte: characterized by in situ thermo irreversible gelation and single ion predominent conduction. Scientific Reports , 3 . https://doi.org/10.1038/srep01917 Reperfusion as a Robust Model for Acute to Chronic Kidney Injury in Mice. PLoS ONE , 11 (3). https://doi.or g/10.1371/journal.pone.0152153 Leach, J. B., Bivens, K. A., Patrick, C. W., & Schmidt, C. E. (n.d.). Photocrosslinked hyaluronic acid hydrogels: Natural, biodegradable tissue engineering scaffolds. Biotechnol. Bioeng , 578 589. Lei, Y., Gojgini, S., Lam, J. , & Segura, T. (2011). The spreading, migration and proliferation of mouse mesenchymal stem cells cultured inside hyaluronic acid hydrogels. Biomaterials , 32 (1), 39 47. https://doi.org/10.1016/j.biomaterials.2010.08.103 Locksley, R. M., Killeen, N., & Lena rdo, M. J. (2001). The TNF and TNF Receptor Superfamilies: Integrating Mammalian Biology. Cell , 104 (4), 487 501. https://doi.org/10.1016/S0092 8674(01)00237 9 Loebel, C., Rodell, C. B., Chen, M. H., & Burdick, J. A. (2017). Shear thinning and self healing hydrogels as injectable therapeutics and for 3D printing. Nature Protocols , 12 (8), 1521 1541. https://doi.org/10.1038/nprot.2017.053

PAGE 52

41 Lu, H. D., Soranno, D. E., Rodell, C. B., Kim, I. L., & Burdick, J. A. (2013). Secondary photocrosslinking of injectable sh ear thinning dock and lock hydrogels. Advanced Healthcare Materials , 2 (7), 1028 1036. https://doi.org/10.1002/adhm.201200343 Maitz, M. F. (2015). Applications of synthetic polymers in clinical medicine. Biosurface and Biotribology , 1 (3), 161 176. https://d oi.org/10.1016/j.bsbt.2015.08.002 Marklein, R. A., Soranno, D. E., & Burdick, J. A. (2012). Magnitude and presentation of mechanical signals influence adult stem cell behavior in 3 dimensional macroporous hydrogels. Soft Matter , 8 (31), 8113 8120. https://d oi.org/10.1039/C2SM25501D Nature Reviews Molecular Cell Biology , 13 (10), 616 630. https://doi.org/10.1038/nrm3434 Mealy, J. E., Rodell, C. B., & Burdick, J. A. (2015). Sustained Small Molecule Delivery from Injectable Hyaluronic Acid Hydrogels through Host Guest Mediated Retention. Journal of Materials Chemistry. B, Materials for Biology and Medicine , 3 (40), 8010 8019. https://doi.org/10.1039/C5TB00981B Munshi, R., Johnson, A., Siew, E. D., Ikizler, T. A., Wa (2011). MCP 1 gene activation marks acute kidney injury. Journal of the American Society of Nephrology: JASN , 22 (1), 165 175. https://doi.org/10.1681/ASN.2010060641 NIH. (2016). Stem Cell Information. National Insti tutes of Health, U.S. Department of Health and Human Services. Retrieved from stemcells.nih.gov/info/basics/1.htm Linked Hyaluronic Acid Hydrogels for Tissue Engineering. Biomacro molecules , 12 (3), 824 830. https://doi.org/10.1021/bm101446k (2012). The interstitial expression of alpha smooth muscle actin in glomerulonephritis is assoc iated with renal function. of Experimental and Clinical Research , 18 (4), CR235 CR240. https://doi.org/10.12659/MSM.882623

PAGE 53

42 Pok, S., Vitale, F., Eichmann, S. L., Benavides, O. M., Pasquali, M., & Jacot, J. G. (2014). Biocompatible Carbon Nanotube Chitosan Scaffold Matching the Electrical Conductivity of the Heart. ACS Nano , 8 (10), 9822 9832. https://doi.org/10.1021/nn503693h Raman, R., Sasisekharan, V., & Sasisekharan, R. (2005). Structural Insights into Biological Roles of Protein Glycosaminoglycan Interactions. Chemistry & Biology , 12 (3), 267 277. https://doi.org/10.1016/j.chembiol.2004.11.020 Rodell, C. B., Kaminski, A. L., & Burdick, J. A. (2013). Rational Design of Network Properties in Guest Host As sembled and Shear Thinning Hyaluronic Acid Hydrogels. Biomacromolecules , 14 (11), 4125 4134. https://doi.org/10.1021/bm401280z Rodell, C. B., Rai, R., Faubel, S., Burdick, J. A., & Soranno, D. E. (2015). Local immunotherapy via delivery of interleukin 10 an chronic kidney disease. Journal of Controlled Release: Official Journal of the Controlled Release Society , 206 , 131 139. https://doi.org/10.1016/j.jconrel.2015.03.025 Schmittgen, T. D., & Livak, K. J. (2008). Analyzing real time PCR data by the comparative C T method. Nature Protocols , 3 (6), 1101 1108. https://doi.org/10.1038/nprot.2008.73 Soranno, D. E., Lu, H. D., Weber, H. M., Rai, R., & Burdick, J. A. (2014). Immunotherapy with injectable hydrogels to treat obstructive nephropathy. Journal of Biomedical Materials Research. Part A , 102 (7), 2173 2180. https://doi.org/10.1002/jbm.a.34902 So ranno, D. E., Rodell, C. B., Altmann, C., Duplantis, J., Andres Hernando, A., Burdick, J. A., & Faubel, S. (2016). Delivery of interleukin 10 via injectable hydrogels improves renal outcomes and reduces systemic inflammation following ischemic acute kidney injury in mice. American Journal of Physiology. Renal Physiology , 311 (2), F362 372. https://doi.org/10.1152/ajprenal.00579.2015 Su, H., Lei, C. T., & Zhang, C. (2017). Interleukin 6 Signaling Pathway and Its Role in Kidney Disease: An Update. Frontiers in Immunology , 8 . https://doi.org/10.3389/fimmu.2017.00405 Tögel, F. E., & Westenfelder, C. (2012). Kidney protection and regeneration following acute injury: progress through stem cell therapy. American Journal of Kidney Diseases: The Official Journal of th e National Kidney Foundation , 60 (6), 1012 1022. https://doi.org/10.1053/j.ajkd.2012.08.034

PAGE 54

43 C. (2013). Growth factor delivery from hydrogel particle aggrega tes to promote tubular regeneration after acute kidney injury. Journal of Controlled Release , 167 (3), 248 255. https://doi.org/10.1016/j.jconrel.2013.01.030 Type I collagen. (2017, June 7). In Wikipedia . Retrieved from https://en.wikipedia.org/w/index.php? title=Type_I_collagen&oldid=784242009 van der Smissen, A., Samsonov, S., Hintze, V., Scharnweber, D., Moeller, S., Schnabelrauch, M., sulfated hyaluronan interferes wi induced myofibroblast differentiation. Acta Biomaterialia , 9 (8), 7775 7786. https://doi.org/10.1016/j.actbio.2013.04.023 Vielhauer, V., & Mayadas, T. N. (2007). Functions of TNF and its receptors in renal disease: distinct roles in inflammatory tissue injury and immune regulation. Seminars in Nephrology , 27 (3), 286 308. https://doi.org/10.1016/j.semnephrol.2007.02.004 Webster, A. C., Nagler, E. V., Morton, R. L., & Masson, P. (2017). Chronic Kidney Disease. The Lancet , 389 (10075), 1238 1252. https://doi.org/10.1016/S0140 6736(16)32064 5 Xing, L., Cui, R., Peng, L., Ma, J., Chen, X., Xie, R. J., & Li, B. (2014). Mesenchymal stem cells, not conditioned medium, contribute to k idney repair after ischemia reperfusion injury. Stem Cell Research & Therapy , 5 (4). https://doi.org/10.1186/scrt489 Zarjou, A., Sanders, P. W., Mehta, R. L., & Agarwal, A. (2012). Enabling innovative translational research in acute kidney injury. Clinical and Translational Science , 5 (1), 93 101. https://doi.org/10.1111/j.1752 8062.2011.00302.x

PAGE 55

44 APPENDIX A Table 1: Primer Sequences Gapdh Fw: TGGAGAAACCTGCCAAGTATGA Rv: GAAGAGTGGGAGTTGCTGTTGA Kim1 Fw: AAACCAGAGATTCCCACACG Rv: GTCGTGGGTCTTCCTGTAGC NGAL Fw: GCAGGTGGTACGTTGTGGG Rv: CTC TTGTAGCTCATAGATGGTGC ccl2 (MCP1) Fw: GCATCCACGTGTTGGCTCA Rv: CTCCAGCCTACTCATTGGGATCA IL 1b Fw: GCAACTGTTCCTGAACTCAACT Rv: ATCTTTTGGGGTCCGTCAACT TNFa Fw: CGGAGTCCGGGCAGGT Rv: GCTGGGTAGAGAATGGATGAACA TGFb Fw: ATACGTCAGACATTCGGGAAGCAGTG Rv: AA TAGTTGGTATCCAGGGCTCTCCG a SMA Fw: TCAGCGCCTCCAGTTCCT Rv: AAAAAAAACCACGAGTAACAAATCAA Col1 Fw: CCCGCCGATGTCGCTAT Rv: GCTACGCTGTTCTTGCAGTGAT Col3 Fw: CTGTAACATGGAAACTGGGGAAA Rv: CCATAGCTGAACTGAAAACCACC