Citation
Investigating the effects of GSK-3-related signaling pathways on MRNA methylation in mouse embryonic stem cells

Material Information

Title:
Investigating the effects of GSK-3-related signaling pathways on MRNA methylation in mouse embryonic stem cells
Creator:
Kilpatrick, Kathryn Leigh
Place of Publication:
Denver, CO
Publisher:
University of Colorado Denver
Publication Date:
Language:
English

Thesis/Dissertation Information

Degree:
Master's ( Master of science)
Degree Grantor:
University of Colorado Denver
Degree Divisions:
Department of Integrative Biology, CU Denver
Degree Disciplines:
Biology
Committee Chair:
Phiel, Christopher J.
Committee Members:
Charlesworth, Amanda
Ren, Xiaojun

Notes

Abstract:
Epigenetic regulation is difficult to unravel because multiple processes and participants converge to create a unique gene expression that is often dependent upon external stimuli. As such, these outcomes can be altered by small changes in any of many different activities, such as kinase activity in signaling cascades or RNA methylation levels. Changes in these pathways lead to altered phenotypes. When Gsk-3 function is lost, activation of Wnt signaling and indefinite stem cell pluripotency occur, though a precise mechanism for the latter has not been uncovered. Gsk-3 is known to be a central regulator of both Wnt and insulin signaling pathways and is suspected to mark the m6A demethylase FTO for degradation. Since Wnt signaling is implicated in stem cell pluripotency, and decreased m6A enhances pluripotency, we investigated if this is due to a change in m6A levels or the pathway itself. All of these processes might converge in a complicated epigenetic network. In this study, we analyzed gene expression profiles of cells with activation of two Gsk-3 related signaling pathways, Wnt and insulin signaling. We also overexpressed the demethylase FTO, implicated in m6Atag removal and subsequent renewal of pluripotency. We propose that RNA biology and signal transduction converge on regulating gene expression in a precise and timely manner.
General Note:
n3p

Record Information

Source Institution:
University of Colorado Denver
Holding Location:
Auraria Library
Rights Management:
Copyright Kathryn Kilpatrick. Permission granted to University of Colorado Denver to digitize and display this item for non-profit research and educational purposes. Any reuse of this item in excess of fair use or other copyright exemptions requires permission of the copyright holder.

Downloads

This item has the following downloads:


Full Text
INVESTIGATING THE EFFECTS OF GSK-3-RELATED SIGNALING PATHWAYS ON MRNA
METHYLATION IN MOUSE EMBRYONIC STEM CELLS
by
KATHRYN LEIGH KILPATRICK B.A., Hendrix College, Conway, AR 2013
A thesis submitted to the Faculty of the Graduate School of the University of Colorado in partial fulfillment of the requirements for the degree of Master of Science Integrative Biology Program
2018


© 2018
KATHRYN LEIGH KILPATRICK ALL RIGHTS RESERVED
11


This thesis for the Master of Science degree by
Kathryn Leigh Kilpatrick has been approved for the Integrative Biology Program by
Christopher J. Phiel, Chair Amanda Charlesworth Xiaojun Ren
m
Date: May 12, 2018


Kilpatrick, Kathryn Leigh (M.S., Biology)
Investigating the Effects of Gsk-3-Related Signaling Pathways on mRNA Methylation in Mouse Embryonic Stem Cells
Thesis directed by Assistant Professor Christopher J. Phiel.
ABSTRACT
Epigenetic regulation is difficult to unravel because multiple processes and participants converge to create a unique gene expression that is often dependent upon external stimuli. As such, these outcomes can be altered by small changes in any of many different activities, such as kinase activity in signaling cascades or RNA methylation levels. Changes in these pathways lead to altered phenotypes. When Gsk-3 function is lost, activation of Wnt signaling and indefinite stem cell pluripotency occur, though a precise mechanism for the latter has not been uncovered. Gsk-3 is known to be a central regulator of both Wnt and insulin signaling pathways and is suspected to mark the m6A demethylase FTO for degradation. Since Wnt signaling is implicated in stem cell pluripotency, and decreased m6A enhances pluripotency, we investigated if this is due to a change in m6A levels or the pathway itself. All of these processes might converge in a complicated epigenetic network. In this study, we analyzed gene expression profiles of cells with activation of two Gsk-3 related signaling pathways, Wnt and insulin signaling. We also overexpressed the demethylase FTO, implicated in m6A-tag removal and subsequent renewal of pluripotency. We propose that RNA biology and signal transduction converge on regulating gene expression in a precise and timely manner.
IV


The form and content of this abstract are approved. I recommend its publication.
Approved: Christopher J. Phiel
v


ACKNOWLEDGEMENTS
For his guidance in learning the basics of bench research to his ability to foster true scientific inquiry, a great thanks to Dr. Chris Phiel, my advisor. For their insightful questions in the planning and implementation phase as part of my thesis committee, thank you to Dr. Amanda Charlesworth and Dr. Xiaojun Ren. An enormous thanks to Laura Sedivy for her assistance technically and emotionally. For their assistance in and out of the lab, thanks to Harmony Matshik Dakafay, Kelsie Faulds, Sanju Garimella, Matt Mitchell, Olivia Robard, Tiffany Vu, and Ellie Chaabi. Gratitude to Andrew McDevitt for his aid in visualizing the Nanostring data. Last but by no means least, thanks to my family and friends for their support in this endeavor, especially my parents, Sandra and Steve Kilpatrick, and my partner Joe McPeak.
vi


TABLE OF CONTENTS
CHAPTER
I. INTRODUCTION...............................................1
II. RESULTS...................................................15
III. DISCUSSION................................................71
IV. FUTURE DIRECTIONS.........................................74
REFERENCES........................................................76
APPENDIX..........................................................83
A. SEQUENCES..............................................83
B. MATERIALS AND METHODS..................................88
vii


LIST OF ABBREVIATIONS
3' UTR 3' Untranslated Region
ALKBH5 AlkB Homolog 5
BMP4 Bone Morphogenetic Protein 4
CKI Casein Kinase 1
crRNA CRISPR RNA
DKO Double Knockout
DMEM Dulbecco's Modified Eagle Medium
Dsh Dishevelled
ESC Embryonic Stem Cells
ESRRB Estrogen-Related Receptor Beta
FTO Fat Mass and Obesity Associated Protein
Fz Frizzled
GFP Green Fluorescence Protein
Gsk-3 Glycogen Synthase Kinase
HEK293T Human Embryonic Kidney Cells
iPSC Induced Pluripotent Stem Cells
LiCI Lithium
LIF Leukemia Inhibitory Factor
KO Knockout
m6A N6-methyladensine
m6Am N6, 2'-0-dimethyladenosine
vm


m6A-seq N6-methyladensine sequencing
MAP-K Mitogen-Activated Protein Kinase
mESC Mouse Embryonic Stem Cells
Mettl3 Methyl Transferase-like 3
mRNA messenger RNA
Opti-MEM Minimum Essential Media
pllO* Myristoylated form of pllO subunit stable cell line
PBS Phosphate Buffered Saline
PDK1 Phosphoinositide-dependent kinase-1
PEI Polyethylenimine
PI3K Phosphatidylinositol-3-Kinase
PKB Protein Kinase B (AKA Akt)
qPCR Quantitative PCR
SNP Single Nucleotide Polymorphism
WTAP Wilms' Tumorl-Associating Protein
YTHDF2 YTH Domain Family 2
IX


CHAPTER 1
INTRODUCTION
Epigenetic regulation is difficult to unravel because multiple processes and participants converge to create a unique gene expression that is often dependent upon external stimuli. As such, these outcomes can be altered by small changes in any of many different activities, such as in signaling cascades, kinase activity, or RNA methylation. Epigenetic aberrations account for some disease states, including cancer. Unchecked cell proliferation is the root of all cancers and can be caused by unbridled Gsk-3 activity, which is active in several signaling pathways and phosphorylates over 100 proteins (Beurel 2015). Determining which tags, proteins, signaling cascades, and stimuli are interacting can be difficult. In this study, we endeavored to uncover whether two Gsk-3 dependent signaling pathways, Wnt and insulin signaling, affect RNA methylation, causing indefinite stem cell pluripotency.
Glycogen Synthase Kinase 3
Glycogen synthase kinase 3 (Gsk-3) is active in multiple signal transduction pathways, including Wnt and insulin signaling (Force and Woodgett 2009). Gsk-3 activity is the sum of two isoforms, Gsk-3a and Gsk-33, which are essentially redundant in function but are encoded by two different genes (Woodgett 1990; Kockeritz et al. 2006). Both Gsk-3a and Gsk-33 have a preferred consensus sequence for phosphorylation of S/T-X-X-X-S/T and prefer to phosphorylate substrates that have been primed (phosphorylated by another kinase previously) but will also phosphorylate non-primed substrates (Fiol et al. 1987).
1


Gsk-3 is involved in many signaling pathways, including protein kinase A (PKA),
transforming growth factor-3 (TGF-3), Hedgehog, Wnt, and phosphatidylinositol 3-kinase (PI3K)-dependent insulin signaling (Grimes and Jope 2001; Doble and Woodgett 2003; Frame and Cohen 2001). In Wnt signaling, Gsk-3 phosphorylates 3-catenin in the Axin destruction complex which eventually leads to the degradation of 3-catenin (Zeng et al. 2005; Clevers and Nusse 2012). In this way, Gsk-3 regulates the Wnt pathway in a negative fashion. [This is unconventional for kinases; Gsk-3 is constitutively active in its basal state and is inhibited by phosphorylation, whereas most kinases must be activated by phosphorylation (Kockeritz et al. 2006).] In insulin signaling, phosphatidylinositol 3-kinase (PI3-kinase or PI3K) activates Akt (also known as Protein Kinase B, PKB) via phosphorylation, recruiting Akt to the cytoplasm. There, Akt phosphorylates free cytoplasmic Gsk-3a and Gsk-33, on serine 21 and serine 9, respectively, rendering them inactive (Saltiel and Kahn 2001; Cross et al. 1995). Though Gsk-3 is operating in both pathways, neither pathway functions to turn on or off the other (Ding, Chen, and McCormick 2000; Ng et al. 2009; McManus et al. 2005).
Wnt Signaling
Wnt signaling is crucial for directing cell proliferation, cell polarity, and cell fate determination during embryonic development. Constitutive Wnt signaling is also known to play a role in carcinogenesis (Zhan, Rindtorff, and Boutros 2017). Wnt signaling involves many participants, the most prominent of which are Frizzed (Fz), LRP5/6, Dishevelled (Dsh), Gsk-3 a/3, Axin, APC, casein kinase 1 (CK1), 3-catenin, and Lef/Tcf (Nusse and Clevers 2017). Under basal conditions, 3-catenin levels are kept low via the
2


activity of a complex of proteins termed the 3-catenin destruction complex (Gsk-3a/|3,
Axin, APC, and CK1) (Figure 1). Phosphorylation of 3-catenin by CK1 and Gsk-3 results in the subsequent ubiquitination and degradation of 3-catenin (Aberle et al. 1997). However, upon Wnt ligand binding to the Frizzled receptor complex, Dishevelled recruits Axin to the cell surface, inhibiting the destruction complex from forming and preventing degradation of 3-catenin (Zeng et al. 2005; Wu et al. 2009). When the destruction complex cannot form, Gsk-3 translocates to the cell membrane and is then endocytosed into multivesicular bodies, isolating it physically from 3-catenin (Taelman et al. 2010). 3-catenin then accumulates in the cytoplasm before translocating to the nucleus where it directly complexes with Lef/Tcf proteins to activate Wnt target genes (MacDonald, Tamai, and He 2010; Zeng et al. 2005).
In a growing embryo, Wnt signaling is active, causing cell proliferation and later, cell fate determination. However, if 3-catenin is not degraded, usually because of a mutation, excessive stem cell proliferation occurs, leading to tumorigenesis (MacDonald, Tamai, and He 2010). Subsequent epigenetic regulation is unable to overcome this extreme proliferation.
3


Insulin Signaling
The insulin signaling pathway is triggered by the production of insulin, which causes an increase in the uptake of glucose in muscle and fat cells, reducing glucose synthesis in the liver. When insulin binds to the a subunit of the insulin receptor, a conformational change takes place, activating the tyrosine kinase domains of the receptor's 3 subunits. The 3 subunits phosphorylate two enzymes: Mitogen-activated Protein Kinase (MAP-K) and Phosphatidylinositol-3-Kinase (PI3K). PI3K in turn activates Phosphoinositide-dependent kinase-1 (PDK1) which phosphorylates Akt (AKA protein kinase B (PKB)) at threonine 308, leading to partial activation. When Akt becomes phosphorylated at serine 473, it is fully activated. Once activated, Akt moves to the cytoplasm where it can phosphorylate free Gsk-3. Akt phosphorylates Gsk-3a on serine 21 and Gsk-33 on serine 9, resulting in the inhibition of Gsk-3 when the phosphorylated
4


amino-termini causes a conformational change (Figure 2) (Fang et al. 2000; Grimes and
Jope 2001; Doble and Woodgett 2003; Cross et al. 1995; Frame and Cohen 2001). The method through which Gsk-3 is inhibited in insulin signaling is distinct from that of wnt signaling; Akt directly phosphorylates Gsk-3 in insulin signaling while Gsk-3 is physically removed from 3-catenin in Wnt signaling.
Insulin &
• V
Figure 2: Insulin signaling. PI3K activates Akt which in turn phosphorylates cytoplasmic Gsk-3, inhibiting it. Image: Abeam.
Pluripotency
Embryonic stem cells are pluripotent, meaning they able to differentiate into any of the three types of germ layers; that is, they can become any type of somatic cell. Typically, ESCs will eventually differentiate, whether or not they are not located in a growing embryo because pluripotency is not an indefinite state. There are several techniques to maintain ESC pluripotency in a lab setting. A pluripotency-inducing factor, most commonly leukemia inhibitory factor (LIF) for mouse ESCs (mESCs), must be added to the media of WT mESCs to maintain pluripotency (Pan and Thomson 2007).
5


Mouse embryonic stem cells (mESCs) that have had both Gsk-3a and Gsk-3|3 knocked out (Gsk-3a"/_; Gsk-3(3-/", termed double knock out cells, DKO) are curious because they retain their pluripotency indefinitely; they do not differentiate (Bartman et al. 2014) and do not require LIF to maintain pluripotency (Doble et al. 2007). DKO ESCs also have a different physical phenotype than wildtype (WT) mESCs (Figure 3). Since Gsk-3 DKO ESCs retain pluripotency, and Gsk-3 activity is regulated by both Wnt and insulin signaling, it seems likely that one or both pathways could play a role in promoting LIF-independent ESC pluripotency as well (McManus et al. 2005; Bartman et al. 2014; Klippel etal. 1996).
WT ESCs Gsk-3 DKO ESCs
Figure 3: Phenotypic difference between WT mESCs and Gsk-3 DKO mESCs. DKO cells tend to grow in compact clusters and maintain pluripotency indefinitely, unlike WT
mESCs.
Supporting this hypothesis, a stable ESC line created by the Phiel lab which stably expresses a constitutively active, myristoylated version of the catalytic pllOa subunit of PI3K (termed pllO*), involved in insulin singling, and causes cells to maintain pluripotency because this leads to continuous phosphorylation and inhibition of cytoplasmic Gsk-3, similar to the Gsk-3a_/" Gsk-3(3-/" DKO mESCs (Popkie et al. 2010; Klippel et al. 1996).
6


Conversely, Wnt signaling can be constitutively activated in ESCs by the stable
expression of a mutant for of 3-catenin. This mutation, S33A, prevents 3-catenin from being phosphorylated by Gsk-3, rendering 3-catenin unable to be ubiquitinated and degraded (Korinek et al. 1997; Morin et al. 1997). These cells allow for study of Wnt signaling in the absence of Gsk-3 without removing Gsk-3 from its other tasks in the cells, thereby reducing off-target effects. WT, pllO*, and S33A cells must all be cultured with LIF to remain pluripotent and self-renewing. On the other hand, DKO cells have sustained stem cell pluripotency over time, even in the absence of LIF (Sanchez-Ripoll et al. 2013; Dobleetal. 2007).
Interestingly, ESCs also remain pluripotent when the level of the RNA methylation m6A is reduced, even under conditions when differentiation would normally occur (Batista et al. 2014; Geula et al. 2015; Xiao Wang et al. 2013). RNA methylation occurs post-transcriptionally and is an epigenetic process involved in specifying mRNA fate. The link between m6A and pluripotency is understudied and might have ties to Wnt and/or insulin signaling since mRNAs connected to these two pathways have been shown to contain m6A marks, which could represent a novel mechanism to further regulate these pathways post-transcriptionally.
7


RNA Methylation as Epigenetic Regulation
N6-methyladenosine (m6A) and N6,2'-0-dimethyladenosine (m6Am) are reversible, dynamic modifications on RNA that control gene regulation in a precise and timely manner. Through m6A methylation, mRNA transcripts become marked for degradation, thus lowering gene expression (Jianzhao Liu et al. 2014; Xiao Wang et al. 2013). Conversely, with rn6Am tags, transcripts are protected from degradation and thus the gene is expressed at a higher rate (Mauer et al. 2017). Importantly here, the RNA methylation is a reversible process. The demethylases FTO and ALKBH5 actively remove m6A modifications, typically allowing the mRNA to be translated and thus expressed (Jia et al. 2011; Zheng et al. 2013). It has been reported that FTO specifically removes rn6Am adjacent to the 5' cap and internal m6A, while ALKBH5 seems to only remove m6A (Mauer et al. 2017). Many of the m6A modified mRNAs encode for pluripotency regulators; these must be expressed while the cell remains undifferentiated, but are quickly downregulated upon differentiation.
Proteins Involved with Methylation
The m6A methyl group is added by methyltransferase like 3 (METTL3) and methyltransferase like 14 (METTL14) and assisted by Wilms' Tumorl-Associating Protein (WTAP) (Jianzhao Liu et al. 2014). METTL3 and METTL14 form a heterodimer around the RNA as they work together to add m6A modifications; METTL3 acts as the catalytic core while METTL14 is the RNA binding platform (Xiang Wang et al. 2016). WTAP can colocalize with the METTL3/14 complex to increase methylation activity; WTAP does not have methyltransferase activity of its own, though (Jianzhao Liu et al. 2014). Knock-
8


down (KD) of METTL3 and METTL14 leads to a 60-70% decrease in m6A sites (Y. Wang et
al. 2014). Though it is currently unknown which methyltransferase adds m6Am tags, it is plausible that one of the METTL family enzymes is responsible.
Batista (2014) found that 33% of m6A peaks are preferentially dependent on METTL3 over METTL14 and that many of these are pluripotency marker mRNAs. However, if they are m6A modified, they are targeted for degradation, initiating cell differentiation. This is reinforced by the evidence that METTL3 KO mice die by embryonic days 4-8 (Geula et al. 2015). The cells were unable to differentiate into a growing embryo, conceivably because a methyl tag could not be added to the pluripotency marker mRNAs to target them for degradation.
m6A and rn6Am modifications are removed from mRNA by one of two proteins: fat mass and obesity-associated protein (FTO) or ALKBH5 (Narayan and Rottman 1988; Jia et al. 2011; Zheng et al. 2013; Mauer et al. 2017). ALKBH5 was discovered as an m6A demethylase two years after FTO, but it took another four years to show that FTO actually preferentially removes rn6Am (Zheng et al. 2013; Mauer et al. 2017); follow up research is necessary to determine the extent of overlap.
Though m6A methyltransferases and demethylases are clearly involved in the regulation of genes via m6A, they are not the only means by which mRNAs can be regulated in an m6A-dependent fashion. The YTH protein family can read m6A methylation, meaning m6A modifications are not only reversibly methylated, but also subjectively "read" and targeted for degradation or translation. YTHDF1 directly promotes translation of m6A modified mRNAs, thereby increasing the gene expression
9


of those transcripts (Xiao Wang et al. 2015a). On the other hand, YTHDF2 targets specific methylated mRNAs for degradation, thus controlling the lifetime of its target mRNA transcripts (Xiao Wang et al. 2015a). Though these two proteins sound as if they have conflicting processes, both work in concert to control mRNA transcription. On transcript targets, YTHDF1 binds first to promote transcription and later YTHDF2 binds to direct the mRNA for degradation once enough protein has been made (Xiao Wang et al. 2015b).
N6-Methyladenosine (m6A) and N6,2'-0-dimethyladenosine (m6Am)
N6-methyladenosine (m6A) is the methylation of adenosine at the carbon-6 position (Figure 4) and is the most common internal modification in messenger RNA (mRNA), accounting for modification in 0.1-0.4% of adenosine residues in mRNA (Dubin and Taylor 1975). m6A was discovered 40 years ago, but only recently found to be the first instance of reversible or inducible RNA methylation (Wei, Gershowitz, and Moss 1975, 1976; Wei and Moss 1977; Jia et al. 2011; Fu et al. 2014). This is one of the first indications that genes can be regulated post-transcriptionally. m6A marked transcripts have a shorter half-life and a slightly lowered translational efficiency (Batista et al. 2014; Geula et al. 2015). This indicates that m6A marked transcripts are typically targeted for decay, thereby slowing the expression of the encoded gene.
Cells that would normally differentiate tend to stay pluripotent when m6A levels are low, which is initiated by the demethylase FTO. Many pluripotency regulator mRNAs, both crucial and non-crucial, are normally m6A modified in WT mESCs, including Nanog, Klf4, MYC, Lin28, Medl, Jarid2, and Eed. However, POU5F1 (i.e., Oct4), a critical
10


pluripotency factor, is not m6A modified (Batista et al. 2014). This was determined with
m6A-seq and confirmed with qPCR (Faulds et al. 2018, submitted). At the time of differentiation, m6A modifications target pluripotency markers for degradation and allow differentiation markers to upregulate and change the cell fate.
Similar to m6A, the N6,2'-0-dimethyladenosine (rn6Am) modification was very recently discovered to have related but distinct effects on mRNA transcripts (Mauer et al. 2017). This modification is most commonly found at the first nucleotide after the N7-methylguanosine (m7G) cap (Figure 4) (Dominissini et al. 2012; Mauer et al. 2017). Researchers have found that when this first nucleotide is an adenosine, it always either Am or rn6Am, never just A or m6A (Mauer et al. 2017). It is unknown which methyltransferase adds this methyl tag, but it was shown that FTO is the demethylase for rn6Am both in vivo and in vitro and that FTO preferentially demethylates rn6Am over m6A. Transcripts containing at least one rn6Am tag have increased stability, due to resistance to the DCP2 enzyme, an mRNA-decapper that targets the m7G cap (Mauer et al. 2017). Because rn6Am causes increased transcript stability while m6A decreases stability, and the two tags differ by only one methyl group, determining which mechanisms are at work can be difficult. Moreover, there is not a specific antibody that can differentiate the two methyl tags from one another, making data from traditional enrichment sequencing techniques difficult to interpret.
Two papers in 2012 independently constructed a novel method for measuring and partially localizing m6A (and rn6Am) residues, now called m6A-seq (Dominissini et al. 2012; Meyer et al. 2012). This allowed the researchers the ability to not only quantify
11


m6A modifications across the transcriptome, but also to determine where the m6A modifications were occurring along the RNA. This significantly simplified the process of m6A localization, which is important for determining which genes or regions are methylated most often or at all. These studies indicated that m6A sites are not spread evenly along a transcript; they tend to cluster within long internal exons and around stop codons or at the beginning of the 3' Untranslated Region (3' UTR) (Batista et al. 2014; Meyer et al. 2012; Dominissini et al. 2012; Ke et al. 2015). Though neither m6A-seq method can differentiate m6A from rn6Am (because there is not a specific antibody), the methylation consensus sequence for m6A is known: RRACU (Dominissini et al. 2012). Methyl tags can be inferred to be m6A if they are located near that sequence or in the previously mentioned zones. A tag can be inferred to be rn6Am if it is adjacent to the transcriptional start site and is not located near an RRACU sequence. Nonetheless, it will be advantageous to have a clear way to differentiate these with certainty without doing a sequencing experiment each time.
^CH3 Hrr ^CH3 HINT
OH
ch3 OH OH
N6,2’-0-dimethyadenosine N6-methyladenosine
Figure 4: rn6Am and m6A modifications to adenosine.
12


Hypothesis
The purpose of this study is to determine whether Wnt or insulin signaling regulate RNA methylation. When Gsk-3 function is lost, activation of Wnt signaling and indefinite stem cell pluripotency occur, though a precise mechanism for the latter has not been uncovered (Doble et al. 2007). Gsk-3 is known to be a central regulator of both Wnt and insulin signaling pathways. Does Gsk-3 inhibition via these pathways affect m6A in mESCs? Since Wnt signaling is implicated in stem cell pluripotency, and decreased m6A enhances pluripotency, we investigated if this is due to a change in m6A or the pathway itself.
When Gsk-3 is inhibited, it increases expression of FTO, decreasing m6A methylation which directly causes an increase in mRNA half-life. Wnt transcripts and pluripotency transcripts are predicted to accumulate in the cell. We believe that Gsk-3 normally phosphorylates FTO. [However, overexpression of FTO also decreases the amount of rn6Amtags, which removes resistance to the DCP2 de-capping enzyme, shortening the half-life of those transcripts. It is unknown which transcripts are preferentially marked by rn6Am in mESCs.] We hypothesize that Wnt signaling activity can be upregulated through at least two processes: (1) increased Wnt target gene activation via 3-catenin activity and (2) through the increased mRNA half-life of Wnt target genes via decreased m6A methylation (Figure 5). We propose that RNA biology and signal transduction converge on regulating gene expression in a precise and timely manner.
13


m6Am
methylation
m6A
methylation -----*â– 
I
t
mRNA half-life
Of?? \
\ ? \
\
mRNA half-life ? of wnt targets ** •**.
Wnt target gene
expression
mRNA half-I life of Wnt target genes
Figure 5: Hypothesis for how Wnt signaling can be activated via Gsk-3 inhibition beyond what is expected from activation of each pathway on its own.
Specific Aims:
I. Create a model for study of activated Wnt, insulin, or FTO in mouse embryonic
stem cells. These methods should be efficient separately or in tandem.
II. Perform actinomycin-D experiments to stop transcription of mRNA in DKO or WT mESCs. Utilize Nanostring transcript quantification to conclude which transcripts have the longest and shortest half-lives. Identify patterns in the types of genes that are methylated.
III. Determine other modifications through which gene expression can be manipulated. Perform Nanostring analysis in cell types with modified Wnt, insulin, Gsk-3, FTO, and/or LIF culturing conditions. Analyze which combinations up- or down-regulate gene expression. Look for patterns in groups of genes with differential expression.
14


CHAPTER 2
RESULTS
Fundamental to this study is the ability to activate or inhibit both Wnt and insulin signaling while also gaining the ability to overexpress FTO in these cell types. A variety of methods were surveyed to accomplish these results. Once satisfactory experimental conditions were achieved, we continued on to study the effects of concurrent Wnt, insulin, and/or FTO overexpression to determine if there is a convergence that affects RNA methylation and stem cell pluripotency.
Overexpression of FTO
This study requires the overexpression of FTO so that we can study the effect of decreased m6A (and rn6Am) tags within the framework of activated Wnt or insulin signaling. For this, we needed a plasmid that will overexpress FTO in any given cell. We use the versatile mammalian vector pCAGEN in the Phiel lab because it results in strong constitutive expression of exogenous genes, particularly in mouse ESCs. To insert FTO into a mammalian expression vector, pCAGEN, Gibson Assembly cloning was utilized. gBIock gene fragments (IDT) are synthesized, verified nucleotide fragments. For this we designed a FLAG-FTO fragment (sequence in appendix A). The FTO sequence was tagged with a FLAG epitope to enable easy detection of the protein by antibody and to distinguish endogenous and exogenous protein. To assemble these vectors, the gBIock must have 15-20 bp overlaps to the expression vector. After linearizing pCAGEN with EcoRI (ThermoFisher) to expose the complementary ends, the gBIock was inserted using the Gibson Assembly master mix. This mix contains a DNA polymerase, an exonuclease,
15


and DNA ligase so that a double-stranded circular plasmid can be created. Due to the
complementary overlaps with pCAGEN, the gBIock is guaranteed to be inserted in the correct orientation. OneShot chemically competent cells were then transformed with the assembled plasmid to grow it up and then the plasmid was isolated through mini-preps (GeneJet and Zymo). A restriction digest was performed with Hindi 11 (ThermoFisher) to screen clones to ensure the proper insertion of the gBIock (Figure 6) Because the gBIock has complementary overhangs with the vector, the gBIock will always insert in the correct orientation. Those identified to have the insert were then Sanger sequenced (Eton Biosciences) to further verify the correct cloning.
1— — 1 2 3 CQ -id 4 5 6 7 8 9 10 11 12
4000bp g <=> 1500bp iu t—i t . t-i £—2 4737bp
1618bp

Figure 6: Restriction digest on FLAG-FTO colonies using Hindlll. Expected bands at 4,737 nt and 1,618 nt. This was seen in colonies 1-4, 6-7, and 9-12. Colonies 1-4 were sent for sequencing. One asterisk denotes insert was seen and two asterisks denotes the sample was sent for sequencing.
16


After cloning and sequencing, the plasmids were tested for expression in mouse
embryonic stem cells. Using polyethylenimine (PEI) as a transfection agent (Bartman et al. 2015), 1800 ng plasmid DNA and 200 ng GFP were transfected in mESCs. GFP was used to visually confirm successful transfection the following day. Protein was isolated and subjected to western blotting with an FTO antibody (Figure 7). Robust overexpression was found of the exogenous FTO.
Figure 7: FLAG-FTO Western Blot. Lane one is an untransfected, negative control. Lane 2 is FLAG-Mettl3, positive control for FLAG. FLAG-Mettl3 should be 73 kDa. Lane 3 is the FLAG-FTO plasmid in WT ESCs. FLAG-FTO is predicted to be 67 kDa. Total protein loaded to each lane is not standardized and therefore does not show relative
expression levels.
For ease of study, we attempted to use CRISPR-Cas9 gene editing to knock-in GFP in the FTO gene so that cells would fluoresce any time endogenous FTO was active. This was not a major aim, but would be a simple 'first-look' option to save time quantifying FTO expression in cells that were not expressing it. CRISPR stands for Clustered Regularly Interspaced Short Palindromic Repeats and was originally found as a defense system in bacteria. This system can be used to target a specific region of a gene and permanently modify it by knocking it out, knocking in another gene, or mutating or modifying the gene. Cas9 binds DNA at the PAM sequence and cuts both strands. The
17


designed synthetic CRISPR RNA (crRNA) can then be used to repair the break with the
desired change, in this case GFP (Cong et al. 2013). Three constructs were designed such that GFP was in-frame in the FTO gene at positions 40(+), 43(+), and 52(-); this knock-in would allow endogenous FTO to be expressed as well as GFP at the same time (crRNA sequences in appendix). The crRNA was transfected along with pCas9-GFP and tracrRNA into WT mESCs. Genomic DNA was extracted, PCR was run with primers designed to target the knock-in region, and a T7 surveyor assay was performed (Figure 8). The T7 surveyor assay highlights the success or failure of CRISPR; the T7 endonuclease cuts mismatched DNA (i.e.- where the knock-in has occurred and non-homologous end joining repaired the cut). These cuts result in three bands when CRISPR is successful: two from cut DNA and one from remaining uncut DNA. We saw three bands with crRNA #1 and crRNA #2 (Figure 8). Though the knock-in appeared to be successful, we failed to find expression of this in mouse ESCs.
18


Figure 8: T7 Assay of gDNA in cell transfected for CRISPR. Three bands appear in 'Primer3:crRNAl' and 'Primer3:crRNA2.'
Measurement of m6A
Because there are limited ways to simply and directly measure m6A activity short of an m6A-seq experiment, we decided to test whether m6A affects transcripts for the commonly used reporter gene luciferase. If the luciferase mRNA contains m6A, and is regulated by Mettl3 and FTO, it could provide a useful tool in our studies. A luciferase assay was performed with three groups to determine if FTO or Mettl3 had an effect on m6A on luciferase transcripts. HEK293T cells were transfected with luciferase (Luc-pDEST40), renilla (pRL-SV40), GFP (pMAX-GFP), and one of the following conditions: pCAGEN (negative control), FTO (pCAGEN-FLAG-FTO), or Mettl3 (pCAGEN-FLAG-Mettl3). HEK293T cells are modified Human Embryonic Kidney 293 cells with the Large T antigen which is important for replicating plasmids with an SV40 origin of replication to a high copy number in the cell. Luciferase comes from fireflies and is an oxidative enzyme that
19


produces bioluminescence upon addition of the substrate luciferin. Renilla is used to
normalize the firefly luciferase signal in each sample.
In luciferase reporter assays, luciferase is downstream of the gene of interest's promoter. In this case, though, Luc-pDEST40 has the chicken 3-actin promoter so luciferase mRNA will be expressed constitutively. Subsequent luciferase assays would provide an indirect measure of luciferase mRNA levels. This assay was performed to determine if m6A would methylate (and modulate) luciferase expression (Figure 9). Unfortunately, each sample had comparable luciferase expression and so luciferase assays could not be used as a direct measure of m6A levels in each sample. Moving forward, we had to use indirect measures of m6A.
10000 9000 8000 7000 6000 3 5000
4000 3000 2000 1000 0
FTO
Mettl3
Figure 9: Luciferase Assay in HEK293T cells with overexpressed FTO or Mettl3.
20


Small Molecule Modifiers
Small molecules can be used to inhibit or activate signaling cascades such as Wnt and insulin. These molecules act on the cells the entire time they are in the media, meaning it is not a temporary state. Current literature on each of the small molecules was used as a basis for determining the dosage and timing for best results (Jun Liu et al. 2005; Minami et al. 2012; Ni et al. 2011; Jo et al. 2012; Lianguzova et al. 2007). Not all of these papers used mouse embryonic stem cells as their cell of interest, so we first had to determine the ideal conditions for these small molecules in WT mESCs.
The most common modifier of Wnt signaling is Lithium Chloride, LiCI. It has been extensively used in bipolar disorder (BPD) treatment for over 50 years (Cade 1949). Though the mechanisms by which it operates are still not fully understood, it has been shown that LiCI directly inhibits Gsk-3 (Klein and Melton 1996; Stambolic, Ruel, and Woodgett 1996). However, LiCI is not specific for Gsk-3, resulting in off-target effects (Phiel and Klein 2001). Therefore, we did not use LiCI except as a control for Wnt activation. We sought to modify Wnt more specifically using AMBMP, KY-02111, and Cardionogen-1. AMBMP activates Wnt (Jun Liu et al. 2005) while KY-02111 and Cardionogen-1 both inhibit the pathway (Minami et al. 2012; Ni et al. 2011).
To analyze the Wnt inhibitor small molecule activity, stable HEK293T-OT cells were used. The OT denotes that the cells are a stable line with luciferase downstream of LEF binding sites. These sites are normally upstream of Wnt target genes and are activated in part by 3-catenin; thus, these cells report on Wnt activation. HEK293T-OT cells were used first because they are easy to assay and to determine base dosing. If
21


successful, we planned to move onto ESCs. The HEK293T-OT cells were treated with
lOmM LiCI to turn on Wnt signaling first and then cells were treated with differing concentrations of either KY-02111 (1 pM, 10 pM, or 20 pM) or Cardionogen-1 (10 pM, 15 pM, or 20 pM). A luciferase assay was performed; all treated conditions should have lower expression than the LiCI Wnt-activated positive control (Figure 10). Though the Cardionogen-l-treated cells certainly did not show the expected inhibition, the two lower dosages of KY-02111 (1 pM and 10 pM) looked promising.
6000
5000
4000
3 3000
Sample
Figure 10: Luciferase Assay on HEK293T-OT cells treated as shown on x-axis. Error bars denote technical replicates. All are normalized to re nil la in the same sample.
22


A variety of other methods were attempted to test the small molecule activity in
mouse embryonic stem cells and HEK293Ts. A plasmid called TOP-GFP (Addgene) was used in WT and DKO mESCs. TOP-GFP, which is similar to the reporting in HEK293T-OT cells, has TCF/LEF promoters upstream of a GFP reporter. A visible fluorescent signal can be observed when cells have activated 3-catenin. We expected to see reduced GFP if the Wnt inhibitors were working, but that was not apparent (data not shown). Serum-starved WT mESCs were also subjected to the Wnt inhibitors to see if serum in the media was confounding results. Those results were also inconclusive.
WT mESCs were treated with AMBMP at 0.5pM, 1 pM, lOpM, or left untreated. Protein was harvested after 24 and 48 hours of treatment for each dosage and the negative control. Protein was blotted for 3-catenin and phosphorylated-|3-catenin but failed to show an increase with dosage, time, or even compared to the negative control (data not shown).
We turned our attention to the insulin (PI3K) signaling with SC-79, LY-294,002 and 10-DEBC. SC-79 activates Akt, which phosphorylates free Gsk-3 (Jo et al. 2012). LY-294,002 and 10-DEBC inhibit PI3K and Atk, respectively (Lianguzova et al. 2007). To understand how these molecules work in WT mESCs, the cells were treated with SC-79 to observe activation of insulin signaling. Additionally, pllO* (insulin activated) cells were treated with LY-294,002 or 10-DEBC to examine how much inhibition occurred via western blot for total Gsk-3 and phosphorylated Gsk-3. Phosphorylated Gsk-3 should increase with SC-79 but decrease with LY-294,002 or 10-DEBC treatment. Total Gsk-3 should not change. Figures 11 and 12 exhibit the results of western blots for Gsk-3 and
23


phosphorylated Gsk-3. Fifty micrograms of protein were added to the gel for each sample so that relative changes in phosphorylated Gsk-3 were apparent. SC-79 appeared to increase PI3K signaling slightly, but neither 10-DEBC or LY-294,002 appeared to inhibit insulin signaling. Most of the cells treated with 10-DEBC died, accounting for the lack of bands in most of those samples.
o
CO
5
Q
)-79 in serum-1 â–  10-DE
free WT
- 2
t i e 3 O) §> § 5 5 cv
Tf to 00 O
Figure 11: Western blot for Gsk-3 on PI3K activators and inhibitors.
In the next attempt to use SC-79, the Akt activator, WT mESCs were not given LIF
but treated with SC-79. We thought the LIF might be confounding the results by
stimulating pluripotency. Cells were washed and fed with new media and new SC-79
24


(but never LIF, except the control) every other day. Protein was collected from one well
every other day to determine FTO levels in the cells treated with the Akt activator over time. FTO was chosen as a target because activated insulin signaling causes Gsk-3 to become phosphorylated. Gsk-3 normally phosphorylates FTO and its removal should cause FTO levels to rise. A western blot probing for FTO was performed as well as blots for total Gsk-3 and phosphorylated Gsk-3 using the same amount of total protein for each sample. Sadly, no change was seen in FTO overtime or in phosphorylated Gsk-3 (data not shown).
Though KY-02111 seemed promising at low concentrations in HEK293T-OT cells, it failed to affect mESCs, our cell of interest. All other Wnt and insulin small molecules did not show promising results in any cell type, so this methodology was abandoned for this study.
Establishing Conditions for Wnt Activation
We tested the mutated 3-catenin S33A plasmid (not the stable cell line) to be confident it was expressing, using a luciferase assay and a western blot. In S33A (3-catenin, the 33rd amino acid, serine, is changed to an alanine, creating a mutated Gsk-3 phosphorylation sequence. Since Gsk-3 is not able to phosphorylate the 3-catenin, the 3-catenin will not be degraded and can accumulate faster and turn on Wnt gene expression further. HEK293T cells transfected with S33A plasmid were compared against HEK293T cells transfected with pCAGEN as a negative control (Figure 13). This time the luciferase construct SuperTOPFIash was utilized. SuperTOPFIash is a 3-catenin reporter for luciferase assay; it has 8 TCF/LEF binding sites, which are what 3-catenin binds
25


normally to promote Wnt target transcription. When 3-catenin binds these sites in SuperTOPFIash, luciferase will be expressed and can be quantified. This indirectly shows whether 3-catenin has been overexpressed. We expect 3-catenin expression to be high in S33A cells since it cannot be phosphorylated and degraded. This was observed.
140000 130000 120000 110000 100000 90000 80000 3 70000
60000 50000 40000 30000 20000 10000 0
|3~catenin vs pCAGEN
p-catenin mut (S33A) pCAGEN (control)
Figure 13: Luciferase Assay on HEK293T cells with or without the mutated (3-
catenin plasmid, S33A.
A western blot was also performed on these HEK293T cells with S33A or S33A + FTO and probed for 3-catenin expression (Figure 14). This is a direct measure of the (3-catenin expression in S33A-transfected cells. Now that this was confirmed, we could continue the experiments using S33A-transfected cells to over express mutant (3-catenin.
26


Figure 14: Western blot for 3-catenin in HEK293T cells transfected with S33A, S333A + FTO, or untransfected (negative control).
The S33A plasmid can be transfected into HEK293T cells or WT mESCs, which offers transient expression of the mutated 3-catenin. Another means to turn on Wnt signaling more continuously in WT mESCs is with conditioned media from Wnt3a L-cells. L-cells are mouse fibroblast cells; Wnt3a L-cells produce wnt3a protein and secrete it to the media. Wnt3a is a protein that activates Wnt signaling by inducing the accumulation of 3-catenin (He et al. 2015). We decided to use Wnt3a conditioned media to induce Wnt signaling in WT mESCs as an additional way to study the effects of constitutive Wnt signaling. Taking the media from these Wnt3a L-cells (with wnt3a protein in it) and placing it on WT mESCs will activate Wnt signaling. L-cells (non-wnt3a activated) were used as a control. Wnt3a media was combined in a ratio of 1:1 with complete ESC media and given to WT mESCs for 6 hours. Unfortunately, the conditioned media did not appear to activate Wnt signaling when a western blot for 3-catenin was performed (Figure 15). Moving forward, we used WT mESCs transfected with an S33A plasmid as
27


the Wnt-activated model. (In some experiments we used pCAG-delta90-GFP, which has
the same S33A mutation in |3-catenin, with the addition of GFP fusion.)
Csl
fH rsi re nj
TO ro T3 T3
"O Ol T3 (0 Ol E Ol E
E E TO ro
— — ro O')
100 kDa
70 kDa I
Figure 15: Western Blot for 3-catenin that does not appear to show increased expression of 3-catenin in cells in Wnt3a conditioned media as compared to the L-cell
media, a negative control
Activating Wnt and Overexpressing FTO
Since the genetic deletion of Gsk-3 and the reduction of m6A tags (via decreased FTO) results in indefinite pluripotency, we thought the effects of each might converge. Following this hypothesis, we expect that a cell with a mutant 3-catenin will increase Wnt expression because this mutation disrupts the Gsk-3 phosphorylation sequence, meaning it cannot be phosphorylated and degraded. We also believe that overexpressing FTO in the same cell would further increase Wnt target expression by removal of m6A tags from Wnt transcripts. We found that the dual overexpression of FTO and mutant 3-catenin increased one Wnt target gene, MYC, but not SOX17 or MYCN, though all are Wnt or pluripotency transcripts. SOX17 expression was increased the greatest with mutant 3-catenin alone. MYCN was actually decreased by the addition
28


of FTO with mutant 3-catenin while MYC expression did not increase with mutant (3-
catenin alone (Figures 16, 17, 18). None of these cases showed the significant overexpression of the Wnt target genes that we anticipated, given the luciferase assay results for 3-catenin overexpression (Figure 13).
3.5
WT S33A S33A + FTO
Myc
Figure 16: qPCR data showing MYC expression up in S33A +FTO mESCs. Error bars represent technical and biological replicates.
3
WT S33A S33A + FTO
SOX17
Figure 17: qPCR data showing SOX17 expression up in S33A but not S33A + FTO mESCs. Error bars represent technical and biological replicates.
29


WT S33A S33A + FTO
MYCN
Figure 18: qPCR data showing MYCN expression up in S33A cells but down with the addition of FTO. Error bars represent technical and biological replicates.
Since we saw different results with respect to the SuperTOPFIash reporter (Figure 13) and the endogenous gene expression with the 3-catenin S33A plasmid (Figures 16, 17, 18), we decided to use a mutant-|3-catenin stable cell line moving forward, rather than continuing with the mutant 3-catenin plasmid in a transient transfection as this could be affecting the results.
Using the stable S33A cell line, FTO was overexpressed and a western blot was performed with FTO antibody. Overexpression was found. This was compared against an S33A cell transfected with the empty vector pCAGEN (negative control) and WT cells with FLAG-FTO known to overexpress (positive control) (Figure 19). S33A cells do not have FTO overexpression since Gsk-3 has not been altered, so the experimental set up of S33A cells with overexpressed FTO will work to address our hypothesis. qPCR was performed in untransfected cells and FTO-overexpressed S33A cells against a WT control to determine basal MYC expression in these cell types and to determine whether
30


increasing FTO expression in S33A cells would also increase MYC expression. We expected the S33A alone to cause a large increase in MYC expression and for FTO overexpression to increase MYC expression even more. We found an increase in S33A as compared to WT, but the expected increase from overexpressed FTO was not found (Figure 20).
Figure 19: Western blot for FTO to confirm FTO overexpression in S33A cells. FLAG-FTO has a weight of 67 kDa. Lane 1 is S33A cells with pCAGEN, a negative control. Lane 2 is the S33A cells with FLAG-FTO. Lane 3 is WT cells with FLAG-FTO, a known
positive control.
31


Figure 20: qPCR data comparing MYC expression between WT control and S33A cell with and without overexpressed FTO. Error bars represent biological and technical
replicates.
A luciferase assay was performed to see if the expression of FTO affects the Wnt-responsive (3-catenin) reporter SuperTOPFIash. S33A and WT cells were transfected with luciferase (SuperTOPFIash), renilla (pRL-SV40), GFP (pMAX-GFP), and either pCAGEN (negative control) or pCAGEN-FLAG-FTO (Figure 21). FTO appeared to have a minor effect in S33A cells but nearly no 3-catenin expression was detected in either WT condition. Therefore, these results are largely inconclusive.
32


180000
160000
140000
120000
100000 Z5
_i
££
80000 60000 40000 20000 0
WT + pCAGEN S33A + pCAGEN WT + FTO S33A+FTO
Figure 21: Luciferase Assay on WT or S33A cells with or without overexpressed FTO. Error bars represent biological and technical replicates.
Effect of FTO Overexpression on Transcript Half-Life
To determine whether overexpression of FTO (and therefore removal of m6A and rn6Am) has an effect on the half-life of mRNA transcripts, we overexpressed it in WT mESCs and S33A mESCs. Actinomycin-D treatment was then used. This stops new transcription, so that transcripts in the cell after this treatment were prepared before treatment and a half-life can be calculated. RNA was collected at time 0 and 2 hours after actinomycin-D treatment. qPCR was performed for MYC and we expected the
33


increased FTO to increase the half-life of Wnt targets. This was observed in WT cells
with overexpressed FTO, but not S33A cells with overexpressed FTO (Figure 22).
MYC
1.2
WT WT FTO S33A S33A FTO
Cell type/treatment
â–  0 hour â–  2 hours
Figure 22: Overexpression of FTO in WT but not S33A cells appears to increase the
half-life of MYC, a Wnt target gene.
The same general trend was found for the half-life of ESRRB and NANOG, both pluripotency genes, in S33A cells with the overexpression of FTO (Figures 23, 24).
34


ESRRB
1.2
1
0.8
0.6
0.4
0.2
0
S33A
S33A+ FTO
â–  Ohour â–  2 hours
Figure 23: qPCR data showing that ESRRB half-life is not increased when FTO is
overexpressed in S33A cells.
1.2
1
0.8
0.6
0.4
0.2
0
Nanog
S33A
S33A+ FTO
â–  Ohour |2 hours
Figure 24: qPCR data showing that NANOG half-life is not extended with FTO
overexpression in S33A cells.
35


We were again concerned that the transient transfection of FTO was muddling
the results, similar the transient transfection of the S33A plasmid. In an effort to more accurately study the overexpression of FTO in S33A cells, we attempted to transduce FTO into S33A cells with a virus so that it would be stably expressed. Viral assembly can be found in the methods section, but briefly, a packing plasmid, envelope vector, and transgene (pTripz-FTO-YFP) were assembled in HEK293T cells and then allowed to infect the S33A mESCs. Though the virus assembled as expected and YFP was visible, the transduced cells did not express FTO as anticipated when tested with a western blot.
We expected two bands on an FTO blot: one at 58 kDa, which is the endogenous FTO, and another band at 85 kDa, the size of FTO plus YFP that was transduced. Figure 25 shows the positive control with two bands and the failed S33A + FTO viral lane with only endogenous FTO appearing. Moving forward, we used the transient transfection of FTO as it was the only method available.
36


o o
m
5
O
K
-V
*
-J-
4-
100 kQA
50KDA
Figure 25: Western Blot for FTO on viral cells. "WT + FTO (Viral (+))" is the positive control for transduced cells. "S33A+ FLAG-FTO" and "WT +FLAG-FTO" are transfected cells for FTO positive control. "S33A + FLAG-FTO Viral" is the newly transduced cell type. This transduction did not work, as apparent by the single band at 58 kDa and no larger band at 85 kDa. The 85 kDa band is the fusion of FTO with YFP.
Interactions of Wnt and Insulin Signaling
Since the expected effects from overexpressing FTO in Wnt-activated cells were not observed, we wanted to determine if activating concurrent Wnt and insulin signaling would affect Wnt target genes more than a single pathway alone. Insulin signaling might have a direct effect on m6A tags, and pluripotency, because activated insulin signaling targets Gsk-3 for degradation, meaning FTO levels might rise and remove m6A (and rn6Am) tags. Wnt signaling might have an indirect effect on m6A tags, as it sequesters Gsk-3.
WT cells were transfected using pypCAG-HA-pllO-IH (conferring constitutive insulin signaling and a transient form of the expression found in pllO* cells (Addgene)) to confirm the plasmid's pllO overexpression. This was established through western blot with an antibody for the pllOa. S33A cells were also transfected with pypCAG-HA-pllO-IH and showed the expected overexpression of pllO via western blot. These cell
37


types were used in the following Nanostring experiments to determine gene expression
levels of mRNAs normally (WT) m6A-tagged.
Gene Expression Quantification via Nanostring
Because our previous approaches did not pan out to study interactions among Wnt, insulin, and FTO, a new metric was needed. For this, we used Nanostring. Nanostring is a variation on microarray. It counts gene expression based on mRNA transcripts and does not require cDNA synthesis. This is important because it reduces the number of steps and therefore reduces the technical variation in the samples, which can be a problem with qPCR. This allows for detection of small fold changes that can more reliably be assigned to actual gene expression change, rather than technical variation. At its highest output, up to 800 genes can be analyzed on 12 samples at once. Two target-specific probes, about ~50 bp each, are created for each gene of interest: one is the capture probe and the other is the reporter. These, along with the mRNA sample and buffer, are run in a thermocycler at 65°C overnight to hybridize. The next day, magnetic beads are used to remove unbound probes. The mRNA of interest are then bound to both their capture probe and their reporter probe. The capture probe has a biotin bead at the end and the reporter probe has a fluorescent barcode specific to the gene. This barcode is made of six spaces, each of which can be one of four colors. These capture probe-mRNA-reporter probe hybrids are run over a streptavidin-coated slide so that the biotin bead attached to the capture probe can bind the cartridge. An electric current is then run over the cartridge so that all mRNA and probes lie down flat and in the same direction and are then fixed to the cartridge. This way, each fluorescent
38


barcode can be imaged individually (Nanostring Technologies 2017). The nCounter®
MAX Analysis System at the University of Arizona Genetics Core Facility was used to run each cartridge. Data is output as raw count data for each gene. The data can then be visualized with Nanostring's nSolverâ„¢ software.
For the purpose of these experiments, genes previously found to have decreased m6A methylation in DKO mESCs as compared to WT mESCs via m6A-seq (Faulds et al. 2018, submitted) were used in Nanostring analysis as well as genes that could play a part in the processes we are investigating. The genes are listed below in Table 1. The capture probe sequence for each gene of interest is listed in the appendix. The probes were expired. Each sample run, including cell types, overexpression, and time course data are found in Table 2. Cell types were chosen that overexpressed different mutations in Wnt or insulin signaling or m6A modifiers, including:
• WT mESCs, as a baseline and as a cell type for subsequent transfection with modifiers listed below
• Gsk-3 DKO mESCs, which confer constitutive Wnt signaling (and other unknown off-target effects)
• mutated 3-catenin (S33A stable cells or A90-GFP transfected), which cannot be phosphorylated by Gsk-3, leading to increased Wnt target gene activation
• pllO* (stable cell line or pllO* transfected), which confers constitutive insulin signaling activity, inhibiting Gsk-3, potentially increasing FTO and decreasing m6A
39


• FTO overexpression, which will lead to decreased m6A
• WT or DKO cells grown without LIF, which will lead to a decrease in pluripotency in WT cells.
Table 1: All 48 genes surveyed with Nanostring. Genes with asterisk are used as housekeeping genes.
ALKBH5 CBX7 ESRRB ID2 KIT MSL1 NOTCH1 SORT1
APC CCND3 FTO IMPDH2* LEFTY2 MTOR NOTCH2 SOX17
BCL9L CD44 GAPDH* IRS1 LIF MYC PITX2 T
BMP4 CDX2 GATA6 IRS2 UFR MYCN POU5F1 TWIST1*
CBX1 DND1 GUI JAG2 MDM2 NODAL PPARD VEGFB
CBX4 EOMES GU3 JUN MLL2 NOG RPL4* WNT6
Table 2: All cell types sampled in Nanostring analysis. All were run in duplicate, except those denoted with ** before sample type. Full plasmid names for transfections are shown in Table 3.
Cell Type Transfection Time (h)
DKO mESC - 0
DKO mESC - 0.5
DKO mESC - 1
DKO mESC - 2
DKO mESC - 4
WT mESC - 0
WT mESC - 0.5
WT mESC - 1
WT mESC - 2
WT mESC - 4
pllO* - -
DKO mESC + FTO -
WT mESC + FTO -
**pll0* + FTO -
**WT mESC + pllO + A90-GFP -
WT mESC + pllO+ A90-GFP +FTO -
WT mESC + A90-GFP + FTO -
pllO* + A90-GFP + FTO -
WT mESC-LIF - -
DKO mESC-LIF - -
40


Though we have seen that transient transfections are not ideal, we had to use
them in this case to overexpress multiple genes. To address this, we transfected in the afternoon and harvested the RNA the following morning after confirming with GFP that the transfection was successful. This way, expression from the plasmids should be at a high and producing the effects that we sought.
Each cell type in Table 2 was transfected in two batches (biological duplicates) and plated into four wells total (technical duplicates) as shown in Table 3. pllO denotes the plasmid pypCAG-HA-pllO-IH and overexpresses pllO. PllO* mESC refers to the stably expressing pllO* cell line. A90-GFP denotes pCAG-A90-GFP, which is a mutated form of 3-catenin that cannot be phosphorylated/targeted for degradation, the same as S33A but with a GFP fusion. FTO denotes pCAGEN-FLAG-FTO, the overexpression of FTO. GFP denotes pMAX-GFP and was used to visualize successful transfection in cells without A90-GFP. pCAGEN is simply empty vector and is used so that all cells experience a transfection of 2 micrograms of DNA. Time course samples were treated with actinomycin-D, which stops new transcription, so that transcripts in the cell after this were transcribed before treatment and a half-life can be calculated.
Protein was isolated from two wells (one of each biological duplicate) to verify overexpression from the transfection while RNA was isolated from the other two wells to run with Nanostring. These were the biological duplicates. RNA was quantified with Nanodrop 2000 and re-quantified with Qubit at the University of Arizona Genetics Core Facility. One hundred nanograms of RNA was run for all time course and -LIF samples, and 200 ng of RNA was run for all transfected samples.
41


Table 3: Transfection scheme for cells under Nanostring Analysis. pllO denotes pypCAG-HA-pllO-IH. A90-GFP represents pCAG-delta90-GFP. FTO denotes pCAGEN-FLAG-FTO. GFP indicates pMAX-GFP. pCAGEN is the empty vector.
Cell Type Transfected Plasmid (pg) Transfected Plasmid (pg) Transfected Plasmid (pg) Transfected Plasmid (pg)
WT mESC - A90-GFP (0.6 pg) pCAGEN (0.8 pg) FTO (0.6 pg)
WT mESC pllO (0.6 pg) A90-GFP (0.6 pg) pCAGEN (0.8 pg) -
WT mESC pllO (0.6 pg) A90-GFP (0.6 pg) pCAGEN (0.8 pg) FTO (0.6 pg)
pllO* mESC - - pCAGEN (0.8 pg) + GFP (0.2 pg) FTO (1 pg)
pllO* mESC - A90-GFP (1 pg) - FTO (1 pg)
WT mESC - - GFP (0.2 pg) FTO (1.8 pg)
DKO mESC - - GFP (0.2 pg) FTO (1.8 pg)
Because we used both time course samples and transfected, non-time course samples, we now have information on the half-life of each gene in either WT or DKO mESCs as well as information on how each gene is affected by activating or inhibiting Wnt signaling, insulin signaling, and/or FTO. All samples were normalized using positive and negative control probes (Nanostring) as well as four housekeeping genes: RPL4, IMPDH2, GAPDH, and TWIST1. These genes were chosen because we did not expect them to be modulated by any of our sample types. The Nanostring nSolverâ„¢ software was used for all normalizations. A sampling of the most interesting or unexpected findings is below, starting with time course data.
We first created a heat map to visualize all time course data. This allowed us to compare the duplicate samples and get an impression of gene expression overtime (Figure 26). The most noticeable elements are that WT and DKO do indeed have differential gene expression overall and that the DKO at time 0 duplicates are not similar. One of the DKO time 0 samples appeared to be an outlier but has been included in all figures for reference.
42


in m
in in
OQOOHHNN#*
ilililililililitilil
OOOOHHNN««
ilililililililitilil
oooooooooo
*& *s fs 's 's *s fs *s *& *s a a a a a a a a a a
Lefty2
Kit
CcndJ
rl
1— 1 L
r£S
r
1
jE

M
Id2
Mycn
Sortl
Cbxl
GUI
Modal
Dndl
rto Life Jun Kdm2 Lit Bcl91 Ppard ft 112 Alkthi Motch2 Kail Ape Pitx2 Mtor Mog Irsl let 2 CliJ Notch1 Jag2 Cbx7 Esrrb Bmp< Kyc Cdx2 Eomes T
Sox 17 Cata6 Vfnti Cd44 Cbxt Poulf1
Vegfb
Figure 26: Heat map showing the time course data for WT and DKO mESCs. Black denotes decreased expression while white denotes increased expression. The genes have been clustered, but samples have been ordered so that biological replicates
appear next to each other.
43


The time course data gives us an idea about the half-life of mRNA transcripts in
WT and DKO mESCs as well as general gene expression levels between the two cell types. We expected to find an increased half-life in transcripts identified as being decreased in m6A enrichment in DKO cells, since m6A marks transcripts for degradation. The following figures show both data points for each set of biological duplicates as well as a linear line of fit over time, rendered in R with ggplot2.
We examined variances in the half-life of genes between the two cell types. Five genes (BMP4, ESRRB, FTO, PPARD, WNT6) had a decrease in half-life in DKO cells as compared to WT (Figure 27). BMP4, ESRRB, and FTO all play a role in pluripotency. (FTO because it removes m6A tags, leading to increased pluripotency.) WNT6 and PPARD are Wnt targets. It was expected that ESRRB, PPARD, and FTO would have a decreased half-life in DKO because of the previous finding that m6A is reduced on these transcripts in DKO mESCs. However, in the absence of LIF, DKO mESCs had lower expression of all 5 of these genes (Figure 28). BMP4 had the largest drop without LIF, dropping below expression levels in WT with or without LIF. We cannot say whether the half-life of these genes would be the same or different in -LIF cells. Further study is required on this.
Genes with increased overall expression in DKO mESCs over WT mESCs all have a part in pluripotency and differentiation regulation: CDX2, GATA6, EOMES, SOX17, and T (Figure 29). This was somewhat unexpected, as DKO cells tend to remain pluripotent even in the absence of LIF. This goes hand-in-hand with findings from Figure 27, the decreased half-life of some pluripotency genes in DKO cells. If the half-life of pluripotency genes is shorter in DKO cells, it appears that DKO cells are upregulating
44


differentiation genes while downregulating pluripotency transcripts. Note also that all of
these genes had a negligible expression level in WT. However, when grown without LIF for 14 days ("DKO -LIF"), DKO cells had decreased expression of all of the differentiation genes above (except CDX2, which is known to have decreased m6A in DKO + LIF mESCs) (Figure 30). DKO - LIF cells had increased expression of SOX17. This might mean that LIF is confounding results for genes that play a role in differentiation regulation in DKO cells.
Three genes had a shorter half-life in WT cells, but a pattern was not clear (Figure 31). ID2 is involved in Wnt signaling while MYCN is a pluripotency factor. Both of these had decreased m6A tags in DKO cells. ID2 expression increases in WT grown without LIF while GLI1 expression decreases in both cell types without LIF (Figure 32). A few genes had similar half-life between the two cell types: APC, GLI3, and KIT (Figure 33). KIT was found to have lowered m6A in DKO cells previously, which makes this finding unexpected. Both GLI3 and KIT had increased expression in WT grown without LIF, though (Figure 34).
Genes with decreased expression in DKO over WT did not follow a pattern as tightly (Figure 35). CBX1, ID2, and MYCN are Wnt genes while the other two (DND1,
GLI 1) are not. DND1 had low expression in both cell types and a long half-life. MYCN had a shorter half-life in WT but higher expression generally, even after 4 hours. Note the high overall expression of CBX1 in both cell types. Also note that ID2, GLI 1, and MYCN were found to have a shorter half-life in WT cells as well (Figure 31). However, in the DKO -LIF cells, CBX1, DND1, and GLI1 expression was even lower than WT with or
45


without LIF. ID2 and MYCN expression was similar in both DKO with and without LIF (Figure 36).
Very few genes had similar expression levels and half-life between DKO and WT (Figure 37). They include MDM2, CBX7, and, surprisingly, MYC. MYC is involved in Wnt signaling and is the main gene of interest we were previously using to assess whether Wnt target genes were being transcribed. The expression of this gene is significantly downregulated in DKO cells grown without LIF, while remaining relatively unchanged in WT cells with or without LIF (Figure 38).
Three genes had particularly high expression in both cell types, suggesting there is not a strong link between Gsk-3 inhibition and CCND3, ESRRB, and POU5F1 (Figure 39). This is interesting because ESRRB and POU5F1 are involved in pluripotency; it has been shown previously that POU5F1 is not m6A-tagged (Batista et al. 2014). We previously knew that ESRRB had decreased m6A marks in DKO cells yet it has a shorter half-life in DKO in this data. In DKO cells grown without LIF, ESRRB had lowered expression, even more on par with WT. CCND3 expression fell below WT expression when LIF was not administered to DKO cells. POU5F1 expression also decreased in DKO -LIF cells, but still maintained a very high expression level of around 30,000 counts (Figure 40). Nonetheless, both of these cell types are embryonic stem cells, so we do expect pluripotency factors to be expressed highly in them.
46


Shorter Half-Life in DKO
Fto
Cell Type
DKO
WT
Ppard
Wnt6
Figure 27: Genes with shorter half-life in DKO cells in time course experiments. All cells were treated with LIF. Points depict actual results. Line is a linear line of
fit over time.
47


BMP4, ESRRB, FTO, NODAL, PPARD, WNT6: With and Without LIF
Bmp4
Esrrb
c 4000
3
<3

0+°
Sample
Sample
Fto
Ppard
3 1500
o
O


o^°
Sample
Sample
Wnt6
Sample
Figure 28: Genes found to have a shorter half-life in DKO over time, shown here in
-LIF experiments in same cell types.
48


Differential Gene Expression: DKO Up
Cdx2
Gata6
Eomes Sox17
DKO
WT
Cell Type DKO WT
Cell Type
DKO
WT
Cell Type DKO WT
Figure 29: Genes with increased expression in DKO cells in time course experiments. All cells were treated with LIF. Points depict actual results. Line is a
linear line of fit overtime.
49


CDX2, GATA6, EOMES, SOX17, T: With and Without LIF
Cdx2
Eomes
Sample
Sample
T
Gata6
SamDle
Sox17
Sample
Sample
Figure 30: Genes found to have increased expression in DKO over time, shown here
in -LIF experiments in same cell types.
50


Figure 31: Genes with a shorter half-life in WT cells in time course experiments. All cells were treated with LIF. Points depict actual results. Line is a linear line of fit over
time.
51


GUI, ID2, MYCN: With and Without LIF
Gli1 Id2
Sample Sample
Mycn
mn
Sample
Figure 32: Genes found to have a shorter half-life in WT over time, shown here in
-LIF experiments in same cell types.
52


Figure 33: Genes with similar half-life in both cell types in time course experiments. All cells were treated with LIF. Points depict actual results. Line is a linear line of fit
over time.
53


APC, GLI3, KIT: With and Without LIF
APC GM3
SamPle Sample
Kit
Sample
Figure 34: Genes found to have similar half-lives in both cell types over time, shown here in -LIF experiments in same cell types.
54


Differential Gene Expression: DKO Down
Dnd1 Cbx1
Cell Type
Id2
DKO
WT
Mycn
Cell Type
DKO
WT
Cell Type
DKO
WT
Cell Type
DKO
WT
Figure 35: Genes with decreased expression in DKO cells in time course experiments. All cells were treated with LIF. Points depict actual results. Line is a
linear line of fit overtime.
55


DND1, CBX2, GUI, ID2, MYCN: With and Without LIF
Cbx1
Dnd1
Sample
Sample
Figure 36: Genes found to have decreased expression in DKO over time, shown here
in -LIF experiments in same cell types.
56


Similar Overall Expression Pattern and Level in Both WT & DKO
Mdm2 Cbx7
Cell Type
DKO
WT
Cell Type
DKO
WT
Figure 37: Genes with similar overall expression pattern and level in both cell types in time course experiments. All cells were treated with LIF. Points depict actual results. Line is a linear line of fit overtime.
57


MDM2, CBX7, MYC: With and Without LIF
Myc
Sample
Figure 38: Genes found to have similar expression patterns and level in both cell types overtime, shown here in -LIF experiments in same cell types.
58


High Gene Expression in Both WT & DKO
Ccnd3
Esrrb
Cell Type
DKO
WT
Cell Type
DKO
WT
Cell Type DKO WT
Figure 39: Genes with high expression levels in both cell types in time course experiments. All cells were treated with LIF. Points depict actual results. Line is a
linear line of fit overtime.
59


CCND3, ESRRB, P0U5F1: With and Without LIF
Ccnd3
Sample
Pou5f1
Esrrb
Sample
Sample
Figure 40: Genes found to have high levels of expression in WT & DKO over time, shown here in -LIF experiments in same cell types.
We turned our attention to the transfected cells, which have one or more Wnt, insulin, or m6A modifier. First, a heat map was generated (Figure 41). The nSolverâ„¢ software clustered the genes as well as the samples and we found that the duplicate samples clustered together, indicating the duplicates were in agreement, except for (again) the DKO time 0 duplicates.
The main finding in transfected cells was that pllO* cells (insulin activated) with FTO overexpression (pllO* + FTO) had increased expression of 8 genes over not only pllO* cells, but also many or all other cell types (Figure 42). The genes include CBX4,
60


GUI, I RSI, ID2, JAG2, JUN, MDM2, and NOG. Of the top five Gene Ontology (GO) Biological Process terms for this group of genes, 3 contain "morphogenesis" and 2 contain "differentiation" (Table 4). Note that ID2 and MDM2 also had high expression levels in pllO* + 3-catenin + FTO (Figure 42).
We next looked into the expression profiles for genes with increased expression in pllO* cells. This included CCND3 and WNT6, both Wnt genes. NOG was also upregulated in these cells (Figure 43).
The genes found to be upregulated in the DKO time course data were again found to be upregulated in DKO above all other cell types here: CDX2, EOMES, GATA6, SOX17, and T (Figure 44). All five of these genes are related to differentiation and pluripotency. (Again, though, EOMES, GATA6, and T are down-regulated significantly in DKO -LIF cells while SOX17 is upregulated (Figure 30)).
Figure 45 displays genes with upregulation in all three mESCs more than in that mESC with any transfection. All three cell types (WT, DKO, and pllO*) had increased CCND3, MYC, and VEGFB. CCND3 is a regulator of differentiation while MYC is involved in Wnt signaling. All three of these genes were found to have decreased m6A content in DKO mESCs previously.
WT + FTO increased the expression of KIT, LEFTY2, and NODAL (Figure 46). LEFTY2 directs left-right asymmetry determination of organ systems during development while NODAL is a differentiation regulation transcript for early embryonic development. KIT is involved with stem cell pluripotency and tumorigenesis.
61


Lastly, P0U5F1 expression was again found to be very high in all cell types,
regardless of transfection status (Figure 47), suggesting that this gene is unaffected by
any of these modulations, except LIF (Figure 40).
II
p p n n n
E £ V V V
Lefty2 Vcgfb Cbxl Kycn Endl
Liir Pouif1 Ktor Motch2 Ml 12 Ape Alk£h!> Ppard Esrrc
---- Cbx?
---- Ms 11
---- Fto
---- Be 191
---- Pitx2
---- Cdx2
j Soxl?
* C a t a fa
T
Eomcs Bmp 4
Myc CcndJ Id2 Sort 1 Clil Kit Xodal Iri2 Jag2 Cli3 Notch1
Jun Mdm2 Lif Cbx 4 Irsl Cd4 4 Wntfc Nog
Figure 41: Heat map depicting differential gene expression in the transfected cells. Black means lowered expression and white is higher expression. Genes and samples
have been clustered.
62


Gene Expression is Increased in pllO* + FTO
Cbx4
C
O

\'tf
A'®'

MS' cA° cA° \\° cA°
VZ-’"
MS' m*'*
MS'
Gli1
Sample
Sample
Figure 42, Continued on next page.
63


Gene Expression is Increased in pllO* + FTO, continued
Jag2
~ 300
5
ro 200
o«° ,^° ,^°
0*u

. " ,e^ -t*' ^ -G*
Mf1
Sample
Jun
• 4000-■£ 3000 * •
Lkdll 3 O O 2000- © c _j 1000- o-
0+0 ,^° A'0' ,^° ,<& ^ ,^° ,^° ,^°
a'0"


Sample
Mdm2
â– hllnlll
df£> sP .\o’ „\\° s>°
V r\*' v <*' *V -.*T
A^' '


Sample
0*° ,^° o''°' ,^° ,^° ^ »^° ,^° »^°
, » V
Sample
Figure 42: Gene expression data for genes in which expression in upregulated in pllO* + FTO cells. Purple dots are actual data (biological duplicates, except for pllO* and WT + 3-catenin + pllO*). Gray bars are average expression between duplicate
samples.
64


Table 4: Gene Ontology terms for Biological Process for genes with highest expression in pllO* + FTO cells.
GO Term ID P-Value (with FDR multiple test correction)
Membranous Septum Morphogenesis G0:0003149 6.35 x 10"3
Notochord Morphogenesis G0:0048570 6.57 x 10"3
Endocardial Cushion Morphogenesis G0:0003203 1.41 x 10"2
Negative Regulation of Glial Cell Differentiation G0:0045686 1.59 x 10"2
Regulation of Astrocyte Differentiation G0:0048710 1.89 x 10"2
65


Gene Expression is increased in pllO* cells
Ccnd3
Nog

Wnt6
> ° O*^
0+°
yvtf ^
A'0
Sample
Q 400
MM*

0*P* ^^>*'',9''°
't*' '**'

Sample
Figure 43: Gene expression data for genes upregulated in pllO* cells. Purple dots are actual data (biological duplicates, except for pllO* and WT + 3-catenin + pllO*). Gray bars are average expression between duplicate samples.
66


Gene Expression is Upregulated in DKO and/or DKO + FTO
Cdx2
Eomes
5000- •
y \'0’ y ^ y y y y o*° y o''0- y o'0 •jJ' o'° o'0
* yy y ^ y y y y
Sample Sample
Gata6 Sox17

o 5000-
o*°
yy -t*' o'° o'° „\'° o'° <*» o'° o''0'
<'V* o"tf VVV'° ^ ifV . * V irf* 0*° \'°‘ *'.V o''°
9
Sample

Sample

o+° ^ ^ ^yyy*




Sample
Figure 44: Gene expression is highest in DKO and/or DKO + FTO cells. Purple dots are actual data (biological duplicates, except for pllO* and WT + 3-catenin + pllO*). Gray bars are average expression between duplicate samples.
67


Untransfected Cells Have Highest Gene Expression
Ccnd3 Myc
Sample Sample
Vegfb
Sample
Figure 45: Gene expression is highest in untransfected cell as compared to their transfected counterparts. Purple dots are actual data (biological duplicates, except for pllO* and WT + 3-catenin + pllO*). Gray bars are average expression between
duplicate samples.
68


Gene Expression is Highest in WT + FTO
Kit
Sample
Nodal
Lefty2
Sample
Sample
Figure 46:Gene expression is highest in WT + FTO cells. Purple dots are actual data (biological duplicates, except for pllO* and WT + 3-catenin + pllO*). Gray bars are average expression between duplicate samples.
69


Figure 47: P0U5F1 expression is high in all cell types. The lowest expression is in pllO* + FTO cells, with a count of 70,696. Purple dots are actual data (biological duplicates, except for pllO* and WT + (3-catenin + pllO*). Gray bars are average expression between duplicate
samples.
70


CHAPTER 3
DISCUSSION
Our data begins to uncover the underlying mechanisms tying together Gsk-3, Wnt and insulin signaling, FTO, and RNA methylation. Due to the similar phenotypes of Gsk-3 DKO mESCs and cells with reduced m6A tags, we hypothesized that signaling pathways interacting with Gsk-3 are contributing to a reduction in m6A methylations.
We chose to focus on Wnt and insulin signaling because they affect both ESC pluripotency and Gsk-3. We wanted to see if either or both pathways also altered m6A levels overall or in a subset of genes.
When initially studying activation of these pathways, we found that culturing and transfection conditions needed to be optimized to produce reliable, reproducible results. Several approaches were used, both genetic and pharmacological. Small molecule modulators and Wnt3a conditioned media were an insufficient means for modifying mouse ESCs. We found that stable cell lines were the most reliable method and so stable cells lines were used whenever possible and transient transfections were only used as an addition to a stable mutant cell line. This means that some of the Nanostring results are based on a transient transfection, even though this is not ideal. However, to overexpress two or three of the modifiers, this was necessary. There is some evidence that this was in insufficient means to modify some transcripts, given that CCND3, MYC, and VEGFB all had highest expression in the stable cell lines without any transfection.
71


We were unable to construct a novel and simple method for directly examining
the effects and patterns of m6A. Therefore, we used the best of the culturing conditions, stable cell lines, and actinomycin-D treatment to examine the effects on mRNA stability, which is an indirect readout of m6A function since these tags decrease the half-life of mRNA.
We were interested in whether insulin signaling could play a role in this network because activated insulin signaling decreases cytoplasmic Gsk-3 through phosphorylation. We found that the activation of insulin signaling coupled with FTO overexpression indeed increased expression of differentiation-involved genes. Further research is needed to elucidate this precise pathway as well as determine if the half-lives of these or other transcripts are altered in this cell type. Since insulin signaling phosphorylates Gsk-3, which then cannot phosphorylate FTO, it seems that insulin signaling and FTO overexpression are working in parallel rather than in the same pathway. In every case of overexpression in pllO* + FTO (Figure 42), we found that pllO* + FTO had increased expression over the pllO* cell on its own.
Figures 27 and 29 show an increased in differentiation transcripts and decrease in half-life of pluripotency transcripts in DKO mESCs. This was unexpected. It is also apparent, though, that LIF is confounding some or all of our data, especially with respect to pluripotency and differentiation expression levels. Minus LIF experiments for all cell types should be performed.
MYC expression was found to be similar between WT and DKO mESCs in the time course data. This was surprising, given that it is a pluripotency factor and we expected
72


DKO cells to have a higher expression of it because they remain pluripotent indefinitely.
In fact, though, the expression of MYC is downregulated considerably in DKO -LIF cells, suggesting there is another piece to the puzzle that has yet to be uncovered. Further research is needed to uncover this, keeping in mind that DKO cells do have overarching off-target effects that cannot be taken into consideration fully.
POU5F1 had high expression in all cell types surveyed; it was higher by an average of 4.7 times more than the next two highest-expressed genes (MDM2 and CBX1). This has been previously shown to have no m6A tags. That is supported by this data. P110* + FTO cells had the lowest count of this transcript, with 70,696 counts, still a very high amount of expression. Again, though, the addition of LIF is likely affecting these numbers and should be reassessed with -LIF experiments.
Taken together, these results support our notion that Gsk-3, FTO, Wnt signaling, insulin signaling, and m6A RNA methylation all work together in some way to regulate gene expression and timing. The missing link could be rn6Am methylations. These modifications might be working in concert with m6A to control this precise process. In-depth understanding of these processes will contribute significantly to our understanding of epigenetic regulation in healthy and disease states.
73


CHAPTER 4
FUTURE DIRECTIONS
Further characterization is undoubtedly needed to elucidate the link between Gsk-3 and m6A. The inhibition of Gsk-3 causes an increase in FTO, which removes m6A and m6Am. The first focus moving forward is to determine a method to differentiate m6A from rn6Am; current antibodies do not discriminate and thin layer chromatography (TLC) is time-consuming and radioactive work is prohibitive in many labs, including ours.
Because of the interesting findings on pllO* cells with overexpressed FTO, actinomycin-D time course experiments on pllO* cells and pllO* + FTO cells will be of great use. Since insulin signaling phosphorylates Gsk-3, which then cannot phosphorylate FTO, it seems that insulin signaling and FTO overexpression are working in parallel rather than in the same pathway. This could be tricky to test, but important nonetheless as these two processes are converging as we hypothesized.
Running m6A-seq on other cells types, such as pllO* and S33A, will be useful to determine differentially methylated genes with signaling activation. Gsk-3 DKO mESCs and WT mESCs were subjected to m6A-seq prior to this study and the Nanostring genes of interest were based on these differentially methylated genes. Since Gsk-3 knock-out has potentially numerous off-target effects, this cell type is less enlightening than cells with a specific signaling pathway activation. Expanding m6A-seq to more cell types and then Nanostring to cover more genes will help narrow down which groups of genes are being m6Aor rn6Am methylated. Additionally, it would be beneficial to grow each of the cell types without LIF for 14 days as previously described (Jennifer Egelston, Phiel lab) to
74


see if there is a change in pluripotency or differentiation gene expression. LIF appears to
be confounding some of the results in WT and DKO mESCs, especially in relation to differentiation and pluripotency genes which are of great interest.
Future directions will also include determining if m6A and rn6Am work in concert to control pluripotency and differentiation. It is possible that m6A marks transcripts for degradation while rn6Am marks transcripts for a longer half-life such that differentiation is carefully timed. We will also search for any other methylations that might also be acting in this way.
Because our studies are primarily carried out in mouse embryonic stem cells, it will be important moving forward to use other cell types from different species. We want to determine if the mechanism is the same in humans or other species. Human FTO is 87% conserved with mice, but that does not necessarily mean the mechanism is the same. There is overwhelming evidence that Gsk-3 inhibition or knock-down promotes pluripotency but assessing the effects in non-stem cells is important as well. Future experiments will be imperative to move from an epigenetic hypothesis to disease diagnostics and treatment.
75


REFERENCES
Aberle, Hermann, Andreas Bauer, Jorg Stappert, Andreas Kispert, and Rolf Kemler. 1997. "3-Catenin Is a Target for the Ubiquitin-Proteasome Pathway." EMBO Journal 16 (13): 3797-3804. doi:10.1093/emboj/16.13.3797.
Bartman, Colleen M., Jennifer Egelston, Sravya Kattula, Leigh C. Zeidner, Anthony D'lppolito, Bradley W. Doble, and Christopher J. Phiel. 2014. "Gene Expression Profiling in Mouse Embryonic Stem Cells Reveals Glycogen Synthase Kinase-3-Dependent Targets of Phosphatidylinositol 3-Kinase and Wnt/B-Catenin Signaling Pathways." Frontiers in Endocrinology 5 (August): 1-12. doi:10.3389/fendo. 2014.00133.
Bartman, Colleen M., Jennifer Egelston, Xiaojun Ren, Raibatak Das, and Christopher J. Phiel. 2015. "A Simple and Efficient Method for Transfecting Mouse Embryonic Stem Cells Using Polyethylenimine." Experimental Cell Research 330 (1): 178-85. doi:10.1016/j.yexcr.2014.07.020.
Batista, Pedro J., Benoit Molinie, Jinkai Wang, Kun Qu, Jiajing Zhang, Lingjie Li, Donna M. Bouley, et al. 2014. "M6A RNA Modification Controls Cell Fate Transition in Mammalian Embryonic Stem Cells." Cell Stem Cell 15 (6). Elsevier Inc.: 707-19. doi:10.1016/j.stem. 2014.09.019.
Beurel, Eleonore. 2015. "Glycogen Synthase Kinase-3 (GSK3): Regulation, Actions, and Diseases." Pharmacolo Ther, 114-31. doi:10.1016/j.pharmthera. 2014.11.016. Glycogen.
Cade, John F.J. 1949. "Lithium Salts in the Treatments of Psychotic Excitement." The Medical Journal of Australia II (10): 349-51.
Clevers, Hans, and Roel Nusse. 2012. "Wnt/B-Catenin Signaling and Disease." Cell 149 (6): 1192-1205. doi:10.1016/j.cell.2012.05.012.
Cong, Le, F Ann Ran, David Cox, Shuailiang Lin, Robert Barretto, Patrick D Hsu, Xuebing Wu, Wenyan Jiang, and Luciano A Marraffini. 2013. "Multiplex Genome Engineering Using CRISPR/VCas Systems." Science 339 (6121): 819-23. doi:10.1126/science. 1231143. Multiplex.
Cross, D A, Dario R. Alessi, Philip Cohen, Mirjana Andjelkovich, and Brian A. Hemmings. 1995. "Inhibition of Glycogen Synthase Kinase-3 by Insulin Mediated by Protein Kinase B." Nature 378 (6559): 785-89. doi:10.1038/378785a0.
Ding, V W, R H Chen, and F McCormick. 2000. "Differential Regulation of Glycogen Synthase Kinase 3beta by Insulin and Wnt SignalingJournal of Biological
76


Chemistry 275 (42): 32475-81. doi:10.1074/jbc.M005342200.
Doble, B. W., Satish Patel, Geoffrey A. Wood, Lisa K. Kockeritz, and James R. Woodgett. 2007. "Functional Redundancy of GSK-3A and GSK-3B in Wnt/B-Catenin Signaling Shown by Using an Allelic Series of Embryonic Stem Cell Lines." Developmental Cell 12 (6): 957-71. doi:10.1016/j.devcel.2007.04.001.
Doble, B. W., and James R. Woodgett. 2003. "GSK-3: Tricks of the Trade for a Multi-Tasking Kinase." Journal of Cell Science 116 (7): 1175-86. doi:10.1242/jcs.00384.
Dominissini, Dan, Sharon Moshitch-Moshkovitz, Schraga Schwartz, Mali Salmon-Divon, Lior Ungar, Sivan Osenberg, Karen Cesarkas, et al. 2012. "Topology of the Human and Mouse m6A RNA Methylomes Revealed by m6A-Seq." Nature 485 (7397). Nature Publishing Group: 201-6. doi:10.1038/naturellll2.
Dubin, Donald T., and Robert H. Taylor. 1975. "The Methylation State of Poly A-
Containing-Messenger RNA from Cultured Hamster Cells." Nucleic Acids Research 2 (10): 1653-68. doi:10.1093/nar/2.10.1653.
Fang, X., S. X. Yu, Y. Lu, R. C. Bast, J. R. Woodgett, and G. B. Mills. 2000.
"Phosphorylation and Inactivation of Glycogen Synthase Kinase 3 by Protein Kinase A." Proceedings of the National Academy of Sciences 97 (22): 11960-65. doi:10.1073/pnas. 220413597.
Faulds, Kelsie J, Egelston, Jennifer N, Sedivy, Laura J, Mitchell, Matthew K, Garimella, Sanjana, Kozlowski, Hanna, D'Alessandro, Angelo, Hansen, Kirk C, Balsbaugh, Jeremy L, Phiel, Christopher J. 2018. "Glycogen Synthase Kinse-3 (Gsk-3) Activity Regulates mRNA Methylation Via Controlling FTO Protein Stability in Mouse Embryonic Stem Cells. Submitted.
Fiol, C J, A M Mahrenholz, Y Wang, R W Roeske, and P J Roach. 1987. "Formation of Protein Kinase Recognition Sites by Covalent Modification of the Substrate. Molecular Mechanism for the Synergistic Action of Casein Kinase II and Glycogen Synthase Kinase 3." The Journal of Biological Chemistry 262 (29): 14042-48. http://www.ncbi.nlm.nih.gov/pubmed/2820993.
Force, Thomas, and James R. Woodgett. 2009. "Unique and Overlapping Functions of GSK-3 Isoforms in Cell Differentiation and Proliferation and Cardiovascular Development." J Biol Chem 284 (15): 9643-9647. doi:10.1074/jbc.R800077200.
Frame, S, and P Cohen. 2001. "GSK3 Takes Centre Stage More than 20 Years after Its Discovery." The Biochemical Journal 359 (Pt 1): 1-16. doi:10.1042/0264-6021:3590001.
77


Fu, Ye, Dan Dominissini, Gideon Rechavi, and Chuan He. 2014. "Gene Expression
Regulation Mediated through Reversible m6A RNA Methylation." Nature Reviews. Genetics 15 (5): 293-306. doi:10.1038/nrg3724.
Geula, Shay, Abed Alfatah Mansour, Nitzan Kol, Vera Hershkovitz, Eyal Peer, Nofar Mor, Yair S Manor, et al. 2015. "m6A mRNA Methylation Facilitates Resolution of Naive Pluripotency toward Differentiation." Science 347 (6225): 1002-6. doi:10.1126/science.1261417.
Grimes, Carol A., and Richard S. Jope. 2001. "The Multifaceted Roles of Glycogen Synthase Kinase 33 in Cellular Signaling." Progress in Neurobiology. doi:10.1016/S0301-0082(01)00011-9.
He, Sha, Yi Lu, Xia Liu, Xin Huang, Evan T. Keller, Chao Nan Qian, and Jian Zhang. 2015. "Wnt3a: Functions and Implications in Cancer." Chinese Journal of Cancer 34 (12): 554-62. doi:10.1186/s40880-015-0052-4.
Jia, Guifang, Ye Fu, Xu Zhao, Qing Dai, Guanqun Zheng, Ying Yang, Chengqi Yi, et al.
2011. "N6-Methyladenosine in Nuclear RNA Is a Major Substrate of the Obesity-Associated FTO." Nature Chemical Biology 7 (12): 885-87. doi:10.1038/nchembio.687.
Jo, H., S. Mondal, D. Tan, E. Nagata, S. Takizawa, A. K. Sharma, Q. Hou, et al. 2012.
"Small Molecule-Induced Cytosolic Activation of Protein Kinase Akt Rescues Ischemia-Elicited Neuronal Death." Proceedings of the National Academy of Sciences 109 (26): 10581-86. doi:10.1073/pnas,1202810109.
Ke, Shengdong, Endalkachew A. Alemu, Claudia Mertens, Emily Conn Gantman, John J. Fak, Aldo Mele, Bhagwattie Haripal, et al. 2015. "A Majority of m6A Residues Are in the Last Exons, Allowing the Potential for 3' UTR Regulation." Genes and Development 29: 2037-53. doi:10.1101/gad.269415.115.
Klein, P S, and D A Melton. 1996. "A Molecular Mechanism for the Effect of Lithium on Development." Proceedings of the National Academy of Sciences of the United States of America 93 (16): 8455-59. doi:10.1073/pnas.93.16.8455.
Klippel, A, C Reinhard, W M Kavanaugh, G Apell, M A Escobedo, and L T Williams. 1996. "Membrane Localization of Phosphatidylinositol 3-Kinase Is Sufficient to Activate Multiple Signal-Transducing Kinase Pathways." Molecular and Cellular Biology 16 (8): 4117-27.
http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=231408&tool=pmcent
rez&rendertype=abstract.
Kockeritz, Lisa, Bradley Doble, Satish Patel, and James R Woodgett. 2006. "Glycogen
78


Synthase Kinase-3--an Overview of an over-Achieving Protein Kinase." Current Drug Targets 7 (11): 1377-88. http://www.ncbi.nlm.nih.gov/pubmed/17100578.
Korinek, Vladimir, Nick Barker, Patrice J Morin, Dick van Wichen, Roel de Weger,
Kenneth W Kinzler, Bert Vogelstein, and Hans Clevers. 1997. "Constitutive Transcriptional Activation by a 3-Catenin-Tcf Complex in
APC<sup>-/-</sup> Colon Carcinoma." Science 275 (5307): 1784 LP-1787. http://science.sciencemag.org/content/275/5307/1784.abstract.
Lianguzova, Maria S., Ilia A. Chuykin, Alfred Nordheim, and Valery A. Pospelov. 2007. "Phosphoinositide 3-Kinase Inhibitor LY294002 but Not Serum Withdrawal Suppresses Proliferation of Murine Embryonic Stem Cells." Cell Biology International 31 (4 SPEC. ISS.): 330-37. doi:10.1016/j.cellbi.2007.01.019.
Liu, Jianzhao, Yanan Yue, Dali Han, Xiao Wang, Ye Fu, Liang Zhang, Guifang Jia, et al. 2014. "A METTL3-METTL14 Complex Mediates Mammalian Nuclear RNA N6-Adenosine Methylation." Nature Chemical Biology 10 (2): 93-95. doi:10.1038/nchembio.l432.
Liu, Jun, Xu Wu, Brian Mitchell, Chris Kintner, Sheng Ding, and Peter G. Schultz. 2005. "A Small-Molecule Agonist of the Wnt Signaling Pathway." Angewandte Chemie -International Edition 44 (13): 1987-90. doi:10.1002/anie.200462552.
MacDonald, Bryan T., Keiko Tamai, and Xi He. 2010. "Wnt/3-Catenin Signaling:
Components, Mechanisms, and Diseases." Developmental Biology 17 (1): 9-26. doi:10.1016/j.devcel.2009.06.016.Wnt/.
Mauer, Jan, Xiaobing Luo, Alexandre Blanjoie, Xinfu Jiao, Anya V. Grozhik, Deepak P. Patil, Bastian Linder, et al. 2017. "Reversible Methylation of m6Am in the 5' Cap Controls mRNA Stability." Nature 541 (7637). Nature Publishing Group: 371-75. doi:10.1038/nature21022.
McManus, Edward J, Kei Sakamoto, Laura J Armit, Leah Ronaldson, Natalia Shpiro, Rodolfo Marquez, and Dario R Alessi. 2005. "Role That Phosphorylation of GSK3 Plays in Insulin and Wnt Signalling Defined by Knockin Analysis." The EMBO Journal 24 (8): 1571-83. doi:10.1038/sj.emboj.7600633.
Meyer, Kate D., Yogesh Saletore, Paul Zumbo, Olivier Elemento, Christopher E. Mason, and Sarnie R. Jaffrey. 2012. "Comprehensive Analysis of mRNA Methylation Reveals Enrichment in 3' UTRs and near Stop Codons." Cell 149 (7): 1635-46. doi:10.1016/j.cell.2012.05.003.
Minami, I, K Yamada, T G Otsuji, T Yamamoto, Y Shen, S Otsuka, S Kadota, et al. 2012. "A Small Molecule That Promotes Cardiac Differentiation of Human Pluripotent Stem
79


Cells under Defined, Cytokine- and Xeno-Free Conditions." Cell Reports 2 (5): 1448-60. doi:10.1016/j.celrep.2012.09.015; 10.1016/j.celrep.2012.09.015.
Morin, Patrice J., Andrew B. Sparks, Vladimir Korinek, Nick Barker, Hans Clevers, Bert Vogelstein, and Kenneth W. Kinzler. 1997. "Activation of 3-Catenin-Tcf Signaling in Colon Cancer by Mutations in 3-Catenin or APC." Science 275 (5307): 1787-90. doi:10.1126/science. 275.5307.1787.
Nanostring Technologies. 2017. "nCounter® Analysis System Brochure."
https://www.nanostring.com/application/files/9315/0836/6543/BR_nCounterSyst
ems_USNS_PM1093_20170ctl8.pdf.
Narayan, Prema, and Fritz M Rottman. 1988. "An in Vitro System for Accurate Methylation of Internal Adenosine Residues in Messenger RNA." Science 242 (4882): 1159-62. doi:10.1126/science.3187541.
Ng, Ser Sue, Tokameh Mahmoudi, Esther Danenberg, Ines Bejaoui, Wim de Lau, Hendrik C. Korswagen, Mieke Schutte, and Hans Clevers. 2009. "Phosphatidylinositol 3-Kinase Signaling Does Not Activate the Wnt Cascade." Journal of Biological Chemistry 284 (51): 35308-13. doi:10.1074/jbc.M109.078261.
Ni, Terri T., Eric J. Rellinger, Amrita Mukherjee, Shuying Xie, Lauren Stephens, Curtis A. Thorne, Kwangho Kim, et al. 2011. "Discovering Small Molecules That Promote Cardiomyocyte Generation by Modulating Wnt Signaling." Chemistry and Biology 18 (12): 1658-68. doi:10.1016/j.chembiol.2011.09.015.
Nusse, Roel, and Hans Clevers. 2017. "Wnt/3-Catenin Signaling, Disease, and Emerging Therapeutic Modalities." Cell. doi:10.1016/j.cell.2017.05.016.
Pan, Guangjin, and James A Thomson. 2007. "Nanog and Transcriptional Networks in Embryonic Stem Cell Pluripotency." Cell Research 17 (January). Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences: 42-49. http://dx.doi.org/10.1038/sj.cr.7310125.
Phiel, Christopher J, and Peter S Klein. 2001. "Molecular Targets of Lithium Action." Annu. Rev. Pharmacol. Toxicol. 41: 789-813.
Popkie, Anthony P., Leigh C. Zeidner, Ashley M. Albrecht, Anthony D'lppolito, Sigrid Eckardt, David E. Newsom, Joanna Groden, et al. 2010. "Phosphatidylinositol 3-Kinase (PI3K) Signaling via Glycogen Synthase Kinase-3 (Gsk-3) Regulates DNA Methylation of Imprinted Loci." Journal of Biological Chemistry 285 (53): 41337-47. doi :10.1074/j be. M110.170704.
Saltiel, A R, and C R Kahn. 2001. "Insulin Signalling and the Regulation of Glucose and
80


Lipid Metabolism." Nature 414 (6865): 799-806. doi:10.1038/414799a.
Sanchez-Ripoll, Yolanda, Heather K. Bone, Tom Owen, Ana M V Guedes, Elsa Abranches, Benjamin Kumpfmueller, Ruth V. Spriggs, Domingos Henrique, and Melanie J. Welham. 2013. "Glycogen Synthase Kinase-3 Inhibition Enhances Translation of Pluripotency-Associated Transcription Factors to Contribute to Maintenance of Mouse Embryonic Stem Cell Self-Renewal." PLoS ONE 8 (4). doi:10.1371/journal. pone.0060148.
Stambolic, Vuk, Laurent Ruel, and James R. Woodgett. 1996. "Lithium Inhibits Glycogen Synthase Kinase-3 Activity and Mimics Wingless Signalling in Intact Cells." Current Biology 6 (12): 1664-69. doi:10.1016/S0960-9822(02)70790-2.
Taelman, Vincent F., Radoslaw Dobrowolski, Jean Louis Plouhinec, Luis C. Fuentealba, Peggy P. Vorwald, Iwona Gumper, David D. Sabatini, and Edward M. De Robertis. 2010. "Wnt Signaling Requires Sequestration of Glycogen Synthase Kinase 3 inside Multivesicular Endosomes." Cell 143 (7): 1136-48. doi:10.1016/j.cell.2010.11.034.
Terry, Stephane, Xuezhen Yang, Min Wei Chen, Francis Vacherot, and Ralph Buttyan. 2006. "Multifaceted Interaction between the Androgen and Wnt Signaling Pathways and the Implication for Prostate Cancer." Journal of Cellular Biochemistry. doi:10.1002/jcb. 20983.
Wang, Xiang, Jing Feng, Yuan Xue, Zeyuan Guan, Delin Zhang, Zhu Liu, Zhou Gong, et al. 2016. "Structural Basis of N6-Adenosine Methylation by the METTL3-METTL14 Complex." Nature, 1-15. doi:10.1038/naturel8298.
Wang, Xiao, Zhike Lu, Adrian Gomez, Gary C. Hon, Yanan Yue, Dali Han, Ye Fu, et al.
2013. "N6-Methyladenosine-Dependent Regulation of Messenger RNA Stability." Nature 505 (7481). doi:10.1038/naturel2730.
Wang, Xiao, Boxuan Simen Zhao, Ian A. Roundtree, Zhike Lu, Dali Han, Honghui Ma,
Xiaocheng Weng, Kai Chen, Hailing Shi, and Chuan He. 2015a. "N6-Methyladenosine Modulates Messenger RNA Translation Efficiency." Cell. doi:10.1016/j.cell.2015.05.014.
------. 2015b. "N6-Methyladenosine Modulates Messenger RNA Translation
Efficiency." Cell 33 (4): 1388-99. doi:10.1038/nbt.3121.ChlP-nexus.
Wang, Yang, Yue Li, Julia I Toth, Matthew D Petroski, Zhaolei Zhang, and Jing Crystal Zhao. 2014. "N6-Methyladenosine Modification Destabilizes Developmental Regulators in Embryonic Stem Cells." Nature Cell Biology 16 (2). Nature Publishing Group: 191-98. doi:10.1038/ncb2902.
81


Wei, Cha Mer, Alan Gershowitz, and Bernard Moss. 1975. "Methylated Nucleotides Block 5' Terminus of HeLa Cell Messenger RNA." Cell 4 (4): 379-86. doi:10.1016/0092-8674(75)90158-0.
------. 1976. "5'-Terminal and Internal Methylated Nucleotide Sequences in Hela Cell
mRNA." Biochemistry 15 (2): 397-401. doi:10.1021/bi00647a024.
Wei, Cha Mer, and Bernard Moss. 1977. "Nucleotide Sequences at the N6-
Methyladenosine Sites of HeLa Cell Messenger Ribonucleic Acid." Biochemistry 16 (8): 1672-76. doi:10.1021/bi00627a023.
Woodgett, J R. 1990. "Molecular Cloning and Expression of Glycogen Synthase Kinase-3/factor A." The EMBO Journal 9 (8): 2431-38. doi:10.1023/A:1006321324190.
Wu, Geng, He Huang, Jose Garcia Abreu, and Xi He. 2009. "Inhibition of GSK3 Phosphorylation of 3-Catenin via Phosphorylated PPPSPXS Motifs of Wnt Coreceptor LRP6." PLoS ONE 4 (3). doi:10.1371/journal.pone.0004926.
Zeng, Xin, Keiko Tamai, Bradley W. Doble, Shitao Li, He Huang, Raymond Habas, Heidi Okamura, James Woodgett, and Xi He. 2005. "A Dual-Kinase Mechanism for Wnt Coreceptor Phosphorylation and Activation." Nature 438 (7069): 873-77. doi:10.1038/jid.2014.371.
Zhan, T., N. Rindtorff, and M. Boutros. 2017. "Wnt Signaling in Cancer." Oncogene. doi:10.1038/onc. 2016.304.
Zheng, Guanqun, John Arne Dahl, Yamei Niu, Peter Fedorcsak, Chun Min Huang, Charles J. Li, Cathrine B. Vagbp, et al. 2013. "ALKBH5 Is a Mammalian RNA Demethylase That Impacts RNA Metabolism and Mouse Fertility." Molecular Cell 49 (1): 18-29. doi:10.1016/j.molcel. 2012.10.015.
82


APPENDIX A: SEQUENCES
IDT G-block Sequences
FLAG-FTO with homology to pCAGEN
AT C ATTTT G G C A A AG ATG G ACT AC A A AG ACG ACG ACG AT A A AG ACT AC A AAG ATG ATG ACG AC A AG A A A AG AGTG C A AACCG CCGAGGAGAGAGAGAGGGAAG C A AAG A A ACTT CG G CTG CTCG AG G A ACTG G AAG AC ACTT G G CTCCCCT AT CT C ACCCCT A A AG ATG ACG AGTTTTACC A AC AGTG G C A ACTC A AATACCCC A A ACTTGTTTTC AG G G AAG CAG G CTCTATACCTG AAG AG CTTC ATA AG GAGGTACCTGAGG CCTTT CTT AC ACTT C AC A AG C ACG GTTG CCTTTT CCGGGACGTTGTCCG AAT AC AG G G A A AG G ATGTGTTG ACCCCTGTC AGTCG CAT CCTT ATT G G AG ATCCCG G CTG C AC AT AC AAGTACCTT AACACACG ACTTTT CACTGTCCCTT G G CCTGTAAAAG GTTG CACAGTG AAGTATAC TG A AG CTG A A AT CG CTG CAG CTTGTC AG ACCTnTT G A A ACTT AAT G ATT ATTT G C AG GTAG AG ACAATTCAAGCTTTGGAAGAGCTCGCTGTGAGAGAAAAGGCAAACGAGGACGCTGTGCCACTC TGTATGGCAGAATTTCCTAGGGCAGGTGTCGGCCCATCTTGCGATGACGAAGTTGACTTGAAGA G C AG AG CTG CCTATA ACGTG ACCCT CCTG A ACTT CAT G G AT CCCC A A A A A AT G CCCT AT CT C A A A G A AG A ACC AT ATTTT G G AAT G G G G A A A AT G G CCGTGTC AT G G C ACC AT G ACG A A AACTT G GTT GACAGATCTGCTGTCGCTGTTTATTCATATAGTTGTGAGGGATCTGAGGATGAAAGTGAGGATG AG AG CAG CTTT G A AG G A AG AG ACCCCG AT AC AT G G C ATGTCG GTTTC A AG AT CT CAT G G G ATA TAG AG AC ACCT G G ATT G ACC AT CCCCCT CC ACC A AG GTG ACTGTTATTT CAT G CTG G ATG ATCTC AACG CC ACCC ACC A AC ATT G CGTCCTCGCAGG GTCACAG CCT CG GTTTTCTT CAACCCAT AGG GT CGCTGAGTGCTCTACTGGAACTTTGGATTATATCTTGGAAAGGTGCCAACTTGCTCTGCAGAAT GTCCTTAATGATAGTGACGATGGTGACGTCAGTCTGAAAAGTTTTGACCCCGCTGTACTCAAAC AGGGTGAAGAAATCCACAATGAAGTGGAATTTGAGTGGCTTAGGCAGTTTTGGTTCCAGGGGA ATCGGTATAAACTGTGTACCGATTGGTGGTGCGAACCTATGACTCACCTGGAGGGTCTGTGGAA A A A A AT G G AAT CC AT G AC A A ACG C AGTCCT CAG G G AG GTC A AG CG AG AG G G CTT G CCCGTG G A AC A ACG CTCTG AG AT ACT CT CAG CT AT ATT G GTG CCCTT G AC AGTACG G C AAA AT CTT CG G A A AGAGTGGCACGCACGCTGTCAGTCAAGGGTGGTTAGAACCCTGCCTGTCCAACAAAAGCCTGA CTGTCG CCCTT ATT G G G A A A AG G ATG ACCCAT CT ATG CCTCTG CCCTT CG ACCTG ACT G ATGTTG TTTCTGAGCTGCGGGGGCAACTGCTGGAAGCACGGAGTTAGAATTCCTCGAGGATA
CRISPR crRNA Sequences, from Dharmacon
FTO, Position 40(+): CAUGAAGCGCGUCCAGACCGGUUUAGAGCUAUGCUGUUUUG FTO, Position 43(+): GAAGCGCGUCCACCGCGGGUUUUAGAGCUAUGCUGUUUUG FTO, Position 52(-): GCUCUCGUUCCUCCGCGGUCGUUUUAGAGCUAUGCUGUUUUG
83


Appendix Table 1: Nanostring mRNA targets, accession numbers, and sequence
mRNA target Access -ion Sequence
ALKBH5 NM_1 72943. 4 ACC A AT CCTG G AT G GTC AAG G A ACT AG CAC A AT G GTTCTG ACCT CTTTT G CT AAG AG CATG CCTGTTTG CTGGGTTG CTCCTGTTAG GCATATGTGTGTG
APC NM_0 07462. 3 CC AT G G G GTC ATT CCC A AG AAG A AC ATTTGTA A AT G G A AG C AG AG AG AGT ACTG G GTATCTAG AAG AG CTT G A A A A AG AA AG AT CATT ACT CCTT G CTG A
BCL9L NM_0 30256. 2 CCCGTTTCCCAGGCAACCAGATGCAAAGGGTGCCCGGATTTGGAGGTATG C AG AGTATG CCC AT G G A AGTACCC AT G AAT G CC AT G C AG AG ACCTGTA AG
BMP4 NM_0 07554. 2 AGACCCTAGTCAACTCTGTTAATTCTAGTATCCCTAAGGCCTGTTGTGTCCC CACTGAACTGAGTGCCATTTCCATGTTGTACCTGGATGAGTATGACAA
CBX1 NM_0 07622. 3 ATATGTGGTGGAAAAAGTTCTTGATCGGCGAGTTGTCAAGGGCAAGGTGG AAT AT CTT CT A A AGTG G A AG G GTTTCT C AG ATG AG G AC A AC ACTT G G G AG
CBX4 NM_0 07625. 2 CAAGGGGACAAGGGCTTGTCATTTACTGTGTTCCTTTGATGTCCCATGAGC ATTGTG G CTT ATTT AGTCCCCAAGTAGG CCAG CTCTCTGTG ACACAG GT
CBX7 NM_1 44811. 3 CTG G AC ACCCACG CT CCCCT C A AGTG AAGTTACCGTGACTG AC AT CACCG C C A ACTCCGTC ACCGTC ACCTTCCG CG AG G CTC A AG CCG CCG AG G G CTTC
CCND3 NM_0 07632. 2 G CC AT GATGGTCAGAG A A AT AC A AAC AG GTA A A AT CC AC AC ACC AG C ATTT CTTTT G AGTCCCT CTT CTGTCCGGGGCT CC A ACCTT CTC AGTTG CC A AA
CD44 NM_0 09851. 2 TCG CTTTG GGTGTGTCCTTCG CG CG CTCCCTCCCT CTT AG GTC ACTC ACT CTT T C A A AG CCTG G AAT A A A A ACC AC AG CC AACTT CCGAAGCGGTCT CAT
CDX2 NM_0 07673. 3 CTGTGTTGTAAATG CCAG AG CCAACCT G G ACTT CCTGTCCCTT CCCT CGTCT TTGGCTGAAGAAGACCGGAATTGTTTGCTGCTGTTCGAGTCACTGATC
DND1 NM_1 73383. 2 TG CT AT CCTT AGTCAATT CCCAG CTTG G C ACC AG AG CTTACTATG AATCTTT GTmTATTT G G AG A ACTG G CTG A ACCA A AG AG CCCTT CCTCCC ACC A
EOMES NM_0 10136. 2 ACTGAAAAGGTCGTTCAAGGTGCTGGATTGATTCATTTATGGGAAACGAGA A ATGTTC AG A A A A AG C AG G CTATG A AG A ACG AGTGCCCGGTGCT ATT A A
ESRRB NM_0 11934. 3 GGGTTTGGGTTGACAGGATGTCCTAAAGATGAAGCGGTTCATTCTGGAAA ATG G AC ACG CC ACTTTC ATG AC A AGTCCTCCG G CTTTACCTG CTCTG ATC
84


FTO NM_0 11936. 2 CCT AC A ACGTG ACTTT G CT A A ACTT CAT G G AT CCT C AG A AG ATG CCCT ACTT GAAAGAGGAGCCCTATTTCGGCATGGGGAAGATGGCGGTGAGCTGGCA
GAPDH NM_0 01001 303.1 AG GTTGTCTCCTG CG ACTTCAACAG C AACTCCC ACTCTTCC ACCTTCG ATG C CG G G G CTG G CATTG CTCTC A ATG AC A ACTTTGTC A AG CTC ATTTCCTG
GATA6 NM_0 10258. 3 G G G CTCTG A AG G CCT CAT ACC ACTTGTGTCT G AT ATTGTCC AG C AGTCC AG ATG G C AG C A A A A AT G C AG AC AT A AC ATT CCTT CGATGCGTG ATTT CTGT
GUI NM_0 10296. 2 GAG CC AG AG GTTG G AACTT CTGTG ATG G G C A AT G GTCTG A ACCC AT AC AT GGATTTTTCCTCCACTGATACTCTGGGATATGGGGGACCCGAGGGGACGG
GU3 NM_0 08130. 2 ACTG GTCTG AGTTC AG G AG AGTA A AT A A AG C A AG G CTT CTTTTT G CCT C A A AC AG GTC AC AGTGTCAT C AC A A A AT GGGTGATGG A AT CCCTG A ATTT C A
ID2 NM_0 10496. 3 A AG A A AG CG G A AG G A A A ACT A AG G ATG AT CGTCTT GCCCAGGTGTCGTTC TCCGGCCTGGACTGTGATACCGTTATTTATGAGAGACTTTCAGTGCCCTT
IMPDH2 NM_0 11830. 3 CGGGGACGGCCT C ACCT AC A AT G ATTTT CT C ATT CTT CCTGGGTATATCGAC TTC ACTG C AG AT C AG GTG G ACTT G ACGTCTG CTCT A ACT A AG A AG ATT
IRS1 NM_0 10570. 4 CCACTTCAGACTGTCTCTTCCCGAGGCGCTCTAGTGCTTCCGTGTCCGGTTC GCCTAGCGATGGCGGTTTCATCTCTTCTGATGAGTATGGTTCTAGTCC
IRS2 NM_0 01081 212.1 G G C ACTG G AG CTTTG CCCTCTG CC AG C ACCTATG CAAG CATCG ACTTCCTGT CCC AT C ACTT G A AG G A AG CC AC AGTCGTG A A AG AGTG A AG CG CT ACC A
JAG2 NM_0 10588. 2 ACGTGCGCGTGTGCCTTAAGGAGTACCAGGCCAAGGTGACGCCCACGGGG CCCTG CAG CTACG G CTACG G CG CC ACG CCCGTG CTG G GTG G C A ACT CCTT
JUN NM_0 10591. 2 CG CG ACC AG A ACG AT G G ACTTTT CGTTA AC ATT G ACC A AG A ACT G CAT G G A CCTAACATTCGATCTCATTCAGTATTAAAGGGGGGTGGGAGGGGTTACA
KIT NM_0 01122 733.1 CAGTTTCCCTG CATGTCG CT C ACTGTCT AG A ATTT ACT C A A AG CCG CCACAG AGGCTTAGCGGAGTGAAGTGCCGAAGGACCTCTTTATTTGGAGTCCTC
MLL2 NM_0 01033 276.1 G G A AG ACG ATG AC ACC AT G C AAA AT ACCGTGGTTCT CTT CT CT A AC AC AG A CAAGTTTGTTCTAATGCAGGACATGTGTGTGGTGTGCGGCAGCTTTGGC
LEFTY2 NM_1 77099. 3 AAG GGTGTACCTG AGTCTTTCTG G CCATTG CCTGGCAG CTTTG CCCATGTCA TTT ATTGTC AG AG CTT C ACG G G A A A AT G C A AGTAG CCG ACTT CG G AG C
85


LIF NM_0 08501. 2 AC AT CTTT C ACCTG G A AG CATTG ACTTCCACCG AG CATAGTAG GTAGTGTG TCTG G ACC AG AG AAA A AG G G ATG G G G C ATTTT G C AGTTTAT CC AG AG AG
UFR NM_0 01113 386.1 TCAGTTTCAG CC AG G AGTA AG AT AC A ACTTTT ACCTCTATG GGTG CACTAAC C AG G G AT ACC A ACTGTTACGTTCC AT A ATT G G ATACGTAG A AG A ACT G
MDM2 NM_0 10786. 4 GTCATGTTTCACGTGTG CAAAG AAG CT AAAAAAAAG AAACAAGCCCTGCCC AGTGTG CAG ACAG CCAAT CCAAATG ATTGTG CT AACTT ACTT CAACT AG
MSL1 NM_0 28722. 2 T CCTT CTT G G AG G G ACC ACT C AGTAG AG CCT CTA AG G G ACCC A A AT CCTT C AG AC ATTTT G G AG A ACCT G G ATG AC AGTGTATTTT CAAAG AG G CAT G C A
MTOR NM_0 20009. 2 CAT G G AG CCTATCCTG AAG G CTTT A ATTTT G A A ACTG A A AG AT CC AG ACCC T G ACCC A A ACCCG G G CGTG AT C A AT A ACGTGTTG G CC ACT ATAG G AG A A
MYC NM_0 10849. 4 CCCT C A ACGTG AACTT C ACC A ACAG G A ACT ATG ACCTCG ACTACG ACTCCGT ACAG CCCT ATTT CAT CTG CG ACG AG G A AG AG A ATTT CT AT C ACC AG C A
MYCN NM_0 08709. 3 A A AT ACC ATT G ATAC ACCCG CCTTTTGTAT ACGTCCTG G GTA AT G AG AG GT G G CTCTTG CG G CC AGTATT AG ACTG G A AGTTC AC ACCT A AGTACTGTA A
NODAL NM_0 13611. 4 ACCAGAGAGGTGGGCACTTGTCCAAGAGGGGACTGGCCATGGTGGACTTT AG A AG CC AG AGTCCTG AG ATGTATG CTT G G C AG AC AC A ACCC A AGTCT AT
NOG NM_0 08711. 2 G AT CAAAG G G CTG G AGTTCTCCG AG G G CTT G G CCC AAG G C A AG A A AC AG C GCCTGAGCAAGAAGCTGAGGAGGAAGTTACAGATGTGGCTGTGGTCACAG
NOTCH1 NM_0 08714. 2 TG AG ATT G ATGTTA AT G AGTG CAT CT CC A ACCC ATGTC AG A AT G ATG CC AC TTG CCTG G ACC AG ATTG G G G AGTTCC A ATG CATATGTATG CC AG GTTAT
NOTCH2 NM_0 10928. 1 G G CTTCTCATG CCAT CCAAG GG ACCCT AT CCT ACCCT CT AGTGTCTGTTTTC AGTGAACTGGAG AGTCC A AG A A ACG CCC AG CTT CTCTATCTG CTCG CG
PITX2 NM_0 01042 502.1 AG CCTG A AT AACTT G A AC A ACCT GAGCAGCCCGTCGCTG A ATT CCG CG GTG CCC ACG CCCG CCTGTCCTT ACG CG CCG CCG ACT CCT CCGTACGTTTAT A
POU5F1 NM_0 13633. 2 AAAGCGAACTAGCATTGAGAACCGTGTGAGGTGGAGTCTGGAGACCATGT TTCTG A AGTG CCCG AAG CCCT CCCT ACAG CAG AT C ACT C AC AT CG CCAAT
PPARD NM_0 11145. 3 CACTTGTACCAGTAG CTCTGTGG CCTTCTCTTCTTTTG CCTG GCTG GTCACCT G CTCCCATCTG CTG CTTC A AGTG G CTTG AAACTTG CTG GGTG CTCCC
86


RPL4 NM_0 24212. 4 ATT CC AG AG AG C A AGTAG AG ACCG CAT ATTT C A AT A A AT C A A AC ATGTG GT G AC A A ACCCTTGTGTG ACT CTT A A ATTGTG G ATGTTTCC A AG CCCCTT G
S0RT1 NM_0 19972. 2 CCTAG CCTTTTCTCTTG G G CAGTGTAGTAGTATG G G CG AG CCACCCTCAG C TCTTTTATTGGCCGGGGCTATAAACCATGGCTGGGCATAACTATTCCGA
SOX17 NM_0 11441. 4 ACTG AG CT CCT AGGGGAGGTGGACCG C ACG G A ATT CG A AC AGTAT CTG CC CTTTGTGTAT A AG CCCG AG ATG G GTCTT CCCT ACC AG G G AC ACG ACT G CG
T NM_0 09309. 2 TCCTCGTCTTCTGGTTCTCCGATGTATGAAGGGGCTGCTACAGTCACAGAC ATTTCTG AC AG CC AGTATG AC ACG G CCC A A AG CCTCCTC ATAG CCTCGT
TWIST1 NM_0 11658. 2 A AT G G AC AGTCT AG AG ACT CTG G AG CTG G AT A ACT AAA A AT A A AT CT AT AT G AC A A AG ATTTT CAT G G A A ATT AG A AG AG C AG AG ACC A A ATT C AC A AG A
VEGFB NM_0 11697. 2 G G CTG G CTGTCTCCCCT C ACT AT G A A A ACCCC A A ACTT CT ACC A AT A ACG G G ATTT G G GTTCTGTTATG AT AACTGTG ACACACACACACACT CACACT C
WNT6 NM_0 09526. 3 CTAGAGGGCCAGGATATGGAAGAAAGTTGGTCCTGGTAGAGTTAGCATTT CAGTCTGAGTCTATCATTCCACCTGTTACCAAGGCATGACGGAGTGAGGG
87


APPENDIX B: MATERIALS AND METHODS
Cellular Mediums
HEK293Tmedia consists of DMEM, 10% BGS, 1% Penicillin Streptomycin, and 1% L-Glutamine.
Complete ESC Media consists of DMEM, 15% FBS, 1% Pen-Strep, 1% L-Glutamine, 1% Sodium Pyruvate, 1% Non-essential Amino Acids. 2-mercaptoethanol ((3-me) and LIF were added fresh each time (luL of 55mM 3-me per lmL of media and luL ESGRO LIF per lmL media).
Equations Equation 1:
pmoles=_______(mass of DNA in ng) x (1000 pg/ng)______
(# of sense strand bp) x (650 Daltons)
Equation 2:
ACT MCr
= C -C
^T,goi ^T,ref
= AC - AC
^T,test '"'T, control
RQ=2_mo
RQ = relative quantification (i.e. fold change)
goi = gene of interest (c-myc) test = test sample (MUT cells)
ref = reference gene (gapdh) control= control sample (WT cells)
Gibson Assembly Cloning of FLAG-FTO into pCAGEN
1. Mammalian expression vector of interest, pCAGEN, was linearized using 2 pL of EcoRl restriction enzyme (ThermoFisher Fast Digest), 2uL EcoRl Buffer, 2 pg of circular pCAGEN, and 14 pL dH20, to make the final reaction volume 20 pL. The digest reaction was incubated at 37°C for 15 minutes.
88


2. 5' phosphate groups on pCAGEN were removed to prevent plasmid recircularization.
1 pL of antarctic phosphatase (NEB) was added to the digest reaction. Samples were incubated at 37°C for 15 minutes.
3. The effectiveness of the digest reaction was confirmed by running the digested product on a 1% agarose 1% ethidium bromide gel. The circular plasmid was added as a control.
4. After validation of successful digestion, the remaining linear plasmid was purified using the QIAquick Gel Extraction Kit from QIAGEN.
5. The synthesized gBIock gene fragments (IDT, sequences contained in Appendix A) were resuspended according to IDT protocol.
a. The tube was centrifuged for 5 seconds at 3000 g.
b. Sterile TE buffer (pH 7.5) was added to a concentration of lOng/pL.
c. Solution was homogenized by vortexing and incubated at 50°C for 20 minutes.
d. Sample was placed on ice for immediate use. (Eventually stored at -20°C).
6. 50 ng of linear plasmid and a 3-fold molar increase of DNA fragments containing 15 bp overlaps were combined for the assembly along with 10 pL Gibson Assembly Master Mix and Milli-Q H2O to a total volume of 20 pL. DNA fragments were converted into pmoles using Equation 1.
7. Samples were incubated at 50°C for 15 minutes. After incubation, samples were immediately placed on ice or stored at -20°C.
8. OneShot chemically competent E. coli cells (included in Gibson Assembly Kit) were transformed with 2 pL of assembly reaction (transformation protocol below).
89


Overnight cultures were made from colonies on LB + 1% ampicillin plates. Plasmids
were purified via the GeneJET Plasmid Miniprep Kit (Thermo Scientific) or Zyppy Plasmid Miniprep Kit (Zymo) according to protocol.
9. To confirm that fragments were successfully cloned into pCAGEN, restriction digests (ThermoFisher Fast Digest restriction enzymes) were performed, and products were run out on a 1% agarose 1% ethidium bromide gel.
Transformation
One vial of 50 pL OneShot chemically competent cells were thawed on ice. Two microliters of DNA plasmid was added and mixed by gently pipetting up and down. Cells were incubated on ice for 30 minutes. Cells were heat shocked in a water bath at 42°C for exactly 45 seconds. Cells were returned to ice for two minutes to recover. Room temperature SOC media was added (450 pL) and the tube was incubated shaking for an hour at 37°C. Up to 200 pL of the transformation was plated on an LB-antibiotic agar plate, spread with glass beads, and incubated overnight at 37°C. Overnight LB cultures were made from colonies the following day.
HEK293T Mammalian Cell Transfection Using PEI
1. Day 1: Cells were plated at 1.0x10s cells per well in 6-well plates in media that is 50% HEK293T media: 50% OptiMEM reduced serum media (Appendix B).
2. Day 2: Media was not changed in 6-well plates. 2.0 pg of total DNA (1800 ng plasmid of interest + 200 ng pMax-GFP for visualization) was added to 100 pL Opti-MEM per transfection. No DNA was added to untransfected control well. In a separate tube, 5 pL of PEI was added to 95 pL Opti-MEM per transfection. Tubes were tapped to mix
90


and incubated at room temperature for 5 minutes. 100 pL PEI:Opti-MEM was transferred to DNA:Opti-MEM tubes. Tubes were tapped to mix, centrifuged at lowest speed for collection, and incubated at room temperature for 20 minutes. Mixture was added to cells drop-wise. Cells were incubated at 37°C with 5% CO2 overnight.
3. Day 3: To determine if transfection was successful, presence of green fluorescence from pMax-GFP was observed using fluorescence microscopy.
mESC Transfection Using PEI
1. Mouse ESCs were washed, trypsinized, and resuspended in Opti-MEM. 10 pL of resuspension was added to 10 pL trypan blue dye. The total number of ESCs was counted using the Cell Countess (Invitrogen).
2. lx 106 cells were aliquoted into 2 mL microcentrifuge tubes, one per well for a six-well plate. Tubes were centrifuged for 2 minutes at 1500rpm. Supernatant was aspirated.
3. Cell pellets were resuspended in 300 pL Opti-MEM.
4. 2 pg of total DNA was added to the resuspended cells (200 ng pMax-GFP and 1800 ng plasmid(s) of interest). No DNA was added to untransfected control cells. Cells were mixed by careful pipetting.
5. 100 pL of PEI was added to the resuspended cells. Cells were mixed by pipetting.
6. Cells were incubated for 30-60 minutes at room temperature. Mixture was mixed by pipetting every 10 minutes.
91


Full Text

PAGE 1

!"#$%&!'(&!"')&*$)$++$,&%)-+)'%. / 0 / 1$2(&$3)%!'"(2!"')4(&*5(6%)-")71"() 7$&*62(&!-")!")7-8%$)$7916-"!,)%&$7),$22% ) :;) ) .(&*16")2$!'*).!24(&1!,. ) 9<(<=)*>?@ABC),DEE>F>=),D?GH;=)(1)IJK0 ) ) ) ) ) ) ) ) ) ) ) ()LM>NBN)NO:PBLL>@)LD)LM>) ) +HQOEL;)DR)LM>)'AH@OHL>)%QMDDE)DR)LM>) ) 8?BS>ANBL;)DR),DEDAH@D)B?)THALBHE)ROERBEEP>?L) ) DR)LM>)A>UOBA>P>?LN)RDA)LM>)@>FA>>)DR) ) 7HNL>A)DR)%QB>?Q>) ) !?L>FAHLBS>)9BDEDF;)4ADFAHP ) IJKV )

PAGE 2

ii ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) !" IJKV ) .(&*16")2$!'*) .!24(&1!,. ) (22)1!'*&%)1$%$1#$3 )

PAGE 3

iii ) ) &MBN)LM>NBN)RDA)LM>)7HNL>A)DR)%QB>?Q>)@>FA>>):; ) .HLMA;?)2>BFM).BETHLABQW ) MHN):>>?)HTTADS>@)RDA)LM>) ) !?L>FAHLBS>)9BDEDF;)4ADFAHP ) :; ) ) ) ) ) ) ) ) ) ) ) ,MABNLDTM>A)X<)4MB>E=),MHBA) ) (PH?@H),MHAE>NGDALM ) YBHDZO?)1>? ) ) ) 3HL>[)7H;)KI=)IJKV )

PAGE 4

iv .BETHLABQW=).HLMA;?)2>BFM)\7<%<=)9BDEDF;]) ) !?S>NLBFHLB?F)LM>)$RR>QLN)DR)'NW / 0 / 1>EHL>@)%BF?HEB?F)4HLMGH;N)D?)P1"()7>LM;EHLBD?)B?) 7DON>)$P:A;D?BQ)%L>P),>EEN ) &M>NBN)@BA>QL>@):;)(NNBNLH?L)4ADR>NNDA),MABNLDTM>A)X<)4MB>E<) ) #$%&'#(& " $TBF>?>LBQ)A>FOEHLBD?)BN)@BRRB QOEL)LD)O?AHS>E):>QHON>)POELBTE>)TADQ>NN>N)H?@) THALBQBTH?LN)QD?S>AF>)LD)QA>HL>)H)O?BUO>)F>?>)>CTA>NNBD?)LMHL)BN)DRL>?)@>T>?@>?L)OTD?) >CL>A?HE)NLBPOEB<)(N)NOQM=)LM>N>)DOLQDP>N)QH?):>)HEL>A>@):;)NPHEE)QMH?F>N)B?)H?;)DR) PH?;)@BRR>A>?L)HQLBSBLB>N=)NOQM)HN) WB?H N>)HQLBSBL;) B?)NBF?HEB?F)QHNQH@>N)DA)1"() P>LM;EHLBD?)E>S>EN<),MH?F>N)B?)LM>N>)THLMGH;N)E>H@)LD)HEL>A>@)TM>?DL;T>N<) 5M>?)'NW / 0) RO?QLBD?)BN)EDNL=)HQLBSHLBD?)DR)5?L)NBF?HEB?F)H?@)B?@>RB?BL>)NL>P)Q>EE)TEOABTDL>?Q;)DQQOA=) LMDOFM)H)TA>QBN>)P>QMH?BNP)RDA)LM>)EHLL >A)MHN)?DL):>>?)O?QDS>A>@<)'NW / 0)BN)W?DG?)LD) :>)H)Q>?LAHE)A>FOEHLDA)DR):DLM)5?L)H?@)B?NOEB?)NBF?HEB?F) THLMGH;N)H?@)BN)NONT>QL>@)LD) PHAW)LM>) P ^ () @>P>LM;EHN>)+&-)RDA)@>FAH@HLBD?< ) %B?Q>)5?L)NBF?HEB?F)BN)BPTEBQHL>@)B?) NL>P)Q>EE)TEOABTDL>?Q;=)H?@)@>QA>HN>@)P ^ () >?MH?Q>N)TEOABTDL>?Q;=)G>)B?S>NLBFHL>@)BR) LMBN)BN)@O>)LD)H)QMH?F>)B?)P ^ () E>S>EN) DA)LM>)THLMGH;)BLN>ER<) (EE)DR)LM>N>)TADQ>NN>N)PBFML) QD?S>AF>)B?)H)QDPTEBQHL>@)>TBF>?>LBQ)?>LGDAW<)!?)LMBN)NLO@;=)G>)H?HE;_>@)F>?>) >CTA>NNBD?)TADRBE>N)DR)Q>EEN)GBLM)HQLBSHLBD?)D R)LGD)'NW / 0)A>EHL>@)NBF?HEB?F)THLMGH;N=)5?L) H?@)B?NOEB?)NBF?HEB?F<)5>)HEND)DS>A>CTA>NN>@)LM>)@>P>LM;EHN>)+&-=)BPTEBQHL>@)B?)P ^ ( / LHF)A>PDSHE)H?@)NO:N>UO>?L)A>?>GHE)DR)TEOABTDL>?Q;<) 5>)TADTDN>)LMHL)1"():BDEDF;)H?@) NBF?HE)LAH?N@OQLBD?)QD?S>AF>)D?)A>FOEHLB?F)F >?>)>CTA>NNBD?)B?)H)TA>QBN>)H?@)LBP>E;) PH??>A<) )

PAGE 5

v &M>)RDAP)H?@)QD?L>?L)DR)LMBN)H:NLAHQL)HA>)HTTADS>@<)!)A>QDPP>?@)BLN)TO:EBQHLBD?< ) (TTADS>@[),MABNLDTM>A)X<)4MB>E )

PAGE 6

vi #()*+,-./0.1.*&% " +DA)MBN)FOB@H?Q>)B?) E>HA?B?F ) LM>):HNBQN)DR):>?QM)A>N>HAQM) LD ) MBN)H:BEBL;)LD)RDNL>A) LAO>)NQB>?LBRBQ) B?UOBA; =)H)FA>HL)LMH?WN)LD)3A<) ,MABN)4MB>E =)P;)H@SBNDA<)+DA)LM>BA)B?NBFMLROE) UO>NLBD?N)B?)LM>)TEH??B?F)H?@)BPTE>P>?LHLBD?)TMHN>)HN)THAL)DR)P;)LM>NBN)QDPPBLL>>=) LMH?W);DO) LD) 3A<) (PH?@H),MHAE>NGDALM ) H?@)3A<) YBHDZO?)1>? < " ( ? ) >?DAPDON ) LMH?WN)LD) 2HOAH)%>@BS; ) RDA)M>A)HNNBNLH?Q>)L>QM?BQHEE;)H?@) >PDLBD?HEE; <)+DA)LM>BA)HNNBNLH?Q>)B?)H?@) DOL)DR)LM>)EH:=)LMH?WN)LD) *HAPD?;)7HLNMBW)3HWHRH; =) .>ENB>)+HOE@N =) %H?ZO)'HABP>EEH =) 7HLL) 7BLQM>EE =) -EBSBH)1D:HA@ = " &BRRH?;)#O =)H?@ " $EEB> ) ,MHH:B <) ) 'AHLBLO@> ) LD) (?@A>G)7Q3> SBLL ) RDA) MBN) HB@ ) B?) SBNOHEB_B?F)LM>)"H?DNLAB?F)@HLH<) 2HNL):OL):;)?D)P>H?N)E>HNL =)LMH?WN)LD)P;) RHPBE;)H?@)RAB>?@N)RDA)LM>BA)NOTTDAL)B?)LMBN)>?@>HSDA =) >NT>QBHEE; ) P;)THA>?LN=)%H?@AH)H?@) %L>S>).BETHLABQW=)H?@)P;)THAL?>A)XD>)7Q4>HW <) " " " "

PAGE 7

vii &#$-."+2"(+*&.*&% ) ,*(4&$1 ) !< ! !"&1-38,&!-"<````` ```````````````````````` <<<`<`<
PAGE 8

viii -3%&"+2"#$$'.43#&3+*% ) 0e)8&1 ) ) 0e) 8?LAH?NEHL>@)1>FBD? ) (2.9*a ) (EW9)*DPDEDF)a ) 974c) ) ) 9D?>)7DATMDF>?>LBQ)4ADL>B?)c ) ,.! ) ) ,HN>B?).B?HN>)!) ) QA1"( ) ) ,1!%41)1"( ) 3.) ) 3DO:E>).?DQWDOL ) 37$7 ) ) 3OE:>QQDeN)7D@BRB>@)$HFE>)7>@BOP ) 3NM ) ) 3BNM>S>EE>@ ) $%,) ) ) $P:A;D?BQ)%L>P),>EEN ) $%119 ) ) $NLADF>? / 1>EHL>@)1>Q>TLDA)9 >LH ) +&) ) +HL)7HNN)H?@)-:>NBL;)(NNDQBHL>@)4ADL>B?) ) +_ ) ) +AB__E>@ ) '+4 ) ) 'A>>?)+EODA>NQ>?Q>)4ADL>B?) ) 'NW / 0) ) ) 'E;QDF>?)%;?LMHN>).B?HN> ) *$.If0& ) *OPH?)$P:A;D?BQ).B@?>;),>EEN ) B4%, ) ) !?@OQ>@)4EOABTDL>?L)%L>P),>EEN ) 2B,E ) ) 2BLMBOP) ) 2!+ ) ) 2>OW>PBH)!?MB:BLDA;)+HQLDA ) .-) ) ) . ?DQWDOL ) P ^ ( ) ) " ^ / P>LM;EH@>?NB?> ) P ^ ( P) ) ) " ^ =)Ig / / @BP>LM;EH@>?DNB?> ) )

PAGE 9

ix P ^ ( / N>U ) " ^ / P>LM;EH@>?NB?>)N>UO>?QB?F ) 7(4 / . ) ) 7BLDF>? / (QLBSHL>@)4ADL>B?).B?HN> ) P$%, ) ) 7DON>)$P:A;D?BQ)%L>P),>EEN ) 7>LLE0 ) ) 7>LM;E)&AH?NR>AHN> / EBW>)0 ) P1"( ) ) P>NN>?F>A)1"( ) -TLB / 7$7 ) 7B?BPOP)$NN>?LBHE ) 7>@BH ) TKKJh ) ) 7;ABNLD;EHL>@)RDAP)DR)TKKJ)NO:O?BL)NLH:E>)Q>EE)EB?> ) 49% ) ) 4MDNTMHL>)9ORR>A>@)%HEB?> ) 43.K ) ) 4MDNTMDB?DNBLB@> / @>T>?@>?L)WB?HN> / K ) ) 4$! ) ) 4DE;>LM;E>?BPB?> ) ) ) 4!0. ) ) 4MDNTMHLB@;EB?DNBLDE / 0 / .B?HN> ) 4.9 ) ) 4ADL>B?).B?HN>)9)\(.()(WL] ) U4,1 ) ) dOH?LBLHLBS>)4,1 ) % "4 ) ) %B?FE>)"OQE>DLB@>)4DE;PDATMBNP ) 5&(4 ) ) 5BEPNe)&OPDAK / (NNDQBHLB?F)4ADL>B? ) 6&*3+I) ) 6&*)3DPHB?)+HPBE;)I) ) " "

PAGE 10

1 (5#6&.'"7 " 3*&'+/8(&3+* " ) $TBF>?>LBQ)A>FOEHLBD?)BN)@BRRBQOEL)LD)O?AHS>E):>QHON>)POELBTE>)TADQ>NN>N)H?@) THALBQBTH?LN)QD?S>AF>)LD)QA>HL>)H)O?BUO>)F>?>)>CTA>NNBD?)LMHL)BN)DRL>?)@>T>?@>?L)OTD?) >CL>A?HE)NLBPOEB<)(N)NOQM=)LM>N>)DOLQDP>N)QH?):>)HEL>A>@):;)NPHEE)QMH?F>N)B?)H?;)DR) PH?;)@BRR >A>?L)HQLBSBLB>N=) NOQM)HN)B?)NBF?HEB?F)QHNQH@>N= ) WB?HN>)HQLBSBL; =)DA)1"() P>LM;EHLBD? <)$TBF>?>LBQ)H:>AAHLBD?N)HQQDO?L)RDA)NDP>)@BN>HN>)NLHL>N=)B?QEO@B?F)QH?Q>A<) 8?QM>QW>@)Q>EE)TADEBR>AHLBD?)BN)LM>)ADDL)DR)HEE)QH?Q>AN)H?@)QH?):>)QHON>@):;)O?:AB@E>@) 'NW / 0)HQL BSBL;=)GMBQM)BN)HQLBS>)B?)N>S>AHE)NBF?HEB?F)THLMGH;N)H?@)TMDNTMDA;EHL>N)DS>A)KJJ) TADL>B?N) \9>OA>E)IJKa] <)3>L>APB?B?F ) GMBQM)LHFN=)TADL>B?N=)NBF?HEB?F)QHNQH@>N=)H?@)NLBPOEB) HA>)B?L>AHQLB?F)QH?):>)@BRRBQOEL<)!?)LMBN)NLO@;=)G>)>?@>HSDA>@)LD)O?QDS>A)GM>LM>A)LGD) 'NW / 0)@>T>?@>?L)NBF?HEB?F)THLMGH;N=) 5?L ) H?@)B?NOEB?)NBF?HEB?F=)HRR>QL)1"()P>LM;EHLBD?=) QHONB?F)B?@>RB?BL>)NL>P)Q>EE ) TEOABTDL>?Q;<)) ) 09:;<=>?"%:?@ABC>")D?BC>"E" " 'E;QDF>?)N;?LMHN>)WB?HN>)0)\'NW / 0])BN)HQLBS>)B?)POELBTE>)NBF?HE)LAH?N@OQLBD?) THLMGH;N=)B?QEO@B?F) 5?L ) H?@)B?NOEB?)NBF?HEB?F) \+DAQ>)H?@)5DD@F>LL)IJJf] <)'NW / 0)HQLBSBL;) BN)LM>)NOP)DR)LGD)BNDRDAPN=)'NW / 0i)H?@)'NW / 0j=)GMBQM)HA>)>NN>?LBHEE;)A>@O?@H?L)B?) RO?QLBD?): OL)HA>)>?QD@>@):;)LGD)@BRR>A>?L)F>?>N) \5DD@F>LL)Kff Jk).DQW>ABL_)>L)HE<)IJJ^] <) 9DLM)'NW / 0i)H?@)'NW / 0j)MHS>)H)TA>R>AA>@)QD?N>?NON)N>UO>?Q>)RDA)TMDNTMDA;EHLBD?)DR) %l& / Y / Y / Y / %l&)H?@)TA>R>A)LD)TMDNTMDA;EHL>)NO:NLAHL>N)LMHL)MHS>):>>?)TABP>@) \TMDNTMDA;EHL>@):;)H?DLM>A)WB?HN>)TA>SBDONE;]):OL)GBEE)HEND)TMDNTMDA;EHL>)?D? / TABP>@) NO:NLAHL>N) \+BDE)>L)HE<)KfVb] <) "

PAGE 11

2 'NW / 0)BN)B?SDES>@)B?)PH?;)NBF?HEB?F)THLMGH;N=)B?QEO@B?F)TADL>B?)WB?HN>)()\4.(]=)) LAH?NRDAPB?F)FADGLM)RHQLDA / j)\&'+ / j]=)*>@F>MDF=)5?L=)H?@)TMDNTMHLB@;EB?DNBLDE)0 / WB?HN>)\4!0.] / @>T>?@>?L)B?NOEB?)NBF?HEB?F) \'ABP>N)H?@)XDT>)IJJKk)3D:E>)H?@)5DD@F>LL) IJJ0k)+AHP>)H?@),DM>?)IJJK] <)!?) 5?L ) NBF?HEB?F=)'NW / 0)TMDNTMDA;EHL>N)j / QHL>?B?)B?)LM>) (CB?)@>NLAOQLBD?)QDPTE>C)GMBQM)>S>?LOHEE;)E>H@N)LD)LM>)@>FAH@HLBD?)DR)j / QHL>?B?) \m>?F) >L)HE<)IJJak),E>S>AN)H?@)"ONN>)IJKI] <)!?)LMBN)GH;=)'NW / 0)A>FOEHL>N)LM>)5?L)THLMGH;)B?)H) ?>FHLBS>)RHNMBD?<)n&MBN)BN)O?QD?S>?LBD?HE)RDA)WB?HN>Nk)'NW / 0)BN)QD?NLBLOLBS>E;)HQLBS>)B?)BLN) :HNHE)NLHL>)H?@)BN)B?MB :BL>@):;)TMDNTMDA;EHLBD?=)GM>A>HN)PDNL)WB?HN>N)PONL):>)HQLBSHL>@) :;)TMDNTMDA;EHLBD?) \.DQW>ABL_)>L)HE<)IJJ^] ) \4!0 / WB?HN>)DA)4!0.] ) HQLBSHL>N)(WL)\HEND)W?DG?)HN)4ADL>B?).B?HN>)9=)4.9])SBH) TMDNTMDA;EHLBD?=)A>QAOBLB?F)(WL)LD)LM>)Q;LDTEHNP<)&M>A>=)(WL)TMDNTMDA;EHL>N)RA>>) Q;LDTEHNPBQ)'NW / 0i)H?@)'NW / 0j=) D?)N>AB?>)IK)H?@)N>AB?>)f=)A>NT>QLBS>E;=) A>?@>AB?F)LM>P) B?HQLBS>) \%HELB>E)H?@).HM?)IJJKk),ADNN)>L)HE<)Kffa] <)&MDOFM)'NW / 0)BN) DT>AHLB?F) B?):DLM) THLMGH;N=)?>BLM>A)THLMGH;)RO?QLBD?N)LD)LOA?)D?)DA)DRR)LM>) DLM>A) \3B?F=),M>?=)H?@) 7Q,DAPBQW)IJJJk)"F)>L)HE<)IJJfk)7Q7H?ON)>L)HE<)IJJa] <) ) ,?@"%D=?B9D?= " 5?L)NBF?HEB?F)BN)QAOQBHE)RDA)@BA>QLB?F)Q>EE)TADEBR>AHLBD?=)Q>EE)TDEHABL;=)H?@)Q>EE)RHL>) @>L>APB?HLBD?)@OAB?F)>P:A;D?BQ)@>S>EDTP>? L<),D?NLBLOLBS>) 5?L ) NBF?HEB?F)BN)HEND)W?DG?) LD)TEH;)H)ADE>)B?)QHAQB?DF>?>NBN) \mMH?=)1B?@LDARR=)H?@)9DOLADN)IJKb] <)5?L)NBF?HEB?F) B?SDES>N)PH?;)THALBQBTH?LN=)LM>)PDNL)TADPB?>?L)DR)GMBQM)HA>)+AB__>@)\+_]=)214al^=) 3BNM>S>EE>@)\3NM]=)'NW / 0)ilj=)(CB?=)(4, =)QHN>B?)WB?HN>)K)\,.K]=)j / QHL>?B?=)H?@)2>Rl&QR ) \"ONN>)H?@),E>S>AN)IJKb] <)8?@>A):HNHE)QD?@BLBD?N=)j / QHL>?B?)E>S>EN)HA>)W>TL)EDG)SBH)LM>)

PAGE 12

3 HQLBSBL;)DR)H)QDPTE>C)DR)TADL>B?N)L>AP>@)LM>)j / QHL>?B?)@>NLAOQLBD?)QDPTE>C)\'NW / 0ilj=) (CB?=)(4,=)H?@),.K])\+BFOA>)K]<)4MDNTMDA;EHLBD?)DR)j / QHL>?B?):;),.K)H?@)'NW / 0)A>NOELN)B?) LM>)NO:N>UO>?L)O:BUOBLB?HLBD?)H?@)@>FAH@HLBD?)DR)j / QHL>?B?) \(:>AE>)>L)HE<)Kffb] <) *DG>S>A=)OTD?)5?L)EBFH?@):B?@B?F)LD)LM>)+AB__E>@)A>Q>TLDA)QDPTE>C=)3BNM>S>EE>@) A>QAOBLN)(CB?)LD)LM>)Q>EE)NOARHQ>=) B?MB:BLB?F)LM>)@>NLAOQLBD?)QDPTE>C)RADP)RDAPB?F)H?@) TA>S>?LB?F)@>FAH@HLBD?)DR)j / QHL>?B? ) \m>?F)>L)HE<) IJJak)5O)>L)HE<)IJJf] <) 5M>?)LM>) @>NLAOQLBD?)QDPTE>C)QH??DL)RDAP=) 'NW / 0)LAH?NEDQHL>N)LD)LM>)Q>EE)P>P:AH?>)H?@)BN)LM>?) >?@DQ;LDN>@)B?LD)POELBS>NBQOEHA):D@B>N=)BNDEHLB?F)BL)TM;NBQHEE;)RADP)j / QHL>?B?) \&H>EPH?) >L)HE<)IJKJ] <)j / QHL>?B?)LM>?)HQQOPOEHL>N)B?)LM>)Q;LDTEHNP):>RDA>)LAH?NEDQHLB?F)LD)LM>) ?OQE>ON)GM>A>)BL)@BA>QLE;)QDPTE>C>N)GBLM)2>Rl&QR)TADL>B?N)LD)HQLBSHL>)5?L)LHAF>L)F>?>N) \7HQ3D?HE@=)&HPHB=)H?@)*>)IJKJk)m>?F)>L)HE<)IJJa] < ) !?)H)FADGB?F)>P:A;D=) 5?L ) NBF?HEB?F)BN)HQLBS>=)QHONB?F)Q>EE)TADEBR>AHLBD?)H?@)EHL>A=) Q>EE)RHL>)@>L>APB?HLBD?<)*DG>S>A=)BR)j / QHL>?B?)BN)?DL)@>FAH@>@=)ONOHEE;):>QHON>)DR)H) POLHLBD?=)>CQ>NNB S>)NL>P)Q>EE)TADEBR>AHLBD?)DQQOAN=)E>H@B?F)LD)LOPDABF>?>NBN) \7HQ3D?HE@=)&HPHB=)H?@)*>)IJKJ] <)%O:N>UO>?L)> TBF>?>LBQ)A>FOEHLBD?)BN)O?H:E>)LD) DS>AQDP>)LMBN)>CLA>P>)TADEBR>AHLBD?<) )

PAGE 13

4 ) 3?CF9D?"%D=?B9D?=" " &M>)B?NOE B?)NBF?HEB?F)THLMGH;)BN)LABFF>A>@):;)LM>)TAD@OQLBD?)DR)B?NOEB?=)GMBQM) QHON>N)H?)B?QA>HN>)B?)LM>)OTLHW>)DR)F EOQDN>)B?)PONQE>)H?@)RHL)Q>EEN=)A>@OQB?F ) FEOQDN>) N;?LM>NBN)B?)LM>)EBS> A <)5M>?)B?NOEB?):B?@N)LD)LM>)i)NO:O?BL)DR)LM>)B?NOEB?)A>Q>TLDA=)H) QD?RDAPHLBD?HE)QMH?F>)LHW>N)TEHQ>=)HQLBSHLB?F)LM>)L;ADNB?>)WB?HN>)@DPHB?N)DR)LM>) A>Q>TLDAeN)j)NO:O?BLN<)&M>)j)NO:O?BLN)TMDNTMDA;EHL>)LGD)>?_;P>N[)7BLDF>? / HQLBSHL>@) 4ADL>B?).B?HN>)\7(4 / .])H?@) 4MDNTMHLB@;EB?DNBLDE / 0 / .B?HN>)\4!0.]<)4!0.)B?)LOA?)HQLBSHL>N) 4MDNTMDB?DNBLB@> / @>T>?@>?L)WB?HN> / K ) \43.K])GMBQM)TMDNTMDA;EHL>N) (WL)\(.()TADL>B?) WB?HN>)9)\4.9]] ) HL)LMA>D?B?>)0JV=)E>H@B?F)LD)THALBHE)HQLBSHLBD?<)5M>?)(WL):>QDP>N) TMDNTMDA;EHL>@)HL)N>AB?>)cb0=)BL ) BN)ROEE;)HQLBSHL>@<)-?Q>)HQLBSHL>@=)(WL)PDS>N)LD)LM>) Q;LDTEHNP)GM>A>)BL)QH?)TMDNTMDA;EHL>)RA>>)'NW / 0<)(WL)TMDNTMDA;EHL>N)'NW / 0i)D?)N>AB?>) IK)H?@)'NW / 0j)D?)N>AB?>)f=)A>NOELB?F)B?)LM>)B?MB:BLBD?)DR)'NW / 0)GM>?)LM>)TMDNTMDA;EHL>@) ) 2D=FG>"7 [),H?D?BQHE)5?L) NBF?HEB?F<)2>RL[)5?L)DRR=)NMDGB?F)j / QHL>?B?):>B?F)@>FAH@>@<) 1BFML[)5?L)D?=)NMDGB?F)H)@BNHNNDQBHL>@)@>NLAOQLBD?)QDPTE>C< ) !PHF>[) &>AA;)>L)HE<)IJJ^ "

PAGE 14

5 HPB?D / L>APB?B)QHON>N)H)QD?RDA PHLBD?HE)QMH?F>)\+BFOA>)I]) \+H?F)>L)HE<)IJJJk)'ABP>N)H?@) XDT>)IJJKk)3D:E>)H?@)5DD@F>LL)IJJ0k),ADNN)>L)HE<)Kffak)+AHP>)H?@),DM>?)IJJK] < ) &M>) P>LMD@)LMADOFM)GMBQM)'NW / 0)BN)B?MB:BL>@)B?)B?NOEB?)NBF?HEB?F)BN)@BNLB?QL)RADP)LMHL)DR)G?L) NBF?HEB?Fk) (WL)@BA>QLE;)TMDNTMDA;EH L>N)'N W / 0)B?)B?NOEB?)NBF?HEB?F) GMBE>)'NW / 0)BN)TM;NBQHEE;) A>PDS>@)RADP)j / QHL>?B? ) B?)5 ?L)NBF?HEB?F<) ) ) 69FGDH<@>?;: " $P:A;D?BQ ) NL>P)Q>EEN)HA>) TEOABTDL>?L=)P>H?B?F)LM>;) H:E>)LD)@BRR>A>?LBHL>)B?LD)H?;) DR)LM>)LMA>>)L;T>N)DR)F>AP)EH;>ANk)LMHL)BN=)LM>;)QH?):>QDP>)H?;)L;T>)DR)NDPHLBQ)Q>EE<) &;TBQHEE;=) $%,N ) GBEE)>S>?LOHEE;)@BRR>A>?LBHL>=)GM>LM>A)DA)?DL)LM>;)HA>)?DL)EDQHL>@)B?)H) FADGB?F)>P:A;D):>QHON>)TEOABTDL>?Q;)BN)?DL)H?)B?@>RB?BL>)NLHL><)&M>A>)HA>)N>S>AHE) L>QM?BUO>N ) LD)PHB?LHB?) $%,) TEOABTDL>?Q;)B?)H)EH:)N>LLB?F<)()TEOABTDL>?Q; / B?@OQB?F)RHQLDA=) PDNL)QDPPD? E;)E>OW>PBH)B?MB:BLDA;)RHQLDA)\2!+] ) RDA)PDON>)$%,N ) \P$%, N ] =)PONL):>)H@@>@) LD)LM>)P>@BH)DR)5&)P$%,N)LD)PHB?LHB?)TEOABTDL>?Q;) \4H?)H?@)&MDPND?)IJJb] <) " ) 2D=FG>" I [)!?NOEB?)NBF?HEB?F<)4!0.)HQLBSHL>N) (WL ) GMBQM)B?)LOA?)TMDNTMDA;EHL>N) Q;LDTEHNPBQ)'NW / 0=) B?MB:BLB?F)BL < ) !PHF>[)(:QHP< )

PAGE 15

6 7DON>)>P:A;D?BQ)NL>P)Q>EEN)\P$%,N])LMHL)MHS>)MH@):DLM)'NW / 0i)H?@)'NW / 0j) W?DQW>@)DOL)\'NW / 0i / l / k)'NW / 0j / l / =)L>AP>@)@DO:E>) W?DQW)DOL)Q>EEN=)3.-]) HA>)QOABDON) :>QHON>)LM>;) A>LHB?)LM>BA)TEOABTDL>?Q;)B?@>RB?BL>E;k)LM>;)@D)?DL)@BRR>A>?LBHL>) \9HA LPH?)>L) HE<)IJKc] ) H?@)@D)?DL)A>UOBA>)2!+)LD)PHB?LHB?)TEOABTDL>?Q; ) \3D:E>)>L)HE<)I JJb] <)3.-) $%,N ) HEND)MHS>)H)@BRR>A>?L)TM;NBQHE)TM>?DL;T>)LMH?)GBE@L;T>)\5&])P$%,N)\+BFOA>)0]<)%B?Q>) 'NW / 0)3.-) $%,N ) A>LHB?)TEOABTDL>?Q; = ) H?@)'NW / 0) HQLBSBL;)BN)A>FOEHL>@):; ) :DLM) 5?L ) H?@) B?NOEB?)NBF?HEB?F=)BL)N>>PN)EBW>E;)LMHL)D?>)DA):DLM)THLMGH;N ) QDOE@ ) TEH ;)H)ADE>)B?) TADPDLB?F)2!+ / B?@>T>?@>?L) $%,) TEOABTDL>?Q;)HN)G>EE) \7Q7H?ON)>L)HE<)IJJak)9HALPH?)>L) HE<)IJKck).EBTT>E)>L)HE<)Kff^] <) " ) %OTTDALB?F ) LMBN)M;TDLM>NBN=) H ) NLH:E>) $%, ) EB?>) QA>HL>@):;)LM>)4MB>E)EH:)GMBQM)NLH:E;) >CTA>NN>N ) H)QD?NLBLOLBS>E;)HQLBS>=) P;ABNLD;EHL>@)S>ANBD?)DR)LM>) QHLHE;LBQ)TKKJi)NO:O?BL)DR) 4!0. ) \L>AP>@)TKKJh] =)B?SDES>@)B?)B?NOEB?)NB?FEB?F=)H?@)QHON>N)Q>EEN)LD)PHB?LHB?) TEOABTDL>?Q;):>QHON>)LMBN)E>H@N)LD)QD?LB?ODON)TMDNTMDA;EHLBD? ) H?@)B?MB:BLBD? ) DR) Q;LDTEHNPBQ)'N W / 0=)NBPBEHA)LD)LM>)'NW / 0i / l / ) 'NW / 0j / l / ) 3.-)P$%,N ) \4DTWB>)>L)HE <)IJKJk) .EBTT>E)>L)HE<)Kff^] < " ) 2D=FG>" E [)4M>?DL;TBQ)@BRR>A>?Q>):>LG>>?)5&)P$%,N)H?@)'NW / 0)3.-)P$%,N<)3.-)Q>EEN) L>?@)LD) FADG)B?)QDPTHQL)QEONL>AN ) H?@)PHB?LHB?)TEOABTDL>?Q;)B?@>RB?BL>E;=)O?EBW>)5&) P$%,N< "

PAGE 16

7 ,D?S>AN>E;=) 5?L)NBF?HEB?F)QH?):>)QD?NLBLOLBS>E;)HQLBSHL>@)B?)$%,N):;)LM>)NLH:E>) >CTA>NNBD?)DR)H)POLH?L)RDA)DR) j / QHL>?B? <)&MBN)POLHLBD?=)%00(=)TA>S>?LN)j / QHL>?B? ) RADP) :>B?F)TMDNTMDA;EHL>@):;)'NW / 0=)A>?@>AB?F)j / QHL>?B?)O?H:E>)LD):>) O:BUOBLB?HL>@ ) H?@) @>FAH@>@) \.DAB?>W)>L)HE<)Kffbk)7DAB?)>L)HE<)Kffb] <)&M>N>)Q>EEN)HEEDG)RDA)NLO@;)DR) 5?L ) NBF?HEB?F)B?)LM>)H:N>?Q>)DR)' NW / 0)GBLMDOL)A>PDSB?F)'NW / 0)RADP)BLN)DLM>A)LHNWN)B?)LM>) Q>EEN=)LM>A>:;)A>@OQB?F)DRR / LHAF>L)>RR>QLN<)5&=)TKKJh=)H?@)%00()Q>EEN)PONL)HEE):>)QOELOA>@) GBLM)2!+)LD)A>PHB?)TEOABTDL>?L)H?@)N>ER / A>?>GB?F<)-?)LM>)DLM>A)MH?@=)3.-)Q>EEN)MHS>) NONLHB?>@)NL>P)Q>EE)TEOAB TDL>?Q;)DS>A)LBP>=)>S>?)B?)LM>)H:N>?Q>)DR)2!+) \%H?QM>_ / 1BTDEE)>L) HE<)IJK0k)3D:E>)>L)HE<)IJJb] <) ) !?L>A>NLB?FE; =) $%,N ) HEND)A>PHB?)TEOABTDL>?L)GM>?)LM>)E>S>E)DR)LM>)1"() P>LM;EHLBD?)P ^ ()BN)A>@OQ>@=)>S>?)O?@>A)QD?@BLBD?N)GM>?)@BRR>A>?LBHLBD?)GDOE@) ?DAPHEE;)DQQOA) \9HLBNLH)>L)HE<)IJKck)'>OEH)>L)HE<)IJKak)YBHD)5H?F)>L)HE <)IJK0] <)1"() P>LM;EHLBD?) DQQOAN)TDNL / LAH?NQABTLBD?HEE;)H?@)BN)H?)>TBF>?>LBQ)TADQ>NN)B?SDES>@)B?) NT>QBR;B?F)P1"()RHL><) &M>)EB?W):>LG>>?)P ^ ()H?@)TEOABTDL>?Q;)BN)O?@>ANLO@B>@)H?@) PBFML)MHS>)LB>N)LD) 5?L ) H?@lDA)B?NOEB?)NBF?HEB?F)NB?Q>) P1"(N ) QD??>QL>@)LD)LM>N >)LGD) THLMGH;N)MHS>):>>?)NMDG?)LD)QD?LHB?)P ^ ()PHAWN=)GMBQM)QDOE@) A>TA>N>?L)H)?DS>E) P>QMH ?BNP)LD)ROALM>A)A>FOEHL>)LM>N>) THLMGH;N ) TDNL / LAH?NQABTLBD?HEE; <) ) " "

PAGE 17

8 '*#"1>@A:9B@D?>@D;"'>=F9B@DLM;EH@>?DNB?> ) \ P ^ ( ])H?@)" ^ =Ie / / @BP>LM;EH@>?DNB?>)\P ^ ( P ])HA>) A>S>ANB:E>=)@;?HPBQ)PD@BRBQHLBD?N)D?)1"()LMHL)QD?LADE)F>?>)A>FOEHLBD?)B?)H)TA>QBN>)H?@) LBP>E;)PH??>A<)&MADOFM) P ^ ( ) P>LM;EHLBD?=)P1"()LAH?NQABTLN):>QDP>)PHAW>@)RDA) @>FAH@HLBD?=)LMON)EDG>AB?F)F>?>)>CTA>NNBD?) \XBH?_MHD)2BO)>L)HE<)IJKck)YBHD)5H?F)>L)HE<) IJK0] <) ,D?S>AN>E;=)GBLM)P ^ ( P ) LHFN=)LAH?NQABTLN)HA>)TADL>QL>@)RADP)@>FAH@HLBD?)H?@)LMON) LM>)F>?>)BN)>CTA>NN>@)HL)H)MBFM>A)AHL>) \7HO>A)>L)HE<)IJKb] < ) !PTDALH?LE;)M>A>=)LM>)1"() P>LM;EHLBD?)BN)H)A>S>ANB:E>)TADQ>NN<) &M>)@>P>LM;EHN>N)+&-)H?@)(2.9*a)HQLBS>E;)A>PDS>) P ^ ()PD@BRBQHLBD?N=)L;TBQHEE;)HEEDGB?F)LM>)P1"()LD):>)LAH?NEHL>@)H?@)LMON) >CTA>NN>@) \XBH) >L)HE<)IJKKk)mM>?F)>L)HE<)IJK0] <)!L)MHN):>>?)A>TDAL>@)LMHL)+&-)NT>QBR BQHEE;)A>PDS>N)P ^ ( P ) H@ZHQ>?L)LD)LM>)ae)QHT)H?@)B?L>A?HE)P ^ (=)GMBE>)(2.9*a)N>>PN)LD)D?E;)A>PDS>)P ^ () \7HO>A)>L)HE<)IJKb] <)7H?;)DR)LM>) P ^ ( ) PD@BRB>@) P1"(N)>?QD@>)RDA ) TEOABTDL>?Q;) A>FOEHLDANk)LM>N>)PONL):>)>CTA>NN>@)GMBE>)LM>)Q>EE)A>PHB?N)O?@BRR>A>?LBHL>@ = ) :OL)HA>) UOBQWE;)@DG?A>FOEHL>@)OTD ?)@BRR>A>? LBHLBD? < ) 6G<@>D?C"3?J<9J>K"LD@A"1>@A:9B@D)P ^ ()P>LM;E)FADOT)BN)H@@>@):;)P>LM;ELAH?NR>AHN>)EBW>)0)\7$&&20])H?@) P>LM;ELAH?NR>AHN>)EBW>)Kc)\7$&&2Kc])H?@)HNNBNL>@):;)5BEPNe)&OPDAK / (NNDQBHLB?F)4ADL>B?) \5&(4]) \XBH?_MHD)2BO)>L)HE<)IJKc] M" 7$&&20)H?@)7$&&2Kc)RDAP)H)M>L>AD@BP>A)HADO?@)LM>) 1"()HN)LM>;)GDAW)LDF>LM>A)LD)H@@)P ^ ()PD@BRBQHLBD?Nk)7$&&20)HQLN)HN)LM>)QHLHE;LBQ)QDA>) GMBE>)7$&&2Kc)BN)LM>)1 "():B?@B?F)TEHLRDAP) \YBH?F)5H?F)>L)HE<)IJK^] <)5&(4)QH?)QD / EDQHEB_>)GBLM)LM>)7$&&20lKc)QDPTE>C)LD)B?QA>HN>)P>LM;EHLBD?)HQLBSBL;k)5&(4)@D>N)?DL) MHS>)P>LM;ELAH?NR>AHN>)HQLBSBL;)DR)BLN)DG?=)LMDOFM ) \XBH?_MHD)2BO)>L)HE<)IJKc] <).?DQW / )

PAGE 18

9 @DG?)\.3])DR)7$&&20)H?@)7$&&2Kc)E>H@N)LD)H)^J / bJp)@>QA>HN>)B?)P ^ ()NBL>N " \6<)5H?F)>L) HE<)IJKc] <)&MDOFM)BL)BN)QOAA>?LE;)O?W?DG?)GMBQM)P>LM;ELAH?NR>AHN>)H@@N)P ^ ( P ) LHFN=)BL)BN) TEHONB:E>)LMHL)D?>)DR)LM>)7$&&2)RHPBE;)>?_;P>N)BN)A>NTD?NB:E><) ) 9HLBNLH)\IJKc])RDO?@)LMHL)00p)DR)P ^ ()T>HWN)HA>) TA>R>A>?LBHEE;)@>T>?@>?L)D?) 7$&&20)DS>A)7$&&2Kc)H?@)LMHL)PH?;)DR)LM>N>)HA>)TEOABTDL>?Q;)PHAW>A)P1"(N<) *DG>S>A=)BR)LM>;)HA>)P ^ ()PD@BRB>@=)LM>;)HA>)LHAF>L>@)RDA)@>FAH@HLBD?=)B?BLBHLB?F)Q>EE) @BRR>A>?LBHLBD?<)&MBN)BN)A>B?RDAQ>@):;)LM>)>SB@>?Q>)LMHL)7$&&20).-)P BQ>)@B>):;) >P:A;D?BQ)@H;N)c / V) \'>OEH)>L)HE<)IJKa] <)&M>)Q>E EN)G>A>)O?H:E>)LD)@BRR>A>?LBHL>)B?LD)H) FADGB?F)>P:A;D=)QD?Q>BSH:E;):>QHON>)H)P>LM;E)LHF)QDOE@)?DL):>)H@@>@)LD)LM>) TEOABTDL>?Q;)PHAW>A)P1"(N)LD)LHAF>L)LM>P)RDA)@>FAH@HLBD?<) ) P ^ ()H?@)P ^ ( P ) PD@BRBQHLBD?N)HA>)A>PDS>@)RADP)P1"():;)D?>)DR)LGD)TADL>B?N[) RHL)PHNN)H ?@)D:>NBL; / HNNDQBHL>@)TADL>B?)\+&-])DA)(2.9*a) \"HAH;H?)H?@)1DLLPH?)KfVVk) XBH)>L)HE<)IJKKk)mM>?F)>L)HE<)IJK0k)7HO>A)>L)HE<)IJKb] <)(2.9*a)GHN)@BNQDS>A>@)HN)H?)P ^ () @>P>LM;EHN>)LGD);>HAN)HRL>A)+&-=):OL)B L)LDDW)H?DLM>A)RDOA);>HAN)LD)NMDG)LMHL)+&-) HQLOHEE;)TA>R>A>?LBHEE;)A>PDS>N)P ^ ( P ) \mM>?F)>L)HE<)IJK0k)7HO>A)>L)HE<)IJKb] k)RDEEDG)OT) A>N>HAQM)BN)?>Q>NNHA;)LD)@>L>APB?>)LM>)>CL>?L)DR)DS>AEH T<) ) &MDOFM)P ^ ()P>LM;ELAH?NR>AHN>N)H?@)@>P>LM;EHN>N)HA>)QE>HAE;)B?SDES>@)B?)LM>) A>FOEHLBD?)DR)F>?>N)SBH)P ^ (=)LM>;)HA>)?DL)LM>)D?E;) P>H?N ) :;)GMBQM) P1"(N)QH?):>) A>FOEHL>@)B?)H?)P ^ ( / @>T>?@>?L)RHNMBD?<)&M>)6&*)TADL>B?)RHPBE;)QH?)A>H@)P ^ () P>LM;EHLBD?=)P>H?B?F)P ^ ()PD@BRBQHLBD?N)HA>)?DL)D?E;)A>S>ANB:E;)P>LM;EHL>@=):OL)HEND) NO:Z>QLBS>E;)qA>H@r)H?@)LHAF>L>@)RDA)@>FAH@HLBD?)DA)LAH?NEHLBD?<)6&*3+K)@BA>QLE;) TADPDL>N)LAH?NEHLBD?)DR)P ^ ()PD@BRB>@)P1"(N=)LM>A>:;)B?QA>HNB?F)LM>)F>?>)>CTA>NNBD?)

PAGE 19

10 DR)LMDN>)LAH?NQABTLN) \YBHD)5H? F)>L)HE<)IJKaH] <)-?)LM>)DLM>A)MH?@=)6&*3+I)LHAF>LN) NT>QBRBQ)P>LM;EHL>@)P1"(N)RDA)@>FAH@HLBD?=)LMON)QD?LADEEB?F)LM>) E BR>LBP>)DR)BLN)LHAF>L) P1"()LAH?NQABTLN) \YBHD)5H?F)>L)HE<)IJKaH] <)&MDOFM)LM>N>)LGD)TADL>B?N)NDO?@)HN)BR)LM>;) MHS>)QD?REBQLB?F)TADQ>NN>N=):DLM)GDAW)B?)QD?Q>AL)LD)QD?LADE)P1"()LAH?NQABTLBD?<)-?) LAH?NQABTL)LHAF>LN=)6&*3+K):B?@N)RBANL)LD)TADPDL>)LAH?NQABTLBD?)H?@)EHL>A)6&*3+I):B?@N) LD)@BA>QL)LM>)P1"()RDA)@>FAH@HLBD?)D?Q>)> ?DOFM)TADL>B?)MHN):>>?)PH@>) \YBHD)5H?F)>L) HE<)IJKa:] <) ) * N O 1>@A:9BK>?"PQ N #R"B ?K" * N SIT O + O KDQ>@A:9BK>?"PQ N # Q R " " ^ / P>LM;EH@>?DNB?> ) \ P ^ ( ])BN) LM>)P>LM;EHLBD?)DR)H@>?DNB?>)HL)LM>)QHA:D? ! ^) TDNBLBD?)\+BFOA>)c] ) H?@)BN) LM>)PDNL)QDPPD?)B?L>A?HE)PD@BRBQHLBD?)B?)P>NN>?F>A)1"() \P1"(]=)HQQDO?LB?F)RDA)PD@BRBQHLBD?)B?)J?DNB?>)A>NB@O>N)B?)P1"() \3O:B?) H?@)&H;EDA)Kfba] <)) P ^ ( ) GHN)@BNQDS>A>@)cJ);>HAN)HFD=):OL)D?E;)A>Q>?LE;)RDO?@)L D):>)LM>) RBANL)B?NLH?Q>)DR)A>S>ANB:E>)DA)B?@OQB:E>)1"()P>LM;EHLBD?) \5>B=)'>ANMDGBL_=)H?@)7DNN) Kfba=)Kfb^k)5>B)H?@)7DNN)Kfbbk)XBH)>L)HE<)IJKKk)+O)>L)HE<)IJKc] <)&MBN)BN)D?>)DR)LM>)RBANL) B?@BQHLBD?N)LMHL)F>?>N)QH?):>)A>FOEHL>@)TDNL / LAH?NQABTLBD?HEE; <) P ^ ()PHAW>@)LAH?NQABTLN) MHS>)H)NMDAL>A) MHER / EBR> ) H?@)H)NEBFMLE;)EDG>A>@)LAH?NEHLBD?HE)>RRBQB>?Q;) \9HLBNLH)>L)HE<)IJKck) '>OEH)>L)HE<)IJKa] <)&MBN)B?@BQHL>N)LMHL)P ^ ()PHAW>@)LAH?NQABTL N)HA>)L;TBQHEE;)LHAF>L>@)RDA) @>QH;=)LM>A>:;)NEDGB?F)LM>)>CTA>NNBD?)DR)LM>)>?QD@>@)F>?><) ) ,>EEN)LMHL)GDOE@)?DAPHEE;)@BRR>A>?LBHL>)L>?@)LD)NLH;)TEOABTDL>?L)GM>?)P ^ ()E>S>EN) HA>)EDG=)GMBQM)BN)B?BLBHL>@):;)LM>)@>P>LM;EHN>)+&-<)7H?;)TEOABTDL>?Q;)A>FOEHLDA) P1"(N= ) :DLM)QAOQBHE)H?@)?D? / QAOQBHE=)HA>)?DAPHEE;)P ^ ()PD@BRB>@)B?)5&)P$%,N=)B?QEO@B?F) "H?DF=).ERc=)76,=)2B?IV=)7>@K=)XHAB@I=)H?@)$>@<))*DG>S>A=)4-8a+K)\ B<><= ) -QLc]=)H)QABLBQHE)

PAGE 20

11 TEOABTDL>?Q;)RHQLDA=)BN)?DL)P ^ ()PD@BRB>@) \9HLBNLH)>L)HE<)IJKc] <)&MBN)GHN)@>L>APB?>@)GBLM) P ^ ( / N>U)H?@)QD?RBAP>@)GBLM)U4,1)\ +HOE@N)>L)HE<)IJKV=) NO:PBLL>@ ]<)(L)LM>)LBP>)DR) @BRR>A>?LBHLBD?= ) P ^ ()PD@BRBQHLBD?N)LHAF>L)TEOABTDL>?Q;)PHAW>AN)RDA)@>FAH@HLBD?)H?@) HEEDG)@BRR>A>?LBHLBD?)PHAW>AN)LD)OTA>FOEHL>)H?@)QMH?F>)LM>)Q>EE)RHL><) ) %BPBEHA)LD)P ^ (=)LM>)" ^ =Ie / / @BP>LM;EH@>?DNB?>)\P ^ ( P ])PD@BRBQHLBD?)GHN)S>A;) A>Q>?LE;)@BNQDS>A>@)LD)MHS>)A>EHL>@):OL)@BN LB?QL)>RR>QLN)D?)P1"()LAH?NQABTLN) \7HO>A)>L) HE<)IJ Kb] <)&MBN)PD@BRBQHLBD?)BN)PDNL)QDPPD?E;)RDO?@) HL ) LM>)RBANL)?OQE>DLB@>)HRL>A)LM>)" b / P>LM;EFOH?DNB?>)\P b '])QHT)\+BFOA>)c]) \3DPB?BNNB?B)>L)HE<)IJKIk)7H O>A)>L)HE<)IJKb] <) 1>N>HAQM>AN)MHS>)RDO?@)LMHL) GM>?) LMBN)RBANL)?OQE>DLB@>)BN ) H? ) H@>?DNB?>=)BL ) HEGH;N)>BLM>A) ( P ) DA)P ^ ( P =)?>S>A)ZONL)()DA)P ^ () \7HO>A)>L)HE<)IJKb] <)!L)BN)O?W?DG?)GMBQM) P>LM;ELAH?NR>AHN>)H@@N)LMBN)P>LM;E)LHF=):OL)BL)GHN)NMDG?)LMHL)+&-)BN)LM>)@>P>LM;EHN>) RDA)P ^ ( P ) :DLM) "#$%"%&$ H?@) "#$%"'(&$ H?@)LMHL)+&-)TA>R>A>?LBHEE;)@>P>LM;EHL>N)P ^ ( P ) DS>A) P ^ (<)&AH?NQABTLN)QD?LHB?B?F)HL)E>HNL)D?>)P ^ ( P ) LHF)MHS>)B?QA>HN>@)NLH:BEBL;=)@O>)LD) A>NBNLH?Q>)LD)LM>)3,4I)>?_;P>=)H?)P1"( / @>QHTT>A)LMHL)LHAF>LN)LM>)P b ')QHT) \7HO>A)>L) HE<)IJKb] <)9>QHON>)P ^ ( P ) QHON>N)B?QA>HN>@)LAH?NQABTL)NLH:BEBL;)GMBE>)P ^ ()@>QA>HN>N) NLH: BEBL;=)H?@)LM>)LGD)LHFN)@BRR>A):;)D?E;)D?>)P>LM;E)FADOT=)@>L>APB?B?F) GMBQM ) P>QMH?BNPN)HA>)HL)GDAW)QH?):>)@BRRBQOEL<)7DA>DS>A=)LM>A>)BN)?DL)H)NT>QBRBQ) H?LB:D@;) LMHL) QH?)@BRR>A>?LBHL>)LM>)LGD)P>LM;E)LHFN)RADP)D?>)H?DLM>A =)PHWB?F)@HLH)RADP)LAH@BLBD?HE) >?ABQMP >?L)N>UO>?QB?F)L>QM?BUO>N)@BRRBQOEL)LD)B?L>ATA>L<) $ &GD)THT>AN)B?)IJKI)B?@>T>?@>?LE;)QD?NLAOQL>@)H)?DS>E)P>LMD@)RDA)P>HNOAB?F) H?@)THALBHEE;)EDQHEB_B?F)P ^ () \H?@)P ^ ( P ] ) A>NB@O>N=)?DG)QHEE>@)P ^ ( / N>U) \3DPB?BNNB?B)>L)HE<) IJKIk)7>;>A)>L)HE<)IJKI] <)&MBN)HEEDG>@)LM>)A>N>HAQM>AN)LM>)H:BEBL;)LD)?DL)D ?E;)UOH?LBR;)

PAGE 21

12 P ^ ()PD@BRBQHLBD?N)HQADNN)LM>)LAH?NQABTLDP>=):OL)HEND)LD)@>L>APB?>)GM>A>)LM>)P ^ () PD@BRBQHLBD?N)G>A>)DQQOAAB?F)HED?F)LM>)1"(<)&MBN)NBF?BRBQH?LE;)NBPTEBRB>@)LM>)TADQ>NN)DR) P ^ ()EDQHEB_HLBD?=)GMBQM)BN)BPTDALH?L)RDA)@>L>APB?B?F)GMBQM)F>?>N)DA)A>FBD? N)HA>) P>LM;EHL>@)PDNL)DRL>?)DA)HL)HEE<)&M>N>)NLO@B>N)B?@BQHL>@)LMHL)P ^ ()NBL>N)HA>)?DL)NTA>H@) >S>?E;)HED?F)H)LAH?NQABTLk)LM>;)L>?@)LD)QEONL>A)GBLMB?)ED?F)B?L>A?HE)>CD?N)H?@)HADO?@) NLDT)QD@D?N)DA)HL)LM>):>FB??B?F)DR)LM>)0e)8?LAH?NEHL>@)1>FBD?)\0e)8&1]) \9HLBNLH)>L)HE<) IJKck)7>;>A)>L)HE<)IJKIk)3DPB?BNNB?B)>L)HE<)IJKIk).>)>L)HE<)IJKa] <)&MDOFM)?>BLM>A)P ^ ( / N>U)P>LMD@)QH?)@BRR>A>?LBHL>)P ^ ()RA DP)P ^ ( P) \:>QHON>)LM>A>)BN)?DL)H)NT>QBRBQ)H?LB:D@;]=) LM>)P>LM;EHLBD?)QD?N>?NON)N>UO>?Q>)RDA)P ^ ()BN)W?DG?[)11(,8) \3DPB?BNNB?B)>L)HE<)IJKI] <) 7>LM;E)LHFN)QH?):>)B?R>AA>@)LD):>)P ^ ()BR)LM>;)HA>)EDQHL>@)?>HA)LMHL)N>UO>?Q>)DA)B?)LM>) TA>SBDONE;)P>?LBD?>@)_D?>N<)()LHF)QH?):>)B?R>AA>@)LD):>)P ^ ( P ) BR)BL)BN) H@ZHQ>?L)LD ) LM>) LAH?NQABTLBD?HE)NLHAL)NBL>)H?@)BN ) ?DL)EDQHL>@)?>HA)H?)11(,8)N>UO>?Q><)"D?>LM>E>NN=)BL)GBEE) :>)H@SH?LHF>DON)LD)MHS>)H)QE>HA)GH;)LD)@BRR>A>?LBHL>)LM>N>)GBLM)Q>ALHB?L;)GBLMDOL) @DB?F) ) H)N>UO>?QB?F)>CT>ABP>?L)>HQM)LBP>< ) ) " " " " " " " ) 2D=FG>" U [)P ^ ( P ) H?@)P ^ ( ) PD@BRBQHLBD?N)LD)H@>?DNB?> < "

PAGE 22

13 5:H<@A>CDC " &M>)TOATDN>)DR)LMBN)NLO@;)BN)LD)@>L>APB?>)GM>LM>A) 5?L ) DA)B?NOEB?)NBF ?HEB?F) A>FOEHL>)1"()P>LM;EHLBD? <)5M>?)'NW / 0)RO?QLBD?)BN)EDNL=)HQLBSHLBD?)DR) 5?L ) NBF?HEB?F)H?@) B?@>RB?BL>)NL>P)Q>EE)TEOABTDL>?Q;)DQQOA=)LMDOFM)H)TA>QBN>)P>QMH?BNP)RDA)LM>)EHLL>A)MHN) ?DL):> >?)O?QDS>A>@) \3D:E>)>L)HE<)IJJb] <)'NW / 0)BN)W?D G?)LD):>)H)Q>?LAHE)A>FOEHLDA)DR):DL M) 5?L)H?@)B?NOEB?)NBF?HEB?F) THLMGH;N<)3D>N)'NW / 0)B?MB:BLBD?)SBH)LM>N>)THLMGH;N)HRR>QL)P ^ () B?)P$%,Ns)%B?Q>) 5?L ) NBF?HEB?F) BN ) BPTEBQHL>@)B?)NL>P)Q>EE)TEOABTDL>?Q;=)H?@)@>QA>HN>@) P ^ ()>?MH?Q>N)TEOABTDL>?Q;=)G>) B?S>NLBFHL>@ ) BR)LMBN)BN)@O>)LD)H)QMH?F>)B?)P ^ ( ) DA)LM>) THLMGH; ) BLN>ER <) ) 5M>?)'NW / 0)BN)B?MB:BL>@=)BL)B?QA>HN> N ) >CTA>NNBD?)DR)+&-=)@>QA>HNB?F)P ^ () P>LM;EHLBD?)GMBQM)@BA>QLE;)QHON>N)H?)B?QA>HN>)B?)P1"() MHER / EBR> <) 5?L)LAH?NQABTLN)H?@) TEOABTDL>?Q;)LAH?NQABTLN)HA>)TA>@BQL>@)LD)HQQOPOEHL>)B?)LM>)Q>EE<) 5>):>EB> S>)LMHL)'NW / 0) ?DAPHEE;)TMDNTMDA;EHL>N)+&-<) n*DG>S>A=)DS>A>CTA>NNBD?)DR)+&-)HEND)@>QA>HN>N)LM>) HPDO?L)DR)P ^ ( P) LHFN=)GMBQM)A>PDS>N)A>NBNLH?Q>)LD)LM>)3,4I)@> / QHTTB?F)>?_;P>=) NMDAL>?B?F)LM>) MHER / EBR> ) DR)LMDN>)LAH?NQABTLN<)!L)BN)O?W?DG?)GMBQM)LAH?NQABTLN)HA>) TA>R>A>?LBHEE;)PHAW>@):;)P ^ ( P ) B?)P$%,N)M;TDLM>NB_>)LMHL) 5?L ) NBF?HEB?F)HQLBSBL;) QH?):>)OTA>FOEHL>@)LMADOFM)HL)E>HNL)LGD)TADQ>NN>N[)\K])B?QA>HN>@) 5?L ) LHAF>L)F>?>) HQLBSHLBD?)SBH)j / QHL>?B?)HQLBSBL ;) )#* ) \I])LMADOFM)LM>)B?QA>HN>@)P1"() MHER / EBR> ) DR)5?L) LHAF>L)F>?>N)SBH)@>QA>HN>@)P ^ ()P>LM;EHLBD?)\+BFOA>)a]<)5>)TADTDN>)LMHL)1"():BDEDF;) H?@)NBF?HE)LAH?N@OQLBD?)QD?S>AF>)D?)A>FOEHLB?F)F>?>)>CTA>NNBD?)B?)H)TA>QBN>)H?@)LBP>E;) PH??>A<) "

PAGE 23

14 ) %H>;DVD;"#DQCW" " !< ! ,A>HL>)H) PD@>E ) RDA)NLO@;)DR)HQLBSHL>@) 5?L =)B?NOEB? =)DA)+&-)B?)PDON>)>P:A;D?BQ) NL>P)Q>EEN<)&M>N>)P>LMD@N)NMDOE@):>)>RRBQB>?L)N>THAHL>E;)DA)B?)LH?@>P<)) ) !!< ! 4>ARDAP)HQLB?DP;QB? / 3)>CT>ABP>?LN)LD)NLDT)LAH?NQABTLBD?)DR)P1"()B?)3.-)DA)5&) P$%,N<) 8LBEB_> ) "H?DNLAB?F)LAH?NQABTL)UOH?LBRBQHLBD?)LD)QD?QEO@>)GMBQM)LAH?NQAB TLN) MHS>)LM>)ED?F>NL)H?@)NMDAL>NL)MHER / EBS>N<)!@>?LBR;)THLL>A?N)B?)LM>)L;T>N)DR)F>?>N) LMHL)HA>)P>LM;EHL>@< ) !!!< ! 3>L>APB?>)DLM>A)PD@BRBQHLBD?N)LMADOFM)GMBQM)F>?>)>CTA>NNBD?)QH?):>) PH?BTOEHL>@<)4>ARDAP)"H?DNLAB?F)H?HE;NBN)B?)Q>EE)L;T>N)GBLM)PD@BRB>@) 5?L =) B?NOEB?= ) 'NW / 0= ) +&=)H?@lDA)2!+) QOELOAB?F ) QD?@BLBD? N <)(?HE;_>)GMBQM)QDP:B?HLBD?N) OT / ) DA)@DG? / A>FOEHL>)F>?>)>CTA>NNBD?<)2DDW)RDA)THLL>A?N)B?)FADOTN)DR)F>?>N)GBLM) @BRR>A>?LBHE)>CTA>NNBD?<) " ) ) 2D=FG>" X [) *;TDLM>NBN)RDA)MDG)5?L)NBF?HEB?F)QH?):>)HQLBSHL>@)SBH)'NW / 0)B?MB:BLBD? ) :>;D?@)GMHL)BN)>CT>QL>@)RADP)HQLBSHLBD?)DR)>HQM)THLMGH;)D?)BLN)DG?< $

PAGE 24

15 (5#6&.'"I " " '.%8-&% " ) +O?@HP>?LHE)LD)LMBN)NLO@;)BN)LM>)H:BEBL;)LD)HQLBSHL>)DA)B?MB:BL):DLM) 5?L ) H?@)B?NOEB?) NBF?HEB?F)GMBE>)HEND)FHB?B?F)LM>)H:BEBL;)LD)DS>A>CTA>NN)+&-)B?)LM>N>)Q>EE)L;T>N<)()SHAB>L;)DR) P>LMD@N)G>A>)NOAS>;>@)LD)HQQDPTEBNM)LM>N>)A>NOELN<)-?Q>)NHLBNRHQLDA;)>CT>ABP> ?LHE) QD?@BLBD?N)G>A>)HQMB>S>@=)G>)QD?LB?O>@)D?)LD)NLO@;)LM>)>RR>QLN)DR)QD?QOAA>?L) 5?L =) B?NOEB?=)H?@lDA)+&-)DS>A>CTA>NNBD?)LD)@>L>APB?>)BR)LM>A>)BN)H)QD?S>AF>?Q>)LMHL)HRR>QLN) 1"()P>LM;EHLBD?)H?@)NL>P)Q>EE)TEOABTDL>?Q;<) ) +J>G>YHG>CCDU OBA>N)LM>)DS>A>CTA>NNBD?)DR)+&-)ND)LMHL)G>)QH?)NLO@;)LM>)>RR>QL)DR) @>QA>HN>@)P ^ ()\H?@)P ^ ( P ])LHFN)GBLMB?)LM>)RAHP>GDAW)DR)HQLBSHL>@) 5?L ) DA)B?NOEB?) NBF?HEB?F<)+DA)LMBN=)G>)?>>@>@)H)TEHNPB@)LMHL)GBEE)DS>A>CTA>NN)+&-)B?)H?;)FBS>?)Q>EE< ) 5>) ON>)LM>)S>ANHLBE>)PHP PHEBH?)S>QLDA)T,('$")B?)LM>)4MB>E)EH:):>QHON>)BL)A>NOELN)B?)NLAD?F) QD?NLBLOLBS>)>CTA>NNBD?)DR)>CDF>?DON)F>?>N=)THALBQOEHAE;)B?)PDON>)$%,N<) ) &D)B?N>AL)+&-) B?LD)H)PHPPHEBH?)>CTA>NNBD?)S>QLDA=)T,('$"=)'B:ND?)(NN>P:E;)QED?B?F)GHN)OLBEB_>@<) F9EDQW)F>?>)RAHFP>?L N)\!3&])HA>)N;?LM>NB_>@=)S>ABRB>@)?OQE>DLB@>)RAHFP>?LN<)+DA)LMBN)G>) @>NBF?>@)H) +2(' / +&-)RAHFP>?L)\N>UO>?Q>)B?)HTT>?@BC)(]<)&M>)+&-)N>UO>?Q>)GHN)LHFF>@) GBLM)H) +2(' ) >TBLDT>)LD)>?H:E>) >HN;) @>L>QLBD?)DR)LM>)TADL>B?):;)H?LB:D@;)H?@)LD) @BNLB?FOBNM)>?@DF>?DON)H?@ ) >CDF>?DON)TADL>B?<)&D)HNN>P:E>)LM>N>)S>QLDAN=)LM>)F9EDQW) PONL)MHS>)Ka / IJ):T)DS>AEHTN)LD)LM>)>CTA>NNBD?)S>QLDA<)(RL>A)EB?>HAB_B?F)T,('$")GBLM) $QD1!)\&M>APD+BNM>A])LD)>CTDN>)LM>)QDPTE>P>?LHA;)>?@N=)LM>)F9EDQW)GHN)B?N>AL>@)ONB?F) LM>)'B:ND?)(NN>P:E;)PHNL>A)PB C<)&MBN)PBC)QD?LHB?N)H)3"()TDE;P>AHN>=)H?)>CD?OQE>HN>=)

PAGE 25

16 H?@)3"()EBFHN>)ND)LMHL)H)@DO:E> / NLAH?@>@)QBAQOEHA)TEHNPB@)QH?):>)QA>HL>@<)3O>)LD)LM>) QDPTE>P>?LHA;)DS>AEHTN)GBLM)T,('$"=)LM>)F9EDQW)BN)FOHAH?L>>@)LD):>)B?N>AL>@)B?)LM>) QDAA>QL)DAB>?LHLBD?<)-?>%MDL)QM>P BQHEE;)QDPT>L>?L)Q>EEN)G>A>)LM>?)LAH?NRDAP>@)GBLM) LM>)HNN>P:E>@)TEHNPB@)LD)FADG)BL)OT)H?@)LM>?)LM>)TEHNPB@)GHN)BNDEHL>@)LMADOFM)PB?B / TA>TN)\'>?>X>L)H?@)m;PD]<)()A>NLABQLBD?)@BF>NL)GHN)T>ARDAP>@)GBLM)*B?@!!!) \&M>APD+BNM>A])LD)NQA>>?)QED?>N)LD)>?NOA>)LM>)TAD T>A)B?N>ALBD?)DR)LM>)F9EDQW)\+BFOA>)^]<) 9>QHON>)LM>)F9EDQW)MHN)QDPTE>P>?LHA;)DS>AMH?FN)GBLM)LM>)S>QLDA=)LM>)F9EDQW)GBEE) HEGH;N)B?N>AL)B?)LM>)QDAA>QL)DAB>?LHLBD?<)&MDN>)B@>?LBRB>@)LD)MHS>)LM>)B?N>AL)G>A>)LM>?) %H?F>A)N>UO>?Q>@)\$LD?)9BDNQB>?Q>N])LD)ROALM>A)S>ABR;)LM>)QDAA>QL)QED?B?F<) ) ) 2D=FG>" N [)1>NLABQLBD?)@BF>NL)D?) +2(' / +&) QDED?B>N)ONB?F)*B?@!!!<)$CT>QL>@):H?@N)HL) c=b0b ) ?L) H?@)K=^KV)?L<)&MBN)GHN)N>>?)B? ) QDED?B>N)K / c=)^ / b=) H?@) f / KI<),DED?B>N)K / c) G>A>) N>?L ) RDA)N>UO>?QB?F< ) -?>)HNL>ABNW)@>?DL>N)B?N>AL)GHN)N>>?)H?@)LGD)HNL>ABNWN) @>?DL>N)LM>)NHPTE>)GHN)N>?L)RDA)N>UO>?QB?F<) ) ** ** ** ** * * * * * *

PAGE 26

17 (RL>A)QED?B?F)H?@)N>UO>?QB?F=)LM>)TEHNPB@N)G>A>)L>NL>@)RDA)>CTA>NNBD?)B?)PDON>) >P:A;D?BQ)NL>P)Q>EEN<)8NB?F)TDE;>LM;E>?BPB?>)\4$!])HN)H)LAH?NR>QLBD?)HF>?L) \9HALPH?)>L) HE<)IJKa] =)KVJJ)?F)TEHNPB@)3"()H?@)IJJ)?F)'+4)G>A>)LAH?NR>QL>@)B?)P$%,N<)'+4)GHN) ON>@)LD)SBNOHEE;)QD?RBAP)NOQQ>NNROE)LAH?NR>QLBD?)LM>)RDEEDGB?F)@H;<)4ADL>B?)GHN)BNDEHL>@) H?@)NO:Z>Q L>@)LD)G>NL>A?):EDLLB?F)GBLM)H?)+&-)H?LB:D@;)\+BFOA>)b]<)1D:ONL) DS>A>CTA>NNBD?)GHN)RDO?@)DR)LM>)>CDF>?DON)+&-<) ) $ ) +DA)>HN>)DR)NLO@;=)G>)HLL>PTL>@)LD)ON>),1!%41 / ,HNf)F>?>)>@BLB?F)LD)W?DQW / B?) '+4)B?)LM>)+&-)F>?>)ND)LMHL)Q>EEN)GDOE@)REODA>NQ>)H?;)LBP>)>?@DF>? DON)+&-)GHN)HQLBS><) &MBN)GHN)?DL)H)PHZDA)HBP=):OL)GDOE@):>) H)NBPTE>)tRBANL / EDDWe)DTLBD?)LD)NHS>)LBP>) UOH?LBR;B?F)+&-)>CTA>NNBD?)B?)Q>EEN)LMHL)G>A>)?DL)>CTA>NNB?F)BL<),1!%41)NLH?@N)RDA) ,EONL>A>@)1>FOEHAE;)!?L>ANTHQ>@)%MDAL)4HEB?@ADPBQ)1>T>HLN)H?@)GHN)DABFB?HEE;)RDO?@)HN)H) @>R>?N>)N;NL>P)B?):HQL>ABH<)&MBN)N;NL>P)QH? ) :>)ON>@)LD)LHAF>L)H)NT>QBRBQ)A>FBD?)DR)H)F>?>) H?@)T>APH?>?LE;)PD@BR;)BL):;)W?DQWB?F)BL)DOL=)W?DQWB?F)B?)H?DLM>A)F>?>=)DA)POLHLB?F)DA) PD@BR;B?F)LM>)F>?><),HNf):B?@N)3"()HL)LM>)4(7)N>UO>?Q>)H?@)QOLN):DLM)NLAH?@N<)&M>) " 2D=FG> " Z [)+2(' / +&-) 5>NL>A?)9EDL<)2H?>)D?>)BN)H?)O?LAH?NR>QL>@=)?>FHLBS>)QD?LADE<) 2H?>)I)BN) +2(' / 7>LLE0=)TDNBLBS>)QD?LADE)RDA)+2('<)+2(' / 7>LLE0)NMDOE@):>)b0)W3H<)2H?>) 0)BN)LM>)+2(' / +&-)TEHNPB@)B?)5&)$%,N<)+2(' / +&-)BN)TA>@BQL>@)LD):>)^b)W3H<)&DLHE) TADL>B?)EDH@>@)LD)>HQM)EH?>)BN)?DL)NLH?@HA@B_>@)H?@)LM>A>RDA>)@D>N)?DL)NMDG)A>EHLBS>) >CTA>NNBD?)E>S>E N< )

PAGE 27

18 @>NBF?>@)N;?LM>LBQ),1!%41)1"()\QA1"(])QH ?)LM>?):>)ON>@)LD)A>THBA)LM>):A>HW)GBLM)LM>) @>NBA>@)QMH?F>=)B?)LMBN)QHN>)'+4) \,D?F)>L)HE<)IJK0] <)&MA>>)QD?NLAOQL N)G>A>)@>NBF?>@)NOQM) LMHL)'+4)GHN)B? / RAHP>)B?)LM>)+&-)F>?>)HL)TDNBLBD?N)cJ\u]=)c0\u]=)H?@)aI\ / ]k)LMBN)W?DQW / B?) GDOE@)HEEDG)>?@DF>?DON)+&-)LD):>)>CTA>NN>@)HN)G>EE)HN)'+4)HL)LM>)NHP>)LBP>)\QA1"() N>UO>?Q>N)B?)HTT>?@BC]<))&M>)QA1"()GHN)LAH?NR>QL>@)HED?F)GBLM)T ,HNf / '+4)H?@)LAHQA1"() B?LD)5&)P$%,N<)'>?DPBQ)3"()GHN)>CLAHQL>@=)4,1)GHN)AO?)GBLM)TABP>AN)@>NBF?>@)LD) LHAF>L)LM>)W?DQW / B?)A>FBD?=)H?@)H)&b)NOAS>;DA)HNNH;)GHN)T>ARDAP>@)\+BFOA>)V]<)&M>)&b) NOAS>;DA)HNNH;)MBFMEBFMLN)LM>)NOQQ>NN)DA)RHBEOA>)DR),1!%41k)LM>)&b)>?@ D?OQE>HN>)QOLN) PBNPHLQM>@)3"()\B<>< / ) GM>A>)LM>)W?DQW / B?)MHN)DQQOAA>@)H?@)?D? / MDPDEDFDON)>?@) ZDB?B?F)A>THBA>@)LM>)QOL]<)&M>N>)QOLN)A>NOEL)B?)LMA>>):H?@N)GM>?),1!%41)BN)NOQQ>NNROE[) LGD)RADP)QOL)3"()H?@)D?>)RADP)A>PHB?B?F)O?QOL)3"(<)5>)NHG)LMA>>):H?@N)GBLM)QA 1"() vK)H?@)QA1"()vI)\+BFOA>)V]< ) &MDOFM)LM>)W?DQW / B?) HTT>HA>@)LD):> ) NOQQ>NNROE=)G>)RHBE>@)LD) RB?@)>CTA>NNBD?)DR)LMBN)B?)PDON>)$%,N<) )

PAGE 28

19 ) 1>BCFG>Q>?@"QHON>)LM>A>)HA>)EBPBL>@)GH;N)LD)NBPTE;)H?@)@BA>QLE;)P>HNOA>)P ^ ()HQLBSBL;)NMDAL) DR)H?)P ^ ( / N>U)>CT>ABP>?L=)G>)@>QB@>@)LD)L>NL)GM>LM>A)P ^ ()HRR>QLN)LAH?NQABTLN)RDA)LM>) QDPPD?E;)ON>@)A>TDAL>A)F>?>)EOQBR>AHN><) !R)LM>)EOQBR>AHN>)P1"() QD?LHB?N)P ^ (=)H?@)BN) A>FOEHL>@):;)7>LLE0)H?@)+&-=)BL)QDOE@)TADSB@>)H)ON>ROE)LDDE)B?)DOA)NLO@B>N<) ()EOQBR>AHN>) HNNH;)GHN)T>ARDAP>@)GBLM)LMA>>)FADOTN)LD)@>L>APB?>)BR)+&-)DA)7>LLE0)MH@)H?)>RR>QL)D?) P ^ ()D?)EOQBR>AHN>)LAH?NQABTLN<)*$.If0&)Q>EEN)G>A>)LAH?NR>QL>@ ) GBLM)EOQBR>AHN>)\2OQ / T3$%&cJ]=)A>?BEEH)\T12 / %#cJ]=)'+4)\T7(Y / '+4]=)H?@) &#+ ) DR)LM>)RDEEDGB?F)QD?@BLBD?N[) T,('$")\?>FHLBS>)QD?LADE]=)+&-)\T,('$" / +2(' / +&-]=)DA)7>LLE0)\T,('$" / +2(' / 7>LLE0]<) *$.If0&)Q>EEN)HA>)PD@BRB>@)*OPH?)$P:A;D?BQ).B@?>;)If0)Q>EEN)GBLM)LM>) 2HAF>)&)H?LBF>?) GMBQM)BN)BPTDALH?L)RDA)A>TEBQHLB?F)TEHNPB@N)GBLM)H?)%#cJ)DABFB?)DR)A>TEBQHLBD?)LD)H)MBFM) QDT;)?OP:>A)B?)LM>)Q>EE<))2OQBR>AHN>)QDP>N)RADP)RBA>REB>N)H?@)BN)H?)DCB@HLBS>)>?_;P>)LMHL) " 2D=FG>"[ [)&b)(NNH;)DR)F3"()B?)Q>EE)LAH?NR>QL>@)RDA),1!%41< ) &MA>>):H?@N)HTT>HA)B?)t4ABP>A0[QA1"(Ke)H?@) t4ABP>A0[QA1"(I
PAGE 29

20 TAD@OQ>N):BDEOPB?>NQ>?Q>)OTD?)H@@BLBD?)DR)LM>)NO:NLAHL>)EOQBR >AB?<)1>?BEEH)BN)ON>@)LD) ?DAPHEB_>)LM>)RBA>RE;)EOQBR>AHN>)NBF?HE)B?)>HQM)NHPTE><) ) !?)EOQBR>AHN>)A>TDAL>A)HNNH;N=)EOQBR>AHN>)BN)@DG?NLA>HP)DR)LM>)F>?>)DR)B?L>A>NLeN) TADPDL>A<)!?)LMBN)QHN>=)LMDOFM=)2OQ / T3$%&cJ)MHN)LM>)QMBQW>?)j / HQLB?)TADPDL>A) ND) EOQBR>AHN>)P 1"()GBEE):>)>CTA>NN>@) QD?NLBLOLBS>E;<)%O:N>UO>?L)EOQBR>AHN>)HNNH;N)GDOE@) TADSB@>)H?)B?@BA>QL)P>HNOA>)DR)EOQBR>AHN>)P1"()E>S>EN<) &MBN)HNNH;)GHN)T>ARDAP>@)LD) @>L>APB?>)BR)P ^ ()GDOE@)P>LM;EHL>)\H?@)PD@OEHL>])EOQBR>AHN>)>CTA>NNBD?)\+BFOA>)f]<) 8?RDALO?HL>E;=) >HQM)NHPTE>)MH@)QDPTHAH:E>)EOQBR>AHN>)>CTA>NNBD?)H?@)ND)EOQBR>AHN>) HNNH;N)QDOE@)?DL):>)ON>@)HN)H)@BA>QL)P>HNOA>)DR)P ^ ()E>S>EN)B?)>HQM)NHPTE><)7DSB?F) RDAGHA@=)G>) MH@)LD)ON> ) B?@BA>QL)P>HNOA>N)DR)P ^ (<) ) ) " " ) 2D=FG>" \ [)2OQBR>AHN>)(NNH;)B?)*$.If0&)Q>EEN ) GBLM)DS>A>CTA>NN>@)+&-)DA)7>LLE0 < $ J KJJJ IJJJ 0JJJ cJJJ aJJJ ^JJJ bJJJ VJJJ fJJJ KJJJJ T,('$")\QD?LADE] +&7>LLE0 128

PAGE 30

21 %QB99"1<9>;F9>"1GC" " $ %PHEE)PDE>QOE>N)QH?):>)ON>@)LD)B?MB:BL)DA)HQLBSHL>)NBF?HEB?F)QHNQH@>N)NOQM)HN) 5?L ) H?@)B?NOEB?<)&M>N>)PDE>QOE>N)HQL)D?)LM>)Q>EEN)LM>)>?LBA>)LBP>)LM>;)HA>)B?)LM>)P>@BH=) P>H?B?F)BL)BN)?DL)H)L>PT DAHA;)NLHL><),OAA>?L)EBL>AHLOA>)D?)>HQM)DR)LM>)NPHEE)PDE>QOE>N) GHN)ON>@)HN)H):HNBN)RDA)@>L>APB?B?F)LM>)@DNHF>)H?@)LBPB?F)RDA):>NL)A>NOELN) \XO?)2BO)>L)HE<) IJJak)7B?HPB)>L)HE<)IJKIk)"B)>L)HE<)IJKKk)XD)>L)HE<)IJKIk)2BH?FO_DSH)>L)HE<)IJJb] <)"DL)HEE)DR) L M>N>)THT>AN)ON>@)PDON>)>P:A;D?BQ)NL>P)Q>EEN)HN)LM>BA)Q>EE)DR)B?L>A>NL=)ND)G>)RBANL)MH@)LD) @>L>APB?>)LM>)B@>HE)QD?@BLBD?N)RDA)LM>N>)NPHEE)PDE>QOE>N)B?)5&)P$%,N<) ) &M>)PDNL)QDPPD?)PD@BRB>A)DR) 5?L ) NBF?HEB?F)BN)2BLMBOP),MEDAB@>=)2B,E<)!L)MHN):>>?) >CL>?NBS>E;)ON>@)B?):BTDEHA)@BNDA@>A)\943])LA>HLP>?L)RDA)DS>A)aJ);>HAN) \,H@>)Kfcf] <) &MDOFM)LM>)P>QMH?BN PN):;)GMBQM)BL)DT>AHL>N)HA>)NLBEE)?DL)ROEE;)O?@>ANLDD@=)BL)MHN):>>?) NMDG?)LMHL)2B,E) @BA>QLE;) B?MB:BLN)'NW / 0 " \.E>B?)H?@)7>ELD? ) Kff^k)%LHP:DEBQ=)1O>E=)H?@) 5DD@F>LL)Kff^] <)*DG>S>A=)2B,E)BN)?DL)NT>QBRBQ)RDA)'NW / 0=)A>NOELB?F)B?) DRR / LHAF>L)>RR>QLN ) \4MB>E)H?@).E>B?)IJJK] <)&M>A>RDA>=)G>)@B@)?DL)ON>)2B,E)>CQ>TL)HN)H)QD?LADE)RDA) 5?L ) HQLBSHLBD?<)5>)NDOFML)LD)PD@BR;) 5?L ) PDA>)NT>QBRBQHEE;)ONB?F)(7974=).6 / JIKKK=)H?@) ,HA@BD?DF>? / K<)(7974)HQL BSHL>N) 5?L ) \XO?)2BO)>L)HE<)IJJa] ) GMBE>).6 / JIKKK)H?@) ,HA@BD?DF>? / K):DLM)B?MB:BL)LM>)THLMGH; ) \7B?HPB)>L)HE<)IJKIk)"B)>L)HE<)IJKK] <) ) &D)H?HE;_>)LM>) 5?L ) B?MB:BLDA)NPHEE)PDE>QOE>)HQLBSBL;=)NLH:E>)*$.If0& / -&)Q>EEN) G>A>)ON>@<)&M>)-&)@>?DL>N)LMHL)LM>)Q>EEN)HA>) H) NLH:E>)EB?>)GBLM)EOQBR>AHN>)@DG?NLA>HP)DR) 2$+):B?@B?F)NBL>N<)&M>N>)NBL>N) HA>)?DAPHEE;)OTNLA>HP)DR) 5?L ) LHAF>L)F>?>N)H?@)HA>) HQLBSHL>@)B?)THAL):;)j / QHL>?B?k)LMON=)LM>N>)Q>EEN)A>TDAL)D?) 5?L ) HQLBSHLBD?<)*$.If0& / -&) Q>EEN)G>A>)ON>@)RBANL):>QHON>)LM>;)HA>)>HN;)LD)HNNH;)H?@)LD)@>L>APB?>):HN>)@DNB?F<) !R)

PAGE 31

22 NOQQ>NNROE=)G>)TEH??>@)LD)PDS>)D? LD)$%,N<)&M>)*$.If0& / -& ) Q>EEN)G>A>)LA>HL>@)GBLM) KJP7)2B,E)LD)LOA?)D?) 5?L ) NBF?HEB?F)RBANL)H?@)LM>?)Q>EEN)G>A>)LA>HL>@)GBLM)@BRR>AB?F) QD?Q>?LAHLBD?N)DR)>BLM>A).6 / JIKKK)\K)w7=)KJ)w7=)DA)IJ)w7])DA),HA@BD?DF>? / K)\KJ)w7=) Ka)w7=)DA)IJ)w7]<)()EOQBR>AHN>)HNNH;)GHN) T>ARDAP>@k)HEE)LA>HL>@)QD?@BLBD?N)NM DOE@)MHS>) EDG>A)>CTA>NNBD?)LMH?)LM>) 2B,E) 5?L / HQLBSHL>@) TDNBLBS>)Q D?LADE)\+BFOA>)KJ]<)&MDOFM)LM>) , HA@BD?DF>? / K / LA>HL>@)Q>EEN)Q>ALHB?E;)@B@)?DL)NMDG)LM>)>CT>QL>@)B?MB:BLBD?=)LM>)LGD) EDG>A)@DNHF>N)DR).6 / JIKKK)\K)w7)H?@)KJ)w 7])EDDW>@)TADPBNB?F<) ) ) ) ) ) 2D=FG>" 7] [)2OQBR>AHN>)(NNH;)D?)*$.If0& / -&)Q>EEN)LA>HL>@)HN)NMDG?)D?)C / HCBN<)$AADA) :HAN)@>?DL>)L>QM?BQHE)A>TEBQHL>N<)(EE)HA>)?DAPHEB_>@)LD)A>?BEEH)B?)LM>)NHP>)NHPTE><) ! J KJJJ IJJJ 0JJJ cJJJ aJJJ ^JJJ ">FHLBS>),D?LADE KJP7)2B,E KO7).6/JIKKK KJO7).6/JIKKK IJO7).6/JIKKK KJO7),HA@BD?DF>?/K KaO7),HA@BD?DF>?/K IJO7),HA@BD?DF>?/K 128 %HPTE>

PAGE 32

23 ()SHAB>L;)DR)DLM>A)P>LMD@N)G>A>)HLL>PTL>@)LD)L>NL)LM>)NPHEE ) PDE>QOE>)HQLBSBL;)B?) PDON>)>P:A;D?BQ)NL>P)Q>EEN)H?@)*$.If0&N<)()TEHNPB@)QHEE>@)&-4 / '+4)\(@@F>?>])GHN) ON>@)B?)5&)H?@)3.-)P$%,N<)&-4 / '+4=)GMBQM)BN)NBPBEHA)LD) LM>) A>TDALB?F)B?)*$.If0& / -&) Q>EEN=)MHN)&,+l2$+)TADPDL>AN)OTNLA>HP)DR)H)'+4)A>TDAL>A<)()SBNB:E>)REOD A>NQ>?L)NBF?HE)QH?) :>)D:N>AS>@)GM>?)Q>EEN)MHS>)HQLBSHL>@)j / QHL>?B?<)5>)>CT>QL>@)LD)N>>)A>@OQ>@)'+4)BR) LM>) 5?L ) B?MB:BLDAN)G>A>)GDAWB?F=):OL)LMHL)GHN)?DL)HTTHA>?L)\@HLH)?DL)NMDG?]<)%>AOP / NLHAS>@)5&)P$%,N)G>A>)HEND)NO:Z>QL>@)LD)LM>) 5?L ) B?MB:BLDAN)LD)N>>)BR)N> AOP)B?)LM>) P>@BH)GHN)QD?RDO?@B?F)A>NOELN<)&MDN>)A>NOELN)G>A>)HEND)B?QD?QEONBS>< ) 5&)P$%,N)G>A>)LA>HL>@)GBLM)(7974)HL)JRL)O?LA>HL>@<) 4ADL>B?)GHN)MHAS>NL>@)HRL>A)Ic)H?@)cV)MDOAN)DR)LA>HLP>?L)RDA)>HQM)@DNHF>)H?@)LM>) ?>FHLBS>)QD?LADE<)4AD L>B?)GHN):EDLL>@)RDA)j / QHL>?B?)H?@)TM DNTMDA;EHL>@ / j / QHL>?B?):OL) RHBE>@)LD)NMDG)H?)B?QA>HN>)GBLM)@DNHF>=)LBP>=)DA)>S>?)QDPTHA>@)LD)LM>)?>FHLBS>)QD?LADE ) \@HLH)?DL)NMDG?] <) ) 5>)LOA?>@)DOA)HLL>?LBD?)LD)LM>)B?NOEB?)\4!0.])NBF?HEB?F)GBLM)%, / bf=)26 / Ifc=JJI) H?@)KJ / 3$9,<)%, / bf)HQLBSHL>N)(WL=)GMBQM)TMDNTMDA;EHL>N)RA>>)'NW / 0 ) \XD)>L)HE<)IJKI] <)26 / Ifc=JJI)H?@)KJ / 3$9,)B?MB:BL)4!0.)H?@)(LW=)A>NT>QLBS>E; ) \2BH?FO_DSH)>L)HE<)IJJb] <)&D) O?@>ANLH?@)MDG)LM>N>)PDE>QOE>N)GDAW)B?)5&)P$%,N=)LM>)Q>EEN)G>A>)LA>HL>@)GBLM)%, / bf) LD)D:N>AS>)HQLBSHLBD?)DR)B?NOEB?)NBF?HEB?F<)(@ @BLBD?HEE;=)TKKJh)\B?NOEB?)HQLBSHL>@])Q>EEN) G>A>)LA>HL>@)GBLM)26 / Ifc=JJI)DA)KJ / 3$9,)LD)>CHPB?>)MDG)POQM)B?MB:BLBD?)DQQOAA>@)SBH) G>NL>A?):EDL)RDA)LDLHE)'NW / 0)H?@)TMDNTMDA;EHL>@)'NW / 0<)4MDNTMDA;EHL>@)'NW / 0)NMDOE@) B?QA>HN>)GBLM)%, / bf):OL)@>QA>HN>)GBLM)26 / Ifc= JJI)DA)KJ / 3$9,)LA>HLP>?L<)&DLHE)'NW / 0) NMDOE@)?DL)QMH?F><)+BFOA>N)KK)H?@)KI) >CMB:BL ) LM>)A>NOELN)DR)G>NL>A?):EDLN)RDA)'NW / 0)H?@)

PAGE 33

24 TMDNTMDA;EHL>@)'NW / 0<)+BRL;)PBQADFAHPN)DR)TADL>B?)G>A>)H@@>@)LD)LM>)F>E)RDA)>HQM) NHPTE>)ND)LMHL)A>EHLBS>)QMH?F>N)B?)TMDNTMDA;EHL>@ ) 'NW / 0)G>A>)HTTHA>?L<)%, / bf) HTT>HA>@)LD)B?QA>HN>)4!0.)NBF?HEB?F)NEBFMLE;=):OL)?>BLM>A)KJ / 3$9,)DA)26 / Ifc=JJI) HTT>HA>@ ) LD)B?MB:BL)B?NOEB?)NBF?HEB?F<)7DNL)DR)LM>)Q>EEN)LA>HL>@)GBLM)KJ / 3$9,)@B>@=) HQQDO?LB?F)RDA)LM>)EHQW)DR):H?@N)B?)PDNL)DR)LMDN>)NHPTE>N< ) ) ) ) ) !?)LM>)?>CL)HLL>PTL)LD)ON>)%, / bf=)LM>)(WL)HQLBSHLDA=)5&)P$%,N)G>A>) #&' ) FBS>?)2!+) :OL)LA>HL>@)GBLM)%, / bf<)5>)LMDOFML)LM>)2!+)PBFML):>)QD?RDO?@B?F)LM>)A>NOELN):;) NLBPOEHLB?F)TEOABTDL>?Q;<),>EEN)G>A>)GHNM>@)H?@)R>@)GBLM)?>G)P>@BH)H?@)?>G)%, / bf) 2D=FG>" 7I [)5>NL>A?):EDL)RDA)TMDNTMDA;EHL>@ / 'NW / 0)D?)4!0.)HQLBSHLDAN)H?@)B?MB:BLDAN< ! 2D=FG>" 77 [)5>NL>A?):EDL)RDA)'NW / 0)D?)4!0.)HQLBSHLDAN)H?@)B?MB:BLDAN< !

PAGE 34

25 \:OL)?>S>A)2!+=)>CQ>TL)LM>)QD?LADE])>S>A;)DLM>A)@H;<)4ADL>B?)GHN)QDEE>QL>@)RADP)D?>)G >EE) >S>A;)DLM>A)@H;)LD)@>L>APB?>)+&-)E>S>EN)B?)LM>)Q>EEN)LA>HL>@)GBLM)LM>)(WL)HQLBSHLDA)DS>A) LBP><) +&-)GHN)QMDN>?)HN)H)LHAF>L):>QHON>)HQLBSHL>@)B?NOEB?)NBF?HEB?F)QHON>N)'NW / 0)LD) :>QDP>)TMDNTMDA;EHL>@<)'NW / 0) ?DAPHEE;) TMDNTMDA;EHL>N)+&) H?@)BLN)A>PDSHE)NMDOE@) QHON>)+&-)E>S>EN)LD)ABN> <) ()G>NL>A?):EDL)TAD:B?F)RDA)+&-)GHN)T>ARDAP>@)HN)G>EE)HN):EDLN) RDA)LDLHE)'NW / 0)H?@)TMDNTMDA;EHL>@)'NW / 0)ONB?F)LM>)NHP>)HPDO?L)DR)LDLHE)TADL>B?)RDA) >HQM)NHPTE><)%H@E;=)?D)QMH?F>)GHN)N>>?)B?)+&-)DS>A)LBP>)DA)B ?)TMDNTMDA;EHL>@)'NW / 0) \@HLH)?DL)NMDG?]< ) ) ) ) &MDOFM).6 / JIKKK)N>>P>@)TADPBNB?F)HL)EDG)QD?Q>?LAHLBD?N)B?)*$.If0& / -&)Q>EEN=) BL)RHBE>@)LD)HRR>QL)P$%,N=)DOA)Q>EE)DR)B?L>A>NL<)(EE)DLM>A) 5?L ) H?@)B?NOEB?)NPHEE)PDE>QOE>N) @B@)?DL)NMDG)TADPBNB?F)A>NOELN)B?)H?;)Q>EE)L; T>=)ND)LMBN)P>LMD@DEDF;)GHN)H:H?@D?>@)RDA) LMBN)NLO@;< ) .C@B^9DCAD?="()L>NL>@ ) LM>)POLHL>@)j / QHL>?B?)%00()TEHNPB@)\?DL)LM>)NLH:E>)Q>EE)EB?>])LD):>) QD?RB@>?L)BL)GHN)>CTA>NNB?F=)ONB?F)H)EOQBR>AHN>)HNNH;)H?@)H)G>NL>A?):EDL<)!?)%00( ) j / QHL>?B?=)LM>)00 A@ ) HPB?D)HQB@=)N>AB?>=)BN)QMH?F>@)LD)H?)HEH?B?>=)QA>HLB?F)H)POLHL>@)'NW / 0) TMDNTMDA;EHLBD?)N>UO>?Q><)%B?Q>)'NW / 0)BN)?DL)H:E>)LD)TMDNTMDA;EHL>)LM>)j / QHL>?B?=)LM>) j / QHL>?B?)GBEE)?DL):>)@>FAH@>@)H?@)QH?)HQQOPOEHL>)RHNL>A)H?@)LOA?)D?) 5?L ) F>?>) >CTA>NNBD?)ROALM>A<)*$.If0&)Q>EEN)LAH?NR>QL>@)GBLM)%00()TEHNPB@)G>A>)QDPTHA>@)HFHB?NL) *$.If0&)Q>EEN)LAH?NR>QL>@)GBLM)T,('$")HN)H)?>FHLBS>)QD?LADE)\+BFOA>)K0]<)&MBN)LBP>)LM>) EOQBR>AHN>)QD?NLAOQL)%OT>A&-4+EHNM)GHN)OLBEB_>@<)%OT>A&-4+EHNM)BN)H)j / QHL>?B?)A>TDA L>A) RDA)EOQBR>AHN>)HNNH;k)BL)MHN)V)&,+l2$+):B?@B?F)NBL>N=)GMBQM)HA>)GMHL)j / QHL>?B?):B?@N)

PAGE 35

26 ?DAPHEE;)LD)TADPDL>) 5?L ) LHAF>L)LAH?NQABTLBD?<)5M>?)j / QHL>?B?):B?@N)LM>N>)NBL>N)B?) %OT>A&-4+EHNM=)EOQBR>AHN>)GBEE):>)>CTA>NN>@)H?@)QH?):>)UOH?LBRB>@<)&MBN)B?@BA>QLE;)NM DGN) GM>LM>A)j / QHL>?B?)MHN):>>?)DS>A>CTA>NN>@<)5>)>CT>QL)j / QHL>?B?)>CTA>NNBD?)LD):>)MBFM) B?)%00()Q>EEN)NB?Q>)BL)QH??DL):>)TMDNTMDA;EHL>@)H?@)@>FAH@>@<) &MBN)GHN)D:N>AS>@< ) ) ) ()G>NL>A?):EDL)GHN)HEND)T>ARDAP>@)D?)LM>N>)*$.If0&)Q>EEN)GBLM)%00()DA)%00()u) +&-)H?@)TAD:>@)RDA)j / QHL>?B?)>CTA>NNBD?)\+BFOA>)Kc]< " &MBN)BN)H)@BA>QL)P>HNOA>)DR)LM>)j / QHL>?B?)>CTA>NNBD?)B?)%00( / LAH?NR>QL>@)Q>EEN<)"DG)LMHL)LMBN)GHN)QD?RBAP >@=)G>)QDOE@) QD?LB?O>)LM>)>CT>ABP>?LN)ONB?F)%00( / LAH?NR>QL>@)Q>EEN)LD)DS>A)>CTA>NN)POLH?L)j / QHL>?B?< ) ) ) 2D=FG>" 7E [)2OQBR>AHN>)(NNH;)D?)*$.If0&)Q>EEN)GBLM)DA)GBLMDOL)LM>)POLHL>@)j / QHL>?B? ) TEHNPB@ = ) %00(< ) $ ! "!!!! #!!!! $!!!! %!!!! &!!!! '!!!! (!!!! )!!!! *!!!! "!!!!! ""!!!! "#!!!! "$!!!! "%!!!! + , -./0121345/367$$89 :;8<=>36-?1/@?A9 BCD + , -./01213EF3:;8<=>

PAGE 36

27 ) &M>)%00()TEHNPB@)QH?):>)LAH?NR>QL>@)B?LD)*$.If0&)Q>EEN)DA)5&)P$%,N=)GMBQM) DRR>AN)LAH?NB>?L)>CTA>NNBD?)DR)LM>)POLHL>@)j / QHL>?B?<)(?DLM>A)P>H?N)LD)LOA?)D?) 5?L ) NBF?HEB?F)PDA>)QD?LB?ODONE;)B?)5&)P$%,N)BN)GBLM)QD?@BLBD?>@)P>@BH)RADP)5?L0H)2 / Q>EEN< $ 2 / Q>EEN)HA>)P DON>)RB:AD:EHNL)Q>EENk)5?L0H)2 / Q>EEN)TAD@OQ>)G?L0H)TADL>B?)H?@)N>QA>L>)BL)LD) LM>)P>@BH<)5?L0H)BN)H)TADL>B?)LMHL)HQLBSHL>N) 5?L ) NBF?HEB?F):;)B?@OQB?F)LM>)HQQOPOEHLBD?) DR)j / QHL>?B?) \*>)>L)HE<)IJKa] <)5>)@>QB@>@)LD)ON>)5?L0H)QD?@BLBD?>@)P>@BH)LD)B?@OQ>) 5?L ) NBF?HEB?F)B?)5&)P$%,N)HN)H?)H@@BLBD?HE)GH;)LD)NLO@;)LM>)>RR>QLN)DR)QD?NLBLOLBS>) 5?L ) NBF?HEB?F<)&HWB?F)LM>)P>@BH)RADP)LM>N>)5?L0H)2 / Q>EEN)\GBLM)G?L0H)TADL>B?)B?)BL])H?@) TEHQB?F)BL)D?)5&)P$%,N)GBEE)HQLBSHL>) 5?L ) NBF?HEB?F<)2 / Q>EEN)\?D? / G?L0H)HQLBSHL>@])G>A>) ON>@)HN)H)QD?LADE<)5?L0H)P>@BH)GHN)QDP:B?>@)B?)H)AHLBD)DR)K[K)GBLM)QDPTE>L>)$%,)P>@BH) H?@)FBS>?)LD)5&)P$%,N)RDA)^)MDOAN<)8?RDALO?HL>E;=)LM>)QD?@BLBD?>@)P>@BH)@B@)?DL) HTT>HA)LD)HQLBSHL>) 5?L ) NBF?HEB?F)GM>?)H)G>NL>A?):EDL)RDA)j / QHL>?B?)GHN)T>ARDAP>@) \+BFOA>)K a]<)7DSB?F)RDAGHA@=)G>)ON>@)5&)P$%,N)LAH?NR>QL>@)GBLM)H?)%00()TEHNPB@)HN) 2D=FG>" 7 UW ) 5>NL>A?):EDL)RDA) j / QHL>?B?)B?)*$.If0&)Q>EEN)LAH?NR>QL>@)GBLM)%00(=)%000() u)+&-=)DA)O?LAH?NR>QL>@)\?>FHLBS>)QD?LADE]< !

PAGE 37

28 LM>) 5?L / HQLBSHL>@)PD@>E<)\!?)NDP>)>CT>ABP>?LN)G>)ON>@)T,(' / @>ELHfJ / '+4=)GMBQM)MHN) LM>)NHP>)%00()POLHLBD?)B?)j / QHL>?B? = ) GBLM)LM>)H@@BLBD?)DR)'+4)RONBD?<] $ ) #;@DJB@D?=",?@"B?K"+J>G>YHG>CCD?="2&+ " %B?Q>)LM>)F>?>LBQ)@>E>LBD?)DR)'NW / 0)H?@)LM>) A>@OQLBD?)DR)P ^ ()LHFN)\SBH)@>QA>HN>@) +&-])A>NOELN)B?)B?@>RB?BL>)TEOABTDL>?Q;=)G>)LMDOFML)LM>)>RR>QLN)DR)>HQM)PBFML)QD?S>AF><) +DEEDGB?F)LMBN)M;TDLM>NBN=)G>)>CT>QL)LMHL)H)Q>EE)GBLM)H)POLH?L)j / QHL>?B?)GBEE)B?QA>HN>) 5?L ) >CTA>NNBD?):>QHON>)LMBN)POLHLBD?)@BNAOTL N)LM>)'NW / 0)TMDNTMDA;EHLBD?)N>UO>?Q>=) P>H?B?F)BL)QH??DL):>)TMDNTMDA;EHL>@)H?@)@>FAH@>@<)5>)HEND):>EB>S>)LMHL) DS>A>CTA>NNB?F)+&-)B?)LM>)NHP>)Q>EE)GDOE@)ROALM>A)B?QA>HN>) 5?L ) LHAF>L)>CTA>NNBD?):;) A>PDSHE)DR)P ^ ()LHFN)RADP) 5?L ) LAH?NQABTLN<)5>)RDO?@)LMHL)LM>)@OH E)DS>A>CTA>NNBD?)DR) +&-)H?@)POLH?L)j / QHL>?B?)B?QA>HN>@)D?>) 5?L ) LHAF>L)F>?>=)76,=):OL)?DL)%-YKb)DA) 76,"=)LMDOFM) HEE)HA> ) 5?L ) DA)TEOABTDL>?Q; ) LAH?NQABTLN <)%-YKb)>CTA>NNBD?)GHN)B?QA>HN>@) LM>)FA>HL>NL)GBLM)POLH?L)j / QHL>?B?)HED?><)76,")GHN)HQLOHEE;)@>QA>HN>@):;) LM>)H@@BLBD?) " 2D=FG>" 7X [)5>NL>A?)9EDL)RDA)j / QHL>?B?)LMHL)@D>N)?DL)HTT>HA)LD)NMDG)B?QA>HN>@) >CTA>NNBD?)DR)j / QHL >?B?)B?)Q> EEN)B?)5?L0H)QD?@BLBD?>@)P>@BH)HN)QDPTHA>@)LD)LM>)2 / Q>EE) P>@BH=)H)?>FHLBS>)QD?LADE< )

PAGE 38

29 DR)+&-)GBLM)POLH?L)j / QHL>?B?)GMBE>)76,)>CTA>NNBD?)@B@)?DL)B?QA>HN>)GBLM)POLH?L)j / QHL>?B?)HED?>)\+BFOA>N)K^=)Kb=)KV]<)"D?>)DR)LM>N>)QHN>N)NMDG>@)LM>)NBF?BRBQH?L) DS>A>CTA>NNBD?)DR)LM>) 5?L ) LHAF>L)F>?>N)LMHL)G>)H?LBQBTHL>@=)FBS>?)LM>)EOQBR>AHN>)HN NH;) A>NOELN)RDA)j / QHL>?B?)DS>A>CTA>NNBD?)\+BFOA>)K0]< ) ) ) ) 2D=FG>" 7Z [)U4,1)@HLH)NMDGB?F)%-YKb ) >CTA>NNBD?)OT)B?)%00() :OL)?DL)%00() u)+&-) P$%,N <)$AADA):HAN)A>TA>N>?L)L>QM?BQHE)H?@) :BDEDFBQHE)A>TEBQHL>N<) $ J J" 7N [)U4,1)@HLH)NMDGB?F) 76, ) >CTA>NNBD?)OT)B?)%00()u+&-)P$%, N <)$AADA):HAN) A>TA>N>?L)L>QM?BQHE)H?@) :BDEDFBQHE)A>TEBQHL>N< $ J J
PAGE 39

30 ) ) %B?Q>)G>)NHG)@BRR>A>?L)A>NOELN)GBLM)A>NT>QL)LD)LM>)%OT>A&-4+EHNM)A>TDAL>A) \+BFOA>)K0])H?@)LM>)>?@DF>?DON)F>?>)>CTA>NNBD?)GBLM)LM>)j / QHL>?B?)%00()TEHNPB@) \+BFOA>N)K^=)Kb=)KV]=)G>)@>QB@>@)LD)ON>)H)POLH?L / j / QHL>?B?)NLH:E>)Q>EE)EB?>)PDSB?F) RDAGHA@=)AHLM>A)LMH? ) QD?LB?OB?F)GBLM)LM>)POLH?L)j / QHL>?B?)TEHNPB@)B?)H)LAH?NB>?L) LAH?NR>QLBD?)HN)LMBN)QDOE@):>)HRR>QLB?F)LM>)A>NOELN< ) ) 8NB?F)LM>)NLH:E>)%00()Q>EE)EB?>=)+&-)GHN)DS>A>CTA>NN>@)H?@)H)G>NL>A?):EDL)GHN) T>ARDAP>@)GBLM)+&-)H?LB:D@;<)-S>A>CTA>NNBD?)GHN)RDO?@<)&MBN)GHN ) QDPTHA>@)HFHB?NL)H?) %00()Q>EE)LAH?NR>QL>@)GBLM)LM>)>PTL;)S>QLDA)T,('$")\?>FHLBS>)QD?LADE])H?@)5&)Q>EEN) GBLM) +2(' / +&-)W?DG?)LD)DS>A>CTA>NN)\TDNBLBS>)QD?LADE])\+BFOA>)Kf]<)%00()Q>EEN)@D)?DL) MHS>)+&-)DS>A>CTA>NNBD?)NB?Q>)'NW / 0)MHN)?DL):>>?)HEL>A>@=)ND)LM>)>C T>ABP>?LHE)N>L)OT) DR)%00()Q>EEN)GBLM)DS>A>CTA>NN>@)+&-)GBEE)GDAW)LD)H@@A>NN)DOA)M;TDLM>NBN<)U4,1)GHN) T>ARDAP>@)B?)O?LAH?NR>QL>@)Q>EEN)H?@)+&/ DS>A>CTA>NN>@)%00()Q>EEN)HFHB?NL)H)5&)QD?LADE) LD)@>L>APB?>):HNHE)76,)>CTA>NNBD?)B?)LM>N>)Q>EE)L;T>N)H?@)LD)@>L>APB ?>)GM>LM>A) ) 2D=FG>"7 [ [)U4,1)@HLH)NMDGB?F) 76," ) >CTA>NNBD?)OT)B?)%00()Q>EEN):OL)@DG?)GBLM)LM>) H@@BLBD?)DR)+&-<)$AADA):HAN)A>TA>N>?L)L>QM?BQHE)H?@) :BDEDFBQHE)A>TEBQHL>N<) $ J J

PAGE 40

31 B?QA>HNB?F)+&-)>CTA>NNBD?)B?)%00()Q>EEN)GDOE@)HEND)B?QA>HN>)76,)>CTA>NNBD?<)5>) >CT>QL>@)LM>)%00()HED?>)LD)QHON>)H)EHAF>)B?QA>HN>)B?)76,)>CTA>NNBD?)H?@)RDA)+&-) DS>A>CTA>NNBD?)LD)B?QA>HN>)76,)>CTA>NNBD?)>S>?)PDA><)5>)RDO?@)H?)B?QA>HN>)B?)%00()HN) Q DPTHA>@)LD)5&=):OL)LM>)>CT>QL>@)B?QA>HN>)RADP)DS>A>CTA>NN>@)+&-)GHN)?DL)RDO?@) \+BFOA>)IJ]< ) ) ) ) 2D=FG>"7 \ [) 5>NL>A?):EDL)RDA)+&-)LD)QD?RBAP)+&-)DS>A>CTA>NNBD?)B?)%00()Q>EEN<)+2(' / +&-)MHN)H)G>BFML)DR)^b ) W3H<) 2H?>)K)BN)%00()Q>EEN)GBLM)T,('$"=)H)?>FHLBS>)QD?LADE<) 2H?>)I)BN)LM>)%00()Q>EEN)GBLM)+2(' / +&-<)2H?>)0)BN)5&)Q>EEN)GBLM)+2(' / +&-=)H)W?DG?) TDNBLBS>)QD?LADE<) $

PAGE 41

32 ) ()EOQBR>AHN>)HNNH;)GHN)T>ARDAP>@)LD)N>>)BR)LM>)>CTA>NNBD?)DR)+&-)HRR>QLN)LM>) 5?L / A>NTD?NBS>)\j / QHL>?B?])A>TDAL>A)%OT>A&-4+EHNM<)%00()H?@)5&)Q>EEN)G>A>)LAH?NR>QL>@) GBL M)EOQBR>AHN>)\%OT>A&-4+EHNM]=)A>?BEEH)\T12 / %#cJ]=)'+4)\T7(Y / '+4]=)H?@) +"',+($ T,('$")\?>FHLBS>)QD?LADE])DA)T,('$" / +2(' / +&-)\+BFOA>)IK]<)+&-)HTT>HA>@)LD)MHS>)H) PB?DA)>RR>QL)B?)%00()Q>EEN):OL)?>HAE;)?D)j / QHL>?B?)>CTA>NNBD?)GHN)@>L>QL>@)B?)>BLM>A)5&) QD?@BLBD?<)&M>A>RDA>=)LM>N>)A>NOELN)HA>)EHAF>E;)B?QD?QEONBS><) ) 2D=FG>" I] [)U4,1)@HLH)QDPTHAB?F) 76,)>CTA>NNBD?):>LG>>?)5& ) QD?LADE)H?@)%00()Q>EE) GBLM) H?@)GBLMDOL) DS>A>CTA>NN>@)+&-< ) $AADA):HAN)A>TA>N>?L):BDEDFBQHE)H?@)L>QM?BQHE) A>TEBQHL>N< $ J K I 0 c a ^ b 5& %00( %00()u)+&1d 76,

PAGE 42

33 ) .VV>;@"G>YHG>CCD " &D)@>L>APB?>)GM>LM>A)DS>A>CTA>NNBD?)DR)+&-)\H?@)LM>A>RDA>)A>PDSHE)DR)P ^ ()H?@) P ^ ( P ])MHN)H?)>RR>QL)D?)LM>) MHER / EBR> ) DR)P1"()LAH?NQABTLN=)G>)DS>A>CTA>NN>@)BL)B?)5&) P$%,N)H?@)%00() P$%,N <)(QLB?DP;QB? / 3)LA>HLP>?L)GHN)LM>?)ON>@<)&MBN)NLDTN)?>G) LAH?NQABTLBD?=)ND)LMHL)LAH?NQABTLN)B?)LM>)Q>EE)HRL>A)LMBN) LA>HLP>?L) G>A>) TA>THA>@ ) :>RDA>) LA>HLP>?L)H?@)H)MHER / E BR>)QH?):>) QHEQOEHL>@ <))1"()GHN)QDEE>QL>@)HL)LBP>)J)H?@)I)MDOAN) HRL>A)HQLB?DP;QB? / 3)LA>HLP>?L<)U4,1)GHN)T>ARDAP>@)RDA)76,)H?@)G>)>CT>QL>@)LM>) ) 2D=FG>"I 7 [)2OQBR>AHN>)(NNH;)D?)5&)DA)%00()Q>EEN)GBLM)DA)GBLMDOL) DS>A>CTA>NN>@) +&-<) $AADA):HAN)A>TA>N>?L):BDEDFBQHE)H?@)L>QM?BQHE)A>TEBQHL>N< ) J IJJJJ cJJJJ ^JJJJ VJJJJ KJJJJJ KIJJJJ KcJJJJ K^JJJJ KVJJJJ 5&)u)T,('$" %00()u)T,('$" 5&)u)+&%00()u)+&128

PAGE 43

34 B?QA>HN>@)+&-)LD)B?QA>HN>)LM>) MHER / EBR> ) DR) 5?L ) LHAF>LN<)&MBN)GHN)D:N>AS>@)B?)5&)Q>EEN) GBLM)DS>A>CTA>NN>@)+&-=):OL)?DL)%00()Q>EEN)GBLM)DS>A>CTA>NN>@)+&-)\+BFOA>)II]<) ) ) ) &M>)NHP>)F>?>AHE)LA>?@)GHN)RDO?@)RDA)LM>) MHER / EBR> ) DR)$ %119)H?@)"("-'=):DLM) TEOABTDL>?Q;)F>?>N=)B?)%00()Q>EEN)GBLM)LM>)DS>A>CTA>NNBD?)DR)+&-)\+BFOA>N)I0=)Ic]<) ) ) 2D=FG>"I I [)-S>A>CTA>NNBD?)DR)+&-)B?)5&):OL)?DL)%00()Q>EEN) HTT>HAN ) LD ) B?QA>HN>)LM>) MHER / EBR>)DR)76, =)H) 5?L ) LHAF>L)F>?>< $ J JEE)L;T>lLA>HLP>?L 76, J)MDOA I)MDOAN

PAGE 44

35 ) ) ) ) ) ) ) 2D=FG>" IE [)U4,1)@HLH)NMDGB?F)LMHL) $%119 ) MHER / EBR> ) BN)?DL)B?QA>HN>@)GM>?)+&-)BN) DS>A>CTA>NN>@)B?)%00()Q>EEN< $ J J" IU [)U4,1)@HLH)NMDGB?F)LMHL)"("-') MHER / EBR> ) BN)?DL)>CL>?@>@)GBLM)+&-) DS>A>CTA>NNBD?)B?)%00()Q>EEN< $ J J
PAGE 45

36 5>)G>A>)HFHB?)QD?Q>A?>@)LMHL)LM>)LAH?NB>?L)LAH?NR>QLBD?)DR)+&-)GHN)PO@@EB?F) LM>)A>NOELN=)NBPBEHA)LM>)LAH?NB>?L)LAH?NR>QLBD?)DR)LM>)%00()TEHNPB@<)!?)H?)>RRDAL)LD)PDA>) HQQOAHL>E;) NLO@;)LM>)DS>A>CTA>NNBD?)DR)+&-)B?)%00()Q>EEN=)G>)HLL>PTL>@)LD)LAH?N@OQ>) +&-)B?LD)%00()Q>EEN)GBLM)H)SBAON)ND)LMHL)BL)GDOE@):>)NLH:E;)>CTA>NN>@<)#BAHE)HNN>P:E;)QH?) :>)RDO?@)B?)LM>)P>LMD@N)N>QLBD?=):OL):AB>RE;=)H)THQWB?F)TEHNPB@=)>?S>EDT>)S>QLDA=)H?@) LAH?NF> ?>)\T&ABT_ / +&/ 6+4])G>A>)HNN>P:E>@)B?)*$.If0&)Q>EEN)H?@)LM>?)HEEDG>@)LD)B?R>QL) LM>)%00()P$%,N<)&MDOFM)LM>)SBAON)HNN>P:E>@)HN)>CT>QL>@)H?@)6+4)GHN)SBNB:E>=)LM>) LAH?N@OQ>@)Q>EEN)@B@)?DL)>CTA>NN)+&-)HN)H?LBQBTHL>@)GM>?)L>NL>@)GBLM)H)G>NL>A?):EDL<) 5>)>CT>QL>@) LGD):H?@N)D?)H?)+&-):EDL[)D?>)HL)aV)W3H=)GMBQM)BN)LM>)>?@DF>?DON)+&-=) H?@)H?DLM>A):H?@)HL)Va)W3H=)LM>)NB_>)DR)+&-)TEON)6+4)LMHL)GHN)LAH?N@OQ>@<)+BFOA>)Ia) NMDGN)LM>)TDNBLBS>)QD?LADE)GBLM)LGD):H?@N)H?@)LM>)RHBE>@)%00()u)+&-)SBAHE)EH?>)GBLM)D?E;) >?@DF>?DON)+& -)HTT>HAB?F<)7DSB?F)RDAGHA@=)G>)ON>@)LM>)LAH?NB>?L)LAH?NR>QLBD?)DR)+&-) HN)BL)GHN)LM>)D?E;)P>LMD@)HSHBEH:E><) ) $ $

PAGE 46

37 $ 3?@>GB;@D)LM>)>CT>QL>@)>RR>QLN)RADP)DS>A>CTA>NNB?F)+&-)B?) 5?L / HQLBSHL>@)Q>EEN)G>A>) ?DL)D:N>AS>@=)G>)GH?L>@)LD)@>L>APB?>)BR)HQLBSHLB?F)QD?QOAA>?L) 5?L ) H?@)B?NOEB?)NBF?HEB?F) GDOE@)HRR>QL) 5?L ) LHAF>L)F>?>N)PDA>)LMH?)H)NB?FE>)THLMGH;)HED?><)!?NOEB?)NBF?HEB?F)PBFML) MHS>)H)@BA>QL)>RR>QL)D?)P ^ ()LHFN=)H?@)TEOABTDL>?Q;=):>QHON>)HQLBSHL>@)B?NOEB?)NBF?HEB?F) LHAF>LN)'NW / 0)RDA)@>FAH@HLBD?=)P>H?B?F)+&-)E>S>EN)PBFML)ABN>)H?@)A>PDS>)P ^ ()\H?@) P ^ ( P ])LHFN<) 5?L ) NBF?HEB?F)PBFML)MHS>)H?)B?@BA>QL)>RR>QL)D?)P ^ ()LHFN=)HN)BL)N>UO>NL>AN) 'NW / 0<)) ) 5&)Q>EEN)G>A>)LAH?NR>QL>@)ONB?F)T;T,(' / *( / TKKJ / !*)\QD?R>AAB?F)QD?NLBLOLBS>) B?NOEB?)NBF?HEB?F)H?@)H)LAH?NB>?L)RDAP)DR)LM>)>CTA>NNBD?)RDO?@)B?)TKKJh)Q>EEN)\(@@F>?>]]) LD)QD?RBAP)L M>)TEHNPB@eN)TKKJ)DS>A>CTA>NNBD?<)&MBN)GHN)>NLH:EBNM>@)LMADOFM)G>NL>A?) :EDL)GBLM)H?)H?LB:D@;)RDA)LM>)TKKJi<)%00()Q>EEN)G>A>)HEND)LAH?NR>QL>@)GBLM)T;T,(' / *( / TKKJ / !*)H?@)NMDG>@)LM>)>CT>QL>@)DS>A>CTA>NNBD?)DR)TKKJ)SBH)G>NL>A?):EDL<)&M>N>)Q>EE) 2D=FG>" IX [)5>NL>A?)9EDL)RDA)+&-)D?)SBAHE)Q>EEN<)x5&)u)+&-)\#BAHE)\u]]r)BN)LM>)TDNBLBS>) QD?LADE)RDA)LAH?N@OQ>@)Q>EEN<)q%00(u) +2(' / +&-r)H?@)q5 &)u +2(' / +&-r)HA>)LAH?NR>QL>@) Q>EEN)RDA)+&-)TDNBLBS>)QD?LADE<)q%00()u) +2(' / +&-)#BAHEr)BN)LM>)?>GE;)LAH?N@OQ>@)Q>EE) L;T><)&MBN)LAH?N@OQLBD?)@B@)?DL)GDAW=)HN)HTTHA>?L):;)LM>)NB?FE>):H?@)HL)aV)W3H)H?@)?D) EHAF>A):H?@)HL)Va)W3H<)&M>)Va)W3H):H?@)BN)LM>)RONBD?)DR) +&-)GBLM)6+4< !

PAGE 47

38 L;T>N)G>A>)ON>@) B?)LM>)RDEEDGB?F)"H?DNLAB?F)>CT>ABP>?LN)LD)@>L>APB?>)F>?>)>CTA>NNBD?) E>S>EN)DR)P1"(N)?DAPHEE;)\5&])P ^ ( / LHFF>@<) ) 0>?>".YHG>CCDQHON>)DOA)TA>SBDON)HTTADHQM>N)@B@)?DL)TH?)DOL)LD)NLO@;)B?L>AHQLBD?N)HPD?F) 5?L =)B?NOEB?=)H?@)+&-= ) H)?>G)P>LABQ)GHN)?>>@>@<)+DA)LMBN=)G>)ON>@)"H?DNLAB?F<) "H?DNLAB?F)BN)H)SHABHLBD?)D?)PBQADHAAH;<)!L)QDO?LN)F>?>)>CTA>NNBD?):HN>@)D?)P1"() LAH?NQABTLN)H?@)@D>N)?DL)A>UOBA>)Q3"()N;?LM>NBN<)&MBN)BN)BPTDALH?L):>QHON>)BL)A>@OQ>N) LM>)?OP:>A)DR)NL>TN)H?@)LM>A>RDA> ) A>@OQ>N)LM>)L>QM?BQHE)SHABHLBD?)B?)LM>)NHPTE>N=)GMBQM) QH?):>)H)TAD:E>P)GBLM)U4,1<)&MBN)HEEDGN)RDA)@>L>QLBD?)DR)NPHEE)RDE@)QMH?F>N)LMHL)QH?) PDA>)A>EBH:E;):>)HNNBF?>@)LD)HQLOHE)F>?>)>CTA>NNBD?)QMH?F>=)AHLM>A)LMH?)L>QM?BQHE) SHABHLBD?<)(L)BLN)MBFM>NL)DOLTOL=) OT)LD)VJJ)F>?>N)QH?):>)H?HE;_>@)D?)KI)NHPTE>N)HL)D?Q><) &GD)LHAF>L / NT>QBRBQ)TAD:>N=)H:DOL)yaJ):T)>HQM=)HA>)QA>HL>@)RDA)>HQM)F>?>)DR)B?L>A>NL[) D?>)BN)LM>)QHTLOA>)TAD:>)H?@)LM>)DLM>A)BN)LM>)A>TDAL>A<)&M>N>=)HED?F)GBLM)LM>)P1"() NHPTE>)H?@):ORR>A=)HA>)AO?)B?)H) LM>APDQ;QE>A)HL)^az,)DS>A?BFML)LD)M;:AB@B_><)&M>)?>CL) @H;=)PHF?>LBQ):>H@N)HA>)ON>@)LD)A>PDS>)O?:DO?@)TAD:>N<)&M>)P1"()DR)B?L>A>NL)HA>) LM>?):DO?@)LD):DLM)LM>BA)QHTLOA>)TAD:>)H?@)LM>BA)A>TDAL>A)TAD:><)&M>)QHTLOA>)TAD:>)MHN) H):BDLB?):>H@)HL)LM>)>?@)H?@)LM>)A> TDAL>A)TAD:>)MHN)H)REODA>NQ>?L):HAQD@>)NT>QBRBQ)LD) LM>)F>?><)&MBN):HAQD@>)BN)PH@>)DR)NBC)NTHQ>N=)>HQM)DR)GMBQM)QH?):>)D?>)DR)RDOA)QDEDAN<) &M>N>)QHTLOA>)TAD:> / P1"( / A>TDAL>A)TAD:>)M;:AB@N)HA>)AO?)DS>A)H)NLA>TLHSB@B? / QDHL>@) NEB@>)ND)LMHL)LM>):BDLB?):>H@)HLLHQ M>@)LD)LM>)QHTLOA>)TAD:>)QH?):B?@)LM>)QHALAB@F><)(?) >E>QLABQ)QOAA>?L)BN)LM>?)AO?)DS>A)LM>)QHALAB@F>)ND)LMHL)HEE)P1"()H?@)TAD:>N)EB>)@DG?)REHL) H?@)B?)LM>)NHP>)@BA>QLBD?)H?@)HA>)LM>?)RBC>@)LD)LM>)QHALAB@F><)&MBN)GH;=)>HQM)REODA>NQ>?L)

PAGE 48

39 :HAQD@>)QH?):>)BPHF>@)B? @BSB@OHEE;) \"H?DNLAB?F)&>QM?DEDFB>N)IJKb] <)&M>)?,DO?L>A {) 7(Y)(?HE;NBN)%;NL>P)HL)LM>)8?BS>ANBL;)DR)(AB_D?H)'>?>LBQN),DA>)+HQBEBL;)GHN)ON>@)LD)AO?) >HQM)QHALAB@F><)3HLH)BN)DOLTOL)HN)AHG)QDO?L)@HLH)RDA)>HQM)F>?><)&M>)@HLH)QH?)LM>?):>) SBNOHEB_>@)GBLM)"H?DNLAB?FeN)?%DES>A|)NDRLGHA><) ) +DA)LM>)TOATDN>)DR)LM>N>)>CT>ABP >?LN=)F>?>N)TA>SBDONE;)RDO?@)LD)MHS>)@>QA>HN>@) P ^ ()P>LM;EHLBD?)B?)3.-)P$%,N)HN)QDPTHA>@)LD)5&)P$%,N)SBH)P ^ ( / N>U)\ +HOE@N)>L)HE<) IJKV=)NO:PBLL>@ ])G>A>)ON>@)B?)"H?DNLAB?F)H?HE;NBN ) HN)G>EE)HN)F>?>N)LMHL)QDOE@)TEH;)H) THAL)B?)LM> ) TADQ>NN>N)G>)HA>)B?S>NLBFHLB?F <) &M>)F>?>N)HA>)EBNL>@):>EDG)B?)&H:E>)K<)&M>) QHTLOA>)TAD:>)N>UO>?Q>)RDA)>HQM)F>?>)DR)B?L>A>NL)BN)EBNL>@)B?)LM>)HTT>?@BC<)&M>)TAD:>N) G>A>)>CTBA>@<)$HQM)NHPTE>)AO?=)B?QEO@B?F)Q>EE)L;T>N=)DS>A>CTA>NNBD?=)H?@)LBP>)QDOAN>) @HLH)HA>)RDO?@)B?)&H:E>)I<),>EE)L;T>N) G>A >) QMDN>?)LMHL)DS>A>CTA>NN>@)@BRR>A>?L) POLHLBD?N)B?) 5?L ) DA)B?NOEB?)NBF?HEB?F)DA)P ^ ()PD@BRB>AN=)B?QEO@B?F[ ) • ! 5&)P$%,N=)HN)H):HN>EB?>)H?@)HN)H)Q>EE)L;T>)RDA)NO:N>UO>?L)LAH?NR>QLBD?) GBLM)PD@BRB>AN)EBNL>@):>EDG ) • ! 'NW / 0)3.-)P$%,N=)GMBQM)QD?R>A)QD?NLBLOLBS>) 5?L ) NBF?HEB?F)\H?@)DLM>A) O?W?DG?)DRR / LHAF>L)>RR>QLN] ) • ! POLHL>@)j / QHL>?B?)\%00()NLH:E>)Q>EEN)DA)}fJ / '+4)LAH?NR>QL>@]=)GMBQM) QH??DL):>)TMDNTMDA;EHL>@):;)'NW / 0=)E>H@B?F)LD)B?QA>HN>@) 5?L ) LHAF>L) F>?>)HQLBSHLBD? ) • ! TKKJh)\NLH:E>)Q>EE)EB?>)DA)TKKJh)LAH?NR>QL>@]=)GMBQM)QD ?R>AN)QD?NLBLOLBS>) B?NOEB?)NBF?HEB?F)HQLBSBL;=)B?MB:BLB?F)'NW / 0=)TDL>?LBHEE;)B?QA>HNB?F)+&-)H?@) @>QA>HNB?F)P ^ ( )

PAGE 49

40 • ! +&-)DS>A>CTA>NNBD?=)GMBQM)GBEE)E>H@)LD)@>QA>HN>@)P ^ ( ) • ! 5&)DA)3.-)Q>EEN)FADG?)GBLMDOL)2!+=)GMBQM)GBEE)E>H@)LD)H)@>QA>HN>)B?) TEOABTDL>?Q;)B?)5&) Q>EEN< ) &B^9>"7 [)(EE)cV)F>?>N)NOAS>;>@)GBLM)"H?DNLAB?F<)'>?>N)GBLM)HNL>ABNW)HA>)ON>@)HN) MDON>W>>TB?F)F>?>N< ! (2.9*a ) ,9Yb ) $%119 ) !3I ) .!& ) 7%2K ) "-&,*K ) %-1&K ) (4, ) ,,"30 ) +&) !743*Ih ) 2$+&6I ) 7&-1 ) "-&,*I ) %-YKb ) 9,2f2 ) ,3cc ) '(43*h ) !1%K ) 2!+ ) 76, ) 4!&YI ) & ) 974c ) ,3YI ) '(&(^ ) !1%I ) 2!+1 ) 76," ) 4-8a+K ) &5!%&Kh ) ,9YK ) 3"3K ) '2!K ) X('I ) 737I ) "-3(2 ) 44(13 ) #$'+9 ) ,9Yc ) $-7$% ) '2!0 ) X8" ) 722I ) "-' ) 142ch ) 5"&^ ) ) ) &B^9>"I [)(EE)Q>EE)L;T>N)NHPTE>@)B?)"H?DNLAB?F)H?HE;NBN<)(EE)G>A>)AO?)B?)@OTEBQHL>=)>CQ>TL) LMDN>)@>?DL>@)GBLM)hh):>RDA>)NHPTE>)L;T><)+OEE) TEHNPB@)?HP>N)RDA)LAH?NR>QLBD?N)HA>) NMDG?)B?)&H:E>)0< ! (>99"&:H> " &GB?CV>;@D"PAR " 3.-)P$%, ) / ) J ) 3.-)P$%, ) / ) J

PAGE 50

41 &MDOFM)G>)MHS>)N>>?)LMHL)LAH?NB>?L)LAH?NR>QLBD?N)HA>)?DL)B@>HE=)G>) MH@)LD)ON>) LM>P)B?)LMBN)QHN>)LD)DS>A>CTA>NN)POELBTE>)F>?>N<)&D)H@@A>NN)LMBN=)G>)LAH?NR>QL>@)B?)LM>) HRL>A?DD?)H?@)MHAS>NL>@)LM>)1"()LM>)RDEEDGB?F)PDA?B?F)HRL>A)QD?RBAPB?F)GBLM)'+4)LMHL) LM>)LAH?NR>QLBD?)GHN)NOQQ>NNROE<)&MBN)GH;=)>CTA>NNBD?)RADP)LM>)TEHNPB@N) NMDOE@):>)HL)H) MBFM)H?@)TAD@OQB?F)LM>)>RR>QLN)LMHL)G>)NDOFML< ) $HQM)Q>EE)L;T>)B?)&H:E>)I)GHN)LAH?NR>QL>@)B?)LGD):HLQM>N)\:BDEDFBQHE)@OTEBQHL>N]) H?@)TEHL>@)B?LD)RDOA)G>EEN) LDLHE) \L>QM?BQHE)@OTEBQHL>N])HN)NMDG?)B?)&H:E>)0<) TKKJ)@>?DL>N) LM>)TEHNPB@)T;T,(' / *( / T KKJ / !*)H?@)DS>A>CTA>NN>N)TKKJ<)4KKJh)P$%,)A>R>AN)LD)LM>) NLH:E;)>CTA>NNB?F)TKKJh)Q >EE)EB?><)}fJ / '+4)@>?DL>N)T,(' / }fJ / '+4=)GMBQM)BN)H)POLHL>@) RDAP)DR)j / QHL>?B?)LMHL)QH??DL):>)TMDNTMDA;EHL>@lLHAF>L>@)RDA)@>FAH@HLBD?=)LM>)NHP>)HN) %00():OL)GBLM)H)'+4)RONBD?<) +&-)@>?DL>N)T,('$" / +2(' / +&-=)LM>)DS>A>CTA>NNBD?)DR)+&-<) '+4)@>?DL>N)T7(Y / '+4)H?@)GHN)ON>@)LD)SBNOHEB_>)NOQQ>NNROE)LAH?NR>QLBD?)B?)Q>EEN) GBLMDOL)}fJ / '+4<)T,('$")BN)NBPTE;)>PTL;)S>QLDA)H?@)BN)ON>@)ND)LMHL)HEE)Q>EEN)>CT>AB>?Q>) H)LAH?NR>QLBD?)DR)I)PBQADFAHPN)D R)3"(<) &BP>)QDOAN>)NHPTE>N)G>A>)LA>HL>@)GBLM) HQLB?DP;QB? / 3=)GMBQM) NLDTN)?>G)LAH?NQABTLBD?=)ND)LMHL)LAH?NQABTLN)B?)LM>)Q>EE)HRL>A)LMBN) G>A>) LAH?NQAB:>@ ) :>RDA>)LA>HLP>?L)H?@)H)MHER / EBR>)QH?):>) QHEQOEHL>@ < ! 4ADL>B?)GHN)BNDEHL>@)RADP)LGD)G>EEN)\D? >)DR)>HQM):BDE DFBQHE)@OTEBQHL>] ) LD)S>ABR;) DS>A>CTA>NNBD?)RADP)LM>)LAH?NR>QLBD?)GMBE>)1"()GHN)BNDEHL>@)RADP)LM>)DLM>A)LGD)G>EEN) LD)AO?)GBLM)"H?DNLAB?F<)&M>N>)G>A>)LM>):BDEDFBQHE)@OTEBQHL>N<)1"()GHN)UOH?LBRB>@)GBLM) "H?D@ADT)IJJJ)H?@)A> / UOH?LBRB>@)GBLM)dO:BL)HL)LM>)8?BS>AN BL;)DR)(AB_D?H)'>?>LBQN),DA>) +HQBEBL;<)-?>)MO?@A>@)?H?DFAHPN)DR)1"()GHN)AO?)RDA)HEE)LBP>)QDOAN>)H?@) / 2!+)NHPTE>N=) H?@)IJJ)?F)DR)1"()GHN)AO?)RDA)HEE)LAH?NR>QL>@)NHPTE>N<) )

PAGE 51

42 &B^9>"EW ) &AH?NR>QLBD?)NQM>P>)RDA)Q>EEN)O?@>A)"H?DNLAB?F)(?HE;NBN<)TKKJ)@>?DL>N) T;T,(' / *( / TKKJ / !*<)}fJ / '+4)A>TA>N>?LN)T,(' / @>ELHfJ / '+4<)+&-)@>?DL>N)T,('$" / +2(' / +&-<)'+4)B?@BQHL>N)T7(Y / '+4<)T,('$")BN)LM>)>PTL;)S>QLDA< " (>99"&:H> " &GB?CV>;@>K" 69BCQDK"P`=R " &GB?CV>;@>K" 69BCQDK"P`=R " &GB?CV>;@>K" 69BCQDK"P`=R " &GB?CV>;@>K" 69BCQDK"P`=R " 5&)P$%, ) / ) }fJ / '+4)\J<^)wF] ) T,('$")\JQHON>)G>)ON>@):DLM)LBP>)QDOAN>)NHPTE>N)H?@)LAH?NR>QL>@=)?D? / LBP>)QDOAN>) NHPTE>N=)G>)?DG)MHS>)B?RDAPHLBD?)D?)LM>) MHER / EBR> ) DR)>HQM)F>?>)B?)>BLM>A)5&)DA)3.-) P$%,N)HN)G>EE)HN)B?RDAPHLBD?)D?)MDG)>HQM)F>?>)BN)HRR>QL>@):;)HQLBSHLB?F)DA)B?MB:BLB?F) 5?L ) NBF?HEB?F=)B?NOEB?)NBF?HEB?F=)H?@lDA)+&-<)(EE)NHPTE>N)G>A>)?DAPHEB_>@)ONB?F)TDNBLBS>) H?@)?>FHLBS>)QD?LADE)TAD:>N)\"H?DNLAB?F])HN)G>E E)HN)RDOA)MDON>W>>TB?F)F>?>N[)142c=) !743*I=)'(43*=)H?@)&5!%&K<)&M>N>)F>?>N)G>A>)QMDN>?):>QHON>)G>) @B@ ) ?DL)>CT>QL) LM>P)LD):>)PD@OEHL>@):;)H?;)DR)DOA)NHPTE>)L;T>N<)&M>)"H?DNLAB?F)?%DES>A |)NDRLGHA>) GHN)ON>@)RDA)HEE)?DAPHEB_HLBD?N<)()NHPTEB?F)DR)LM>)PDNL)B?L>A>NLB?F)DA)O?>CT>QL>@) RB?@B?FN)BN):>EDG=)NLHALB?F)GBLM)LBP>)QDOAN>)@HLH<) ) ) 5>)RBANL)QA>HL>@)H)M>HL)PHT)LD)SBNOHEB_>)HEE)LBP>)QDOAN>)@HLH<))&MBN)HEEDG>@)ON)LD) QDPTHA>)LM>)@OTEBQHL>)NHPTE >N)H?@)F>L)H?)BPTA>NNBD?)DR)F>?>)>CTA>NNBD?)DS>A)LBP>) \+BFOA>)I^]<)&M>)PDNL)?DLBQ>H:E>)>E>P>?LN)HA>)LMHL)5&)H?@)3.-)@D)B?@>>@)MHS>) @BRR>A>?LBHE)F>?>)>CTA>NNBD?)DS>AHEE)H?@)LMHL)LM>)3.-)HL)LBP>)J)@OTEBQHL>N)HA>)?DL) NBPBEHA<) -?>)DR)LM>)3.-)LBP>) J)NHPTE> N ) HTT >HA>@)LD):>)H?)DOLEB>A):OL)MHN):>>?)B?QEO@>@) B?)HEE)RBFOA>N)RDA)A>R>A>?Q><) )

PAGE 52

43 ) ) ) ) 2D=FG>" IN [)*>HL)PHT)NMDGB?F)LM>)LBP>)QDOAN>)@HLH)RDA)5&)H?@)3.-)P$%,N<)9EHQW) @>?DL>N)@>QA>HN>@)>CTA>NNBD?)GMBE>)GMBL>)@>?DL>N)B?QA>HN>@)>CTA>NNBD?<)&M>)F>?>N) MHS>):>>?)QEONL>A>@ =):OL)NHPTE>N)MHS>):>>?)DA@>A>@)ND)LMHL):BDEDFBQHE)A>TEBQHL>N) HTT>HA)?>CL)LD)>HQM)DLM>A< !

PAGE 53

44 &M>)LBP>)QDOAN>)@HLH)FBS>N)ON)H?)B@>H)H:DOL)LM>)MHER / E BR>)DR)P1"()LAH?NQABTLN)B?) 5&)H?@)3.-)P$%,N)HN)G>EE)HN)F>?>AHE)F>?>)>CTA>NNBD?)E>S>EN):>LG>>?)LM>)LGD)Q>EE) L ;T>N<)5>)>CT>QL>@)LD)RB?@)H?)B?QA>HN>@)MHER / E BR>)B?)LAH?NQABTLN)B@>?LBRB>@)HN):>B?F) @>QA>HN>@)B?)P ^ ()>?ABQMP>?L)B?)3.-)Q>EEN=)NB?Q>)P ^ ()PHAWN)LAH?NQABTLN)RDA)@>FAH@HLBD?<) &M>)RDEEDGB?F)RBFOA>N)NMDG):DLM)@HLH)TDB?LN)RDA)>HQM)N>L)DR):BDEDFBQHE)@OTEBQHL>N)HN)G>EE) HN)H)EB?>HA)EB?>)DR)RBL)DS>A)LBP>=)A>?@>A>@)B?)1)GBLM)FFTEDLI<) ) 5>)>CHPB?>@)SHABH?Q>N)B?)LM>)MHER / E BR>)DR)F>?>N):>LG>>?)LM>)LGD)Q >EE)L;T>N<)+BS>) F>?>N)\974c=)$%119=)+&-=)44(13=)5"&^])MH@)H)@>QA>HN>)B?)MHER / E BR>)B?)3.-)Q>EEN)HN) QDPTHA>@)LD)5&)\+BFOA>)Ib]<)974c=)$%119=)H?@)+&-)HEE)TEH;)H)ADE>)B?)TEOABTDL>?Q;<)\+&-) :>QHON>)BL)A>PDS>N)P ^ ()LHFN=)E>H@B?F)LD)B?QA>HN>@)TEOABTDL>?Q;<])5"&^)H ?@)44(13)HA>) 5?L ) LHAF>LN<)!L)GHN)>CT>QL>@)LMHL)$%119 =)44(13= ) H?@)+&-)GDOE@)MHS>)H)@>QA>HN>@)MHER / E BR>)B?)3.-):>QHON>)DR)LM>)TA>SBDON)RB?@B?F)LMHL)P ^ ()BN)A>@OQ>@) D?)LM>N>)LAH?NQABTLN) B?) 3.-)P$%,N<)*DG>S>A=)B?)LM>)H:N>?Q>)DR)2!+=)3.-) P$%,N ) MH@)EDG>A)>CTA>NNB D?)DR)HEE)a)DR) LM>N>)F>?>N)\+BFOA>)IV]<)974c)MH@)LM>)EHAF>NL)@ADT)GBLMDOL)2!+=)@ADTTB?F):>EDG) >CTA>NNBD?)E>S>EN)B?)5&)GBLM)DA)GBLMDOL)2!+<)5>)QH??DL)NH;)GM>LM>A)LM>)MHER / E BR>)DR)LM>N>) F>?>N)GDOE@):>)LM>)NHP>)DA)@BRR>A>?L)B?) / 2!+)Q>EEN<)+OALM>A)NLO@;)BN)A>U OBA>@)D?)LMBN<) ) '>?>N)GBLM)B?QA>HN>@)DS>AHEE)>CTA>NNBD?)B?)3.-) P$%,N) DS>A)5& ) P$%,N ) HEE) MHS>)H) THAL ) B?) TEOABTDL>?Q;)H?@) @BRR>A>?LBHLBD? ) A>FOEHLBD? [),3YI=)'(&(^=)$-7$%=)%-YKb=)H?@)& ) \+BFOA>)If]<)&MBN)GHN)NDP>GMHL)O?>CT>QL>@=)HN)3.-)Q>EEN)L>?@)LD)A>PHB?)TEOABTDL>?L) >S>?)B?)LM>)H:N>?Q>)DR)2!+<)&MBN)FD>N)MH?@ / B? / MH?@)GBLM)RB?@B?FN)RADP)+BFOA>)Ib=)LM>) @>QA>HN>@)MHER / E BR>)DR)NDP>)TEOABTDL>?Q;)F>?>N)B?)3.-)Q>EEN<)!R)LM>)MHER / E BR>)DR) TEOABT DL>?Q;)F>?>N)BN)NMDAL>A)B?)3.-)Q>EEN=)BL)HTT>HAN)LMHL)3.-)Q>EEN)HA>)OTA>FOEHLB?F)

PAGE 54

45 @BRR>A>?LBHLBD?)F>?>N) GMBE> ) @DG?A>FOEHLB?F)TEOABTDL>?Q;)LAH?NQABTLN<)"DL>)HEND)LMHL)HEE)DR) LM>N>)F>?>N)MH@)H)?>FEBFB:E>)>CTA>NNBD?)E>S>E)B?)5&<)*DG>S>A=)GM>?)FADG?)GBLMDOL)2!+ ) RDA)Kc)@H;N)\q3.-) )) / 2!+r]=)3.-)Q>EEN)MH@)@>QA>HN>@)>CTA>NNBD?)DR)HEE)DR)LM>) @BRR>A>?LBHLBD?)F>?>N)H:DS>)\>CQ>TL),3YI=)GMBQM)BN)W?DG?)LD)MHS>)@>QA>HN>@)P ^ ()B?) 3.-)u)2!+)P$%,N])\+BFOA>)0J]<)3.-) / ) 2!+)Q>EEN)MH@)B?QA>HN>@)>CTA>NNBD?)DR)%-YKb<)&MBN) PBFML)P>H? ) LMHL)2!+)BN)QD?RDO?@B?F)A>NOELN)RDA)F>?>N)LMHL)TEH;)H)ADE>)B?)@BRR>A>?LBHLBD?) A>FOEHLBD?)B?)3.-)Q>EEN<) ) &MA>>)F>?>N)MH@)H) NMDAL>A ) MHER / E BR>)B?)5&)Q>EEN=):OL)H)THLL>A?)GHN)?DL)QE>HA) \+BFOA>)0K]<)!3I)BN)B?SDES>@)B?) 5?L ) NBF?HEB?F)GMBE>)76,")BN)H)TEOABTDL>?Q; ) RHQLDA<) 9DLM)DR) LM>N>)MH@)@>QA>HN>@)P ^ ()LHFN)B?)3.-)Q>EEN<) !3I)>CTA>NNBD?)B?QA>HN>N)B?)5&)FADG?) GBLMDOL)2!+)GMBE>)'2!K)>CTA>NNBD?)@>QA>HN>N)B?):DLM)Q>EE)L;T>N)GBLMDOL)2!+)\+BFOA>)0I]<)() R>G)F>?>N)MH@)NBPBEHA)MHER / E BR>):>LG>>?)LM>)LGD)Q>EE)L;T>N[)(4,=)'2!0 =)H?@).!&)\+BFOA>) 00]<).!&)GHN)RDO?@)LD)MHS>)EDG>A>@)P ^ ()B?)3.-)Q>EEN)TA>SBDONE;=)GMBQM)PHW>N)LMBN) RB?@B?F)O?>CT>QL>@<)9DLM)'2!0)H?@).!&)MH@)B?QA>HN>@)>CTA>NNBD?)B?)5&)FADG?)GBLMDOL) 2!+=)LMDOFM)\+BFOA>)0c]< ) '>?>N)GBLM)@>QA>HN>@)>CTA>NNBD?)B?)3.-)DS>A)5&)@B@)?DL)RDEEDG)H)THLL>A?)HN) LBFMLE;)\+BFOA>)0a]<),9YK=)!3I=)H?@)76,")HA>) 5?L ) F>?>N)GMBE>)LM>)DLM>A)LGD)\3"3K=) '2!K])HA>)?DL<)3"3K)MH@)EDG)>CTA>NNBD?)B?):DLM)Q>EE)L;T>N)H?@)H)ED?F) MHER / EBR> <)76,")MH@) H)NMDAL>A) MHER / EBR> ) B?)5&):OL)MBFM>A)>CTA>NNBD?)F>?>AHEE;=)>S>?)HRL>A)c)MDOAN<)"DL>)LM>) MBFM)DS>AHEE)>CTA>NNBD?)DR),9YK)B?):DLM)Q>EE)L;T>N<) (END)?DL>)LMHL)!3I =)'2!K= ) H?@)76,") G>A>)RDO?@)LD)MHS>)H)NMDAL>A)MHER / EBR>)B?)5&)Q>EEN)HN)G>EE)\+BFOA>)0K]<) *DG>S>A=)B?)LM>) 3.-) / 2!+)Q>EEN=),9YK=)3"3K=)H?@)'2!K)>CTA>NNBD?)GHN)>S>?)EDG>A)LMH?)5&)GBLM)DA)

PAGE 55

46 GBLMDOL)2!+<)!3I)H?@)76,")>CTA>NNBD?)GHN)NBPBEHA)B?):DLM)3.-)GBLM)H?@)GBLMDOL)2!+) \+BFOA>)0^]< ) #>A;)R>G)F>?>N)MH@)NBPBEHA)>CTA>NNBD?)E>S>EN)H?@)MHER / E BR>):>LG>>? ) 3.-)H?@)5&) \+BFOA>)0b]<)&M>;)B?QEO@>)737I=),9Yb=)H?@=)NOATABNB?FE;=)76,<)76,)BN)B?SDES>@)B?) 5?L ) NBF?HEB?F ) H?@)BN)LM>)PHB?)F>?>)DR)B?L>A>NL)G>)G>A>)TA>SBDONE;)ONB?F)LD)HNN>NN) GM>LM>A) 5?L ) LHAF>L)F>?>N)G>A>):>B?F)LAH?NQAB:>@ <)&M>)>CTA>NNBD?)DR)LMBN)F>?>)BN)N BF?BRBQH?LE;) @DG?A>FOEHL>@)B?)3.-)Q>EEN)FADG?)GBLMDOL)2!+=)GMBE>)A>PHB?B?F)A>EHLBS>E;)O?QMH?F>@)B?) 5&)Q>EEN)GBLM)DA)GBLMDOL)2!+)\+BFOA>)0V]<) ) &MA>>)F>?>N)MH@)THALBQOEHAE;)MBFM)>CTA>NNBD?)B?):DLM)Q>EE)L;T>N=)NOFF>NLB?F)LM>A>) BN)?DL)H) NLAD?F) EB?W):>LG>>?)'NW / 0)B?MB:BLBD?)H?@),,"30=)$%119=)H?@)4-8a+K)\+BFOA>) 0f]<)&MBN)BN)B?L>A>NLB?F):>QHON>)$%119)H?@)4-8a+K)HA>)B?SDES>@)B?)TEOABTDL>?Q;k)BL)MHN) :>>?)NMDG?)TA>SBDONE;)LMHL)4-8a+K)BN)?DL)P ^ ( / LHFF>@) \9HLBNLH)>L)HE<)IJKc] <) 5>) TA>SBDONE;)W?>G)LMHL)$%119)MH@)@>QA>HN>@)P ^ ()PHAWN)B?)3.-)Q>EEN) ;>L)BL)MHN)H)NMDAL>A) MHER / EBR>)B?)3.-)B?)LMBN)@HLH<) ) !?)3.-)Q>EEN)FADG?)GBLMD OL)2!+=)$%119)MH@)EDG>A>@) >CTA>NNBD?=)>S>?)PDA>)D?)THA)GBLM)5&<),,"30)>CTA>NNBD?)R>EE):>EDG)5&)>CTA>NNBD?) GM>?)2!+)GHN)?DL)H@PB?BNL>A>@)LD)3.-)Q>EEN<)4-8a+K)>CTA>NNBD?)HEND)@>QA>HN>@)B?)3.-) / 2!+)Q>EEN=):OL)NLBEE)PHB?LHB?>@)H)S>A;)MBFM)>CTA>NNBD?)E>S>E)DR)H ADO?@)0J=JJJ)QDO?LN) \+BFOA>)cJ]<)"D?>LM>E>NN=):DLM)DR)LM>N>)Q>EE)L;T>N)HA>)>P:A;D?BQ)NL>P)Q>EEN=)ND)G>)@D) >CT>QL)TEOABTDL>?Q;)RHQLDAN)LD):>)>CTA>NN>@)MBFME;)B?)LM>P<) ) ) )

PAGE 56

47 %MDAL>A)*HER / 2BR>)B?)3.-) 2D=FG>" IZ [) '>?>N)GBLM)NMDAL>A)MHER / EBR>)B?)3.-)Q>EEN)B?)LBP>)QDOAN>)>CT>ABP>?LN<) (EE ) Q>EEN)G>A>)LA>HL>@)GBLM)2!+<)4DB?LN)@>TBQL)HQLOHE)A>NOELN<)2B?>)BN)H)EB?>HA)EB?>)DR) RBL)DS>A)LBP>< $

PAGE 57

48 ) ) ) 974c=)$%119=)+&-=)"-3(2=)44(13=)5"&^[)5BLM)H?@)5BLMDOL)2!+ 2D=FG>" I[ [)'>?>N)RDO?@)LD)MHS>)H)NMDAL>A)MHER / EBR>)B?)3.-)DS>A)LBP>=)NMDG?)M>A>)B?))))) / 2!+)>CT>ABP>?LN)B?)NHP>)Q>EE)L;T>N< $

PAGE 58

49 ) ) 3BRR>A>?LBHE)'>?>)$CTA>NNBD?[)3.-)8T 2D=FG>"I \ [) '>?>N)GBLM)B?QA>HN>@)>CTA>NNBD?)B?)3.-)Q>EEN)B?)LBP>)QDOAN>) >CT>ABP>?LN<)(EE)Q>EEN)G>A>)LA>HL>@)GBLM)2!+<)4DB?LN)@>TBQL)HQLOHE)A>NOELN<)2B?>)BN)H) EB?>HA)EB?>)DR)RBL)DS>A)LBP>< $

PAGE 59

50 ) ) ,3YI=)'(&(^=)$-7$%=)%-YKb=)&[)5BLM)H?@)5BLMDOL)2!+ 2D=FG>" E] [)'>?>N)RDO?@)LD)MHS>)B?QA>HN>@)>CTA>NNBD?)B?)3.-)DS>A)LBP>=)NMDG?)M>A>) B?) / 2!+)>CT>ABP>?LN)B?)NHP>)Q>EE)L;T>N< $

PAGE 60

51 ) ) %MDAL>A)*HER / 2BR>)B?)5& ) 2D=FG>" E7 [) '>?>N)GBLM)H)NMDAL>A)MHER / EBR>)B?)5&)Q>EEN)B?)LBP>)QDOAN>)>CT>ABP>?LN<)(EE) Q>EEN)G>A>)LA>HL>@)GBLM)2!+<)4DB?LN)@>TBQL)HQLOHE)A>NOELN<)2B?>)BN)H)EB?>HA)EB?>)DR)RBL)DS>A) LBP>< $

PAGE 61

52 ) ) '2!K=)!3I=)76,"[)5BLM)H?@)5BLMDOL)2!+ 2D=FG>" EI [)'>?>N)RDO?@)LD ) MHS>)H)NMDAL>A)MHER / EBR>)B?)5&)DS>A)LBP>=)NMDG?)M>A>)B?) )))) / 2!+)>CT>ABP>?LN)B?)NHP>)Q>EE)L;T>N< )

PAGE 62

53 ) ) %BPBEHA)*HER / 2BR>)B?)9DLM)5&)~)3.2D=FG>" EE [) '>?>N)GBLM)NBPBEHA)MHER / EBR>)B?):DLM)Q>EE)L;T>N)B?)LBP>)QDOAN>)>CT>ABP>?LN<) (EE)Q>EEN)G>A>)LA>HL>@)GBLM)2!+<)4DB?LN)@>TBQL)HQLOHE)A>NOELN<)2B?>)BN) H)EB?>HA)EB?>)DR)RBL) DS>A)LBP>< $

PAGE 63

54 ) ) (4,=)'2!0=).!&[)5BLM)H?@)5BLMDOL)2!+ 2D=FG>" EU [)'>?>N)RDO?@)LD)MHS>)NBPBEHA)MHER / EBS>N)B?):DLM)Q>EE)L;T>N)DS>A)LBP>=)NMDG?) M>A>)B?) / 2!+)>CT>ABP>?LN)B?)NHP>)Q>EE)L;T>N< $

PAGE 64

55 ) ) 3BRR>A>?LBHE)'>?>)$CTA>NNBD?[)3.-)3DG? 2D=FG>" EX [) '>?>N)GBLM)@>QA>HN>@)>CTA>NNBD?)B?)3.-)Q>EEN)B?)LBP>)QDOAN>) >CT>ABP>?LN<)(EE)Q>EEN)G>A>)LA>HL>@)GBLM)2!+<)4DB?LN)@>TBQL)HQLOHE)A>NOELN<)2B?>)BN)H) EB?>HA)EB?>)DR)RBL)DS>A)LBP>< $

PAGE 65

56 ) ) 3"3K=),9YI=)'2!K=)!3I=)76,"[)5BLM)H?@)5BLMDOL)2!+))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))) ) ) ) ) ) 2D=FG>" EN [)'>?>N)RDO?@ ) LD)MHS>)@>QA>HN>@)>CTA>NNBD?)B?)3.-)DS>A)LBP>=)NMDG?)M>A>) B?) / 2!+)>CT>ABP>?LN)B?)NHP>)Q>EE)L;T>N< $

PAGE 66

57 ) ) ) %BPBEHA)-S>AHEE)$CTA>NNBD?)4HLL>A?)H?@)2>S>E)B?)9DLM)5&)~) 3.2D=FG>" EZ [) '>?>N)GBLM) NBPBEHA)DS>AHEE)>CTA>NNBD?)THLL>A?)H?@)E>S>E)B?):DLM)Q>EE)L;T>N) B?)LBP>)QDOAN>)>CT>ABP>?LN<)(EE)Q>EEN)G>A>)LA>HL>@)GBLM)2!+<)4DB?LN)@>TBQL)HQLOHE) A>NOELN<)2B?>)BN)H)EB?>HA)EB?>)DR)RBL)DS>A)LBP>< $

PAGE 67

58 ) ) 737I=),9Yb=)76,[)5BLM)H?@)5BLMDOL)2!+ 2D=FG>" E[ [)'>?>N)RDO?@)LD)MHS>)NBPBEHA)>CTA>NNBD?)THLL>A?N)H?@)E>S>E)B?):DLM)Q>EE) L;T>N)DS>A)LBP>=)NMDG?)M>A>)B?) / 2!+)>CT>ABP>?LN)B?)NHP>)Q>EE)L;T>N< $

PAGE 68

59 ) ) *BFM)'>?>)$CTA>NNBD?)B?)9DLM)5&)~)3.2D=FG>" E\ [) '>?>N)GBLM)MBFM)>CTA>NNBD?)E>S>EN)B?) :DLM)Q>EE)L;T>N)B?)LBP>)QDOAN>) >CT>ABP>?LN<)(EE)Q>EEN)G>A>)LA>HL>@)GBLM)2!+<)4DB?LN)@>TBQL)HQLOHE)A>NOELN<)2B?>)BN)H) EB?>HA)EB?>)DR)RBL)DS>A)LBP>< $

PAGE 69

60 ) ) 5>)LOA?>@)DOA)HLL>?LBD?)LD)LM>)LAH?NR>QL>@)Q>EEN=)GMBQM)MHS>)D?>)DA)PDA>) 5?L =) B?NOEB?=)DA)P ^ ()PD@BRB>A<)+BANL=)H)M>HL)PHT)GHN)F>?>AHL>@)\+BFOA>)cK]<)&M>)?%DES>A|) NDRLGHA>)QEONL>A>@)LM>)F>?>N)HN)G>EE)HN)LM>)NHPTE>N)H?@)G>)RDO?@)LMHL)LM>)@OTEBQHL>) NHPTE>N)QEONL>A>@)LDF>LM>A=)B?@BQHLB?F)LM>)@OTEBQHL>N)G>A>)B?)HFA>>P>?L=)>CQ>TL)RDA) \HFHB?])LM>)3.-)LB P>)J)@OTEBQHL>N<) ) &M>) PHB? ) RB?@B?F)B?)LAH?NR>QL>@)Q>EEN)GHN)LMHL)TKKJh)Q>EEN)\B?NOEB?)HQLBSHL>@])GBLM) +&-)DS>A>CTA>NNBD?)\TKKJh)u)+&-])MH@)B?QA>HN>@)>CTA>NNBD?) DR)V)F>?>N) DS>A)?DL)D?E;) TKKJh)Q>EEN=):OL)HEND)PH?;)DA)HEE)DLM>A)Q>EE)L;T>N)\+BFOA>)cI]<)&M>)F>?>N)B?QEO@>),9Yc=) ,,"30=)$%119=)4-8a+K[)5BLM)H?@)5BLMDOL)2!+ 2D=FG>" U] [)'>?>N ) RDO?@)LD)MHS>)MBFM)E>S>EN)DR)>CTA>NNBD?)B?)5&)~)3.-)DS>A)LBP>=) NMDG?)M>A>)B?) / 2!+)>CT>ABP>?LN)B?)NHP>)Q>EE)L;T>N< $

PAGE 70

61 '2!K=)!1%K=)!3I=)X('I=)X8"=)737I=)H?@)"-'<))-R)LM>)LDT)RBS>)'>?>)-?LDEDF;)\'-]) 9BDEDFBQHE)4ADQ>NN)L>APN)RDA)LMBN)FADOT)DR)F>?>N=)0)QD?LHB?)qPDATMDF>?>NBNr ) H?@)I) QD?LHB?)q@BRR>A>?LBHLBD?r)\&H:E>)c]<))"DL>)LMHL)!3I)H?@)737I)HEND)MH@)MBFM)>CTA>NNBD?) E>S>EN)B?)TKKJh)u) j / QHL>?B?)u)+&-)\+BFOA>)cI]< ) 5>)?>CL)EDDW>@)B?LD)LM>)>CTA>NNBD?)TADRBE>N)RDA) F>?>N)GBLM)B?QA>HN>@)>CTA>NNBD?) B?) TKKJh)Q>EEN<)&MBN)B?QEO@>@),,"30) H?@)5"&^=):DLM) 5?L ) F>?>N<)"-')GHN)HEND) OTA>FOEHL>@)B?)LM>N>)Q>EEN)\+BFOA>)c0]<) ) &M>)F>?>N)RDO?@)LD):>)OTA>FOEHL>@)B?)LM>)3.-)LBP>)QDOAN>)@HLH)G>A>)HFHB?) RDO?@)LD):>)OTA>FOEHL>@)B?)3.-)H:DS>)HEE)DLM>A)Q>EE)L;T>N)M>A>[),3YI=)$-7$%=)'(&(^=) %-YKb=)H?@)&)\+BFOA >)cc]<) (EE)RBS>)DR)LM>N>)F>?>N ) HA>)A>EHL>@)LD)@BRR>A>?LBHLBD?) H?@) TEOABTDL>?Q; <)\(FHB?=)LMDOFM=)$-7$%=)'(&(^=)H?@)&)HA>)@DG? / A>FOEHL>@)NBF?BRBQH?LE;)B?) 3.-) / 2!+)Q>EEN)GMBE>)%-YKb)BN)OTA>FOEHL>@)\+BFOA> ) 0J ] ]<)) ) +BFOA>)ca)@BNTEH;N)F>?>N)GBLM)OTA>FOEHLBD?)B?) HEE)LMA>>)P$%,N)PDA>)LMH?)B?)LMHL) P$%,)GBLM)H?;)LAH?NR>QLBD?<) (EE)LMA>>)Q>EE)L;T>N)\ 5&=)3.-=)H?@)TKKJh ] ) MH@)B?QA>HN>@) ,,"30=)76,=)H?@)#$'+9<),,"30)BN)H)A>FOEHLDA)DR)@BRR>A>?LBHLBD?)GMBE>)76,)BN)B?SDES>@) B?) 5?L ) NBF?HEB?F <)(EE)LMA>>)DR)LM>N>)F>?>N)G>A>)RDO?@ ) LD)MHS>)@>QA>HN>@)P ^ ()QD?L>?L)B?) 3.-)P$%,N)TA>SBDONE;<) ) 5&)u)+&-)B?QA>HN>@)LM>)>CTA>NNBD?)DR).!&=)2$+&6I=)H?@)"-3(2)\+BFOA>)c^]<) 2$+&6I) @BA>QLN)E>RL / ABFML)HN;PP>LA;)@>L>APB?HLBD?)DR)DAFH?)N;NL>PN)@OAB?F) @>S>EDTP>?L) GMBE>)"-3(2)BN)H) @BRR>A>?LBHLBD?) A>FOEHLBD? ) LAH?NQABTL ) RDA)>HAE;)>P:A;D?BQ) @>S>EDTP>?L < ) .!& ) BN)B?SDES>@)GBLM)NL>P)Q>EE)TEOABTDL>?Q;)H?@)LOPDABF>?>NBN<) )

PAGE 71

62 2HNLE;=)4-8a+K)>CTA>NNBD?)GHN)HFHB?)RDO?@)LD):>)S>A;)MBFM)B?)HEE)Q>EE)L;T>N=) A>FHA@E>NN)DR)L AH?NR>QLBD?)NLHLON)\+BFOA>)cb]=)NOFF>NLB?F)LM HL)LMBN)F>?>)BN)O?HRR>QL >@):;) H?;)DR)LM>N>)PD@OEHLBD?N=)>CQ>TL)2!+)\+BFOA>) cJ]< ) ) 2D=FG>" U7 [)*>HL)PHT)@>TBQLB?F)@BRR>A>?LBHE)F>?>)>CTA>NNBD?)B?)LM>)LAH?NR>QL>@)Q>EEN<) 9EHQW)P>H?N)EDG>A>@)>CTA>NNBD?)H?@)GMBL>)BN)MBFM>A)>CTA>NNBD?<)'>?>N)H?@)NHPTE>N) MHS>) :>>?)QEONL>A>@< !

PAGE 72

63 ) ) ) '>?>)$CTA>NNBD?)BN)!?QA>HN>@)B?)TKKJh)u)+&) 2D=FG>"UI S" ,D?LB?O>@)D?)?>CL)THF>< )

PAGE 73

64 ) ) ) ) ) ) ) ) ) ) ) ) ) '>?> ) $CTA>NNBD?)BN)!?QA>HN>@)B?)TKKJh)u)+&-=)QD?LB?O>@ ) ) 2D=FG>"UI [)'>?>)>CTA>NNBD?)@HLH)RDA)F>?>N)B?)GMBQM)>CTA>NNBD?)B?)OTA>FOEHL>@)B?) TKKJh)u)+&-)Q>EEN<)4OATE>)@DLN)HA>)HQLOHE)@HLH)\:BDEDFBQHE)@OTEBQHL>N=)>CQ>TL)RDA)TKKJh) H?@)5&)u)j / QHL>?B?)u)TKKJh]<)'AH;):HAN)HA>)HS>AHF>)>CTA>NNBD?):>LG>>?)@OTEBQHL>) NHPTE>N<) )

PAGE 74

65 &B^9>"U [)'>?>)-?LDEDF;)L>APN)RDA)9BDEDFBQHE)4ADQ>NN)RDA)F>?>N)GBLM)MBFM>NL)>CTA>NNBD?) B?)TKKJh)u)+&-)Q>EEN< ) 0+"&>GQ " 3/ " 6 O 4B9F>"PLD@A"2/'"QF9@DH9>"@>C@" ;;@DP:AH?DON)%>TLOP) 7DATMDF>?>NBN ) '-[JJJ0Kcf ) ^<0a)C)KJ / 0 ) "DLDQMDA@) ) 7DATMDF>?>NBN ) '-[JJcVabJ ) ^?>NBN ) '-[JJJ0IJ0 ) KFHLBS>)1>FOEHLBD?)DR)'EBHE) ,>EE)3BRR>A>?LBHLBD? ) '-[JJca^V^ ) KFOEHLBD?)DR)(NLADQ;L>) 3BRR>A>?LBHLBD? ) '-[JJcVbKJ ) K
PAGE 75

66 ) '>?>)$CTA>NNBD?)BN)B?QA>HN>@)B?)TKKJh)Q>EEN 2D=FG>"U E [)'>?>)>CTA>NNBD?)@HLH)RDA)F>?>N)OTA>FOEHL>@)B?)TKKJh)Q>EEN <)4OATE>)@DLN)HA>) HQLOHE)@HLH)\:BDEDFBQHE)@OTEBQHL>N=)>CQ>TL)RDA)TKKJh)H?@)5&)u)j / QHL>?B?)u)TKKJh]<)'AH;) :HAN)HA>)HS>AHF>)>CTA>NNBD?) :>LG>>?)@OTEBQHL>)NHPTE>N<

PAGE 76

67 ) ) '>?>)$CTA>NNBD?)BN)8TA>FOEHL>@)B?)3.-)H?@lDA)3.-)u)+&2D=FG>"U U [)'>?>)>CTA>NNBD?)BN)MBFM>NL)B?)3.-)H?@lDA)3.-)u)+&-)Q>EEN<) 4OATE>)@DLN) HA>)HQLOHE)@HLH)\:BDEDFBQHE)@OTEBQHL>N=)>CQ>TL)RDA)TKKJh)H?@)5&)u)j / QHL>?B?)u) TKKJh]<)'AH;):HAN)H A>)HS>AHF>)>CTA>NNBD?):>LG>>?)@OTEBQHL>)NHPTE>N< !

PAGE 77

68 ) ) ) 8?LAH?NR>QL>@),>EEN)*HS>)*BFM>NL)'>?>)$CTA>NNBD? 2D=FG> " UX [)'>?>)>CTA>NNBD?)BN)MBFM>NL)B?)O?LAH?NR>QL>@)Q>EE)HN)QDPTHA>@)LD)LM>BA) LAH?NR>QL>@)QDO?L>ATHALN <)4OATE>)@DLN)HA>)HQLOHE)@HLH)\:BDEDFBQHE)@OTEBQHL>N=)>CQ>TL) RDA)TKKJh)H?@)5&)u)j / QHL>?B?)u)TKKJh]<)'AH;):HAN)HA>)HS>AHF>)>CTA>NNBD?):>LG>>?) @OTEBQHL>)NHPTE>N< $

PAGE 78

69 ) ) ) '>?>)$CTA>NNBD?)BN)*BFM>NL)B?)5&)u)+&2D=FG>"U N ['>?>)>CTA>NNBD?) BN)MBFM>NL)B?)5&)u)+&-)Q>EEN <)4OATE>)@DLN) HA>)HQLOHE)@HLH) \:BDEDFBQHE)@OTEBQHL>N=)>CQ>TL)RDA)TKKJh)H?@)5&)u)j / QHL>?B?)u)TKKJh]<)'AH;):HAN)HA>) HS>AHF>)>CTA>NNBD?):>LG>>?)@OTEBQHL>)NHPTE>N< !

PAGE 79

70 ) " " 2D=FG>"U Z [) 4-8a+K ) >CTA>NNBD?)BN)MBFM)B?)HEE)Q>EE)L;T>N< ) &M>)EDG>NL) >CTA>NNBD?)BN)B?)TKKJh)u)+&-)Q>EEN=)GBLM)H)QDO?L)DR)bJ=^f^<) 4OATE>)@DLN) HA>)HQLOHE)@HLH)\:BDEDFBQHE)@OTEBQHL>N=)>CQ>TL)RDA)TKKJh)H?@)5&)u)j / QHL>?B?)u)TKKJh]<)'AH;):HAN)HA>)HS>AHF>)>CTA>NNBD?):>LG>>?)@OTEBQHL>) NHPTE>N< $

PAGE 80

71 (5#6&.'"E " " /3%(8%%3+* " -O A)@HLH):>FB?N)LD)O?QDS>A)LM>)O?@>AE;B?F)P>QMH?BNPN)L;B?F)LDF>LM>A)'NW / 0=) 5?L ) H?@)B?NOEB?)NBF?HEB?F=)+&-=)H?@)1"()P>LM;EHLBD?<)3O>)LD)LM>)NBPBEHA)TM>?DL;T>N)DR) 'NW / 0)3.-)P$%,N)H?@)Q>EEN)GBLM)A>@OQ>@)P ^ ()LHFN=)G>)M;TDLM>NB_>@)LMHL)NBF?HEB?F) THLMGH;N) B?L>AHQL B?F)GBLM ) 'NW / 0)HA>)QD?LAB:OLB?F)LD)H)A>@OQLBD?)B?)P ^ ()P>LM;EHLBD?N< ) 5>)QMDN>)LD)RDQON)D?)5?L)H?@)B?NOEB?)NBF?HEB?F):>QHON>)LM>;)H RR>QL):DLM)$%,) TEOABTDL>?Q;)H?@)'NW / 0<) 5>)GH?L>@)LD)N>>)BR)>BLM>A)DA):DLM)THLMGH;N)HEND) HEL>A>@ ) P ^ () E>S>EN)DS>AHEE)DA)B?)H)NO:N>L)DR)F>?>N<) ) 5M>?)B?BLBHEE;)NLO@;B?F)HQLBSHLBD?)DR)LM>N>)THLMGH;N=)G>)RDO?@)LMHL)QOELOAB?F) H?@)LAH?NR>QLBD?)QD?@BLBD?N)?>>@>@)LD):>)DTLBPB_>@)LD)TAD@OQ>)A>EBH:E> =)A>TAD@OQB:E> ) A>NOELN<) %>S>AHE)HTTADHQM>N)G>A>)ON>@ =):DLM)F>?>LB Q)H?@)TMHAPHQDEDFBQHE<) %PHEE) PDE>QOE>)PD@OEHLDAN)H?@)5?L0H)QD?@BLBD?>@)P>@BH)G>A>)H?)B?NORRBQB>?L)P>H?N)RDA) PD@BR;B?F ) PDON>)$%,N<) 5>)RDO?@)LMHL)NLH:E>)Q>EE)EB?>N)G>A>)LM>)PDNL)A>EBH:E>)P>LMD@) H?@)ND) N LH:E>)Q>EEN)EB?>N)G>A>)ON>@)GM>?>S>A)TDNNB:E>)H?@)LAH?NB>?L)LAH?NR>QLBD?N)G>A>) D?E;)ON>@) HN)H? ) H@@BLBD?)LD)H)NLH:E>)POLH?L)Q>EE)EB?><)&MBN)P>H?N)LMHL)NDP>)DR)LM>) "H?DNLAB?F)A>NOELN)HA>):HN>@)D?)H)LAH?NB>?L)LAH?NR>QLBD?=)>S>?)LMDOFM)LMBN)BN)?DL)B@>HE<) *DG>S >A=)LD)DS>A>CTA>NN)LGD)DA)LMA>>)DR)LM>)PD@BRB>AN=)LMBN)GHN)?>Q>NNHA;<) &M>A>)BN) NDP>)>SB@>?Q>)LMHL)LMBN)GHN)B?)B?NORRBQB>?L)P>H?N)LD)PD@BR;)NDP>)LAH?NQABTLN=)FBS>?)LMHL) ,,"30=)76,=)H?@)#$'+9)HEE)MH@)MBFM>NL)>CTA>NNBD?)B?)LM>)NLH:E>)Q>EE)EB?>N)GBLMDOL)H?;) LA H?NR>QLBD?<) )

PAGE 81

72 5>)G>A>)O?H:E>)LD)QD?NLAOQL)H)?DS>E) H?@)NBPTE>) P>LMD@)RDA) @BA>QLE;) >CHPB?B?F) LM>)>RR>QLN) H?@)THLL>A?N) DR)P ^ (<) ) &M>A>RDA>=)G>)ON>@)LM>):>NL)DR)LM>)QOELOAB?F) QD?@BLBD?N=)NLH:E>)Q>EE)EB?>N=) H?@)HQLB?DP;QB? / 3)LA>HLP>?L)LD)>CHPB?>)LM>)>RR>QLN)D?) P1"()NLH:BEBL;=)GMBQM)BN)H?)B?@BA>QL)A>H@DOL)DR)P ^ ()RO?QLBD?)NB?Q>)LM>N>)LHFN)@>QA>HN>) LM>)MHER / EBR>)DR)P1"(<) ) 5>)G>A>)B?L>A>NL>@)B?)GM>LM>A)B?NOEB?)NBF?HEB?F)QDOE@)TEH;)H)ADE>)B?)LMBN)?>LGDAW) :>QHON>)HQLBSHL>@)B?NOEB?)NBF?HEB?F)@>QA>HN>N)Q;LDTEHNPBQ)'NW / 0 ) LMADOFM) TMDNTMDA;EHLBD?<)5>)RDO?@)LMHL)LM>)HQLBSHLBD?)DR)B?NOEB?)NBF?HEB?F)QDOTE>@)GBLM)+&-) DS>A>CTA>NNBD?)B?@>>@)B?QA>HN>@)>CTA>NNBD?)DR)@BRR>A>?LBHLBD? / B?SDES>@)F>?>N<)+OALM>A) A>N>HAQM)BN)?>>@>@)LD)>EOQB@HL>)LMBN)TA>QBN>)THLMGH;)HN)G>EE)HN)@>L>APB?>)BR) LM>)MHER / EBS>N)DR)LM>N>)DA)DLM>A)LAH?NQABTLN)HA>)HEL>A>@)B?)LMBN)Q>EE)L;T><)%B?Q>)B?NOEB?)NBF?HEB?F) TMDNTMDA;EHL>N)'NW / 0=)GMBQM)LM>?)QH??DL)TMDNTMDA;EHL>)+&-=)BL)N>>PN)LMHL)B?NOEB?) NBF?HEB?F)H?@)+&-)DS>A>CTA>NNBD?)HA>)GDAWB?F)B?)THAHEE>E)AHLM>A)LMH?)B?)LM> ) NHP>) THLMGH;<) !?)>S>A;)QHN>) DR)DS>A>CTA>NNBD?)B?)TKKJh)u)+&) \+BFOA>)cI]=)G>)RDO?@)LMHL) TKKJh)u)+&-)MH@)B?QA>HN>@)>CTA>NNBD?)DS>A)LM>)TKKJh)Q>EE)D?)BLN)DG?<) ) +BFOA>N)Ib)H?@)If ) NMDG)H?)B?QA>HN>@)B?)@BRR>A>?LBHLBD?)LAH?NQABTLN)H?@)@>QA>HN>) B?) MHER / EBR> ) DR)TEOABTDL>?Q;)LAH?NQABTLN)B?)3.-)P$%,N<)&MBN)GHN)O?>CT>QL>@<) !L)BN)HEND) HTTHA>?L=)LMDOFM=)LMHL)2!+)BN)QD?RDO?@B?F)NDP>)DA)HEE)DR)DOA)@HLH=)>NT>QBHEE;)GBLM)A>NT>QL) LD)TEOABTDL>?Q;)H?@)@BRR>A>?LBHLBD?)>CTA>NNBD?)E>S>EN<)7B?ON)2!+)>CT>ABP>?LN)RDA)HEE)Q>EE) L;T>N)NMDOE@):>) T>ARDAP>@<) " 76,)>CTA>NNBD?)GHN)RDO?@)LD):>)NBPBEHA):>LG>>?)5&)H?@)3.-)P$%,N)B?)LM>)LBP>) QDOAN>)@HLH<)&MBN)GHN)NOATABNB?F=)FBS>?)LMHL)BL)BN)H)TEOABTDL>?Q;)RHQLDA)H?@)G>)>CT>QL>@)

PAGE 82

73 3.-)Q>EEN)LD)MHS>)H)MBFM>A)>CTA>NNBD?)DR)BL):>QHON>)LM>;)A>PHB? ) TEOABTDL>?L ) B?@>RB?BL>E; <) !?)RHQL=)LMDOFM=)LM>)>CTA>NNBD?)DR)76,)BN)@DG?A>FOEHL>@)QD?NB@>AH:E;)B?)3.-) / 2!+)Q>EEN=) NOFF>NLB?F)LM>A>)BN)H?DLM>A)TB>Q>)LD)LM>)TO__E>)LMHL)MHN);>L)LD):>)O?QDS>A>@<)+OALM>A) A>N>HAQM)BN)?>>@>@)LD)O?QDS>A)LMBN=)W>>TB?F)B?)PB?@)LMH L)3.-)Q>EEN)@D)MHS>)DS>AHAQMB?F) DRR / LHAF>L)>RR>QLN)LMHL)QH??DL):>)LHW>?)B?LD)QD?NB@>AHLBD?)ROEE;<) ) 4-8a+K)MH@)MBFM)>CTA>NNBD?)B?)HEE)Q>EE)L;T>N)NOAS>;>@k)BL)GHN)MBFM>A):;)H?) HS>AHF>)DR)cN)PDA>)LMH?)LM>)?>CL)LGD)MBFM>NL / >CTA>NN>@)F>?>N)\737I)H?@) ,9YK ]<)&MBN)MHN):>>?)TA>SBDONE;)NMDG?)LD)MHS>)?D)P ^ ()LHFN<)&MHL)BN)NOTTDAL>@):;)LMBN) @HLH<)4KKJh)u)+&-)Q>EEN)MH@)LM>)EDG>NL)QDO?L)DR)LMBN)LAH?NQABTL=)GBLM)bJ=^f^)QDO?LN=)NLBEE)H) S>A;)MBFM)HPDO?L)DR)>CTA>NNBD?<) (FHB?=)LMDOFM=)LM>)H@@BLBD?)DR)2!+)BN)EBW>E;)HRR>Q LB?F) LM>N>)?OP:>AN)H?@)NMDOE@):>)A>HNN>NN>@)GBLM) / 2!+)>CT>ABP>?LN<) ) &HW>?)LDF>LM>A=)LM>N>)A>NOELN)NOTTDAL)DOA)?DLBD?)LMHL)'NW / 0=)+&-=)5?L)NBF?HEB?F=) B?NOEB?)NBF?HEB?F=)H?@)P ^ ()1"()P>LM;EHLBD?)HEE)GDAW)LDF>LM>A)B?)NDP>)GH;)LD)A>FOEHL>) F>?>)>CTA>NNBD?)H?@)LBPB?F<) &M>)PBNNB?F)EB?W)QDOE@):>)P ^ ( P ) P>LM;EHLBD?N<)&M>N>) PD@BRBQHLBD?N)PBFML):>)GDAWB?F)B?)QD?Q>AL)GBLM)P ^ ()LD)QD?LADE)LMBN)TA>QBN>)TADQ>NN<) !? / @>TLM)O?@>ANLH?@B?F)DR)LM>N>)T ADQ>NN>N)GBEE)QD?LAB:OL>)NBF?BRBQH?LE;)LD)DOA) O?@>ANLH?@B?F)DR)>TBF>?>LBQ)A>FOEHLBD?)B?)M>HELM;)H?@)@BN>HN>)NLHL>N<) ) " "

PAGE 83

74 (5#6&.'"U " 28&8'."/3'.(&3+*% " ) +OALM>A)QMHAHQL>AB_HLBD?)BN)O?@DO:L>@E;)?>>@>@)LD)>EOQB@HL>)LM>)EB?W):>LG>>?) 'NW / 0)H?@)P ^ (<)&M>)B?MB:BLBD?)D R)'NW / 0)QHON>N)H?)B?QA>HN>)B?)+&-=)GMBQM)A>PDS>N)P ^ () H?@)P ^ ( P <)&M>)RBANL)RDQON) PDSB?F)RDAGHA@) BN)LD)@>L>APB?>)H)P>LMD@)LD)@BRR>A>?LBHL>)P ^ () RADP)P ^ ( P k)QOAA>?L)H?LB:D@B>N) @D)?DL)@BNQABPB?HL>)H?@)LMB?)EH;>A)QMADPHLDFAHTM;)\&2,]) BN)LBP> / QD?NOPB?F)H?@)AH@BDHQLBS>)GDAW)BN)TADMB:BLBS>)B?)PH?;)EH:N=)B?QEO@B?F)DOAN<) ) 9>QHON>)DR)LM>)B?L>A>NLB?F)RB?@B?FN)D?)TKKJh)Q>EEN)GBLM)DS>A>CTA>NN>@)+&-=) HQLB?DP;QB? / 3)LBP>)QDOAN>)>CT>ABP>?LN)D? ) TKKJh)Q>EEN)H?@)TKKJh)u)+&-)Q>EEN)GBEE):>)DR) FA>HL)ON><)%B?Q>)B?NOEB?)NBF?HEB?F)TMDNTMDA;EHL>N)'NW / 0=)GMBQM)LM>?)QH??DL) TMDNTMDA;EHL>)+&-=)BL)N>>PN)LMHL)B?NOEB?)NBF?HEB?F)H?@)+&-)DS>A>CTA>NNBD?)HA>)GDAWB?F) B?)THAHEE>E)AHLM>A)LMH?)B?)LM>)NHP>)THLMGH;<)&MBN ) QDOE@):>)LABQW;)LD)L>NL=):OL)BPTDALH?L) ?D?>LM>E>NN)HN)LM>N>)LGD)TADQ>NN>N)HA>)QD?S>AFB?F)HN)G>)M;TDLM>NB_>@<) ) 1O??B?F)P ^ ( / N>U)D?)DLM>A)Q>EEN)L;T>N=)NOQM)HN)TKKJh)H?@)%00(=)GBEE):>)ON>ROE)LD) @>L>APB?>)@BRR>A>?LBHEE;)P>LM;EHL>@)F>?>N)GBLM)NBF?HEB?F)HQLBSHLB D?<)'NW / 0)3.-)P$%,N) H?@)5&)P$%,N)G>A>)NO:Z>QL>@)LD)P ^ ( / N>U)TABDA)LD)LMBN)NLO@;)H?@)LM>)"H?DNLAB?F)F>?>N) DR)B?L>A>NL)G>A>):HN>@)D?)LM>N>)@BRR>A>?LBHEE;)P>LM;EHL>@)F>?>N<)%B?Q>)'NW / 0)W?DQW / DOL) MHN)TDL>?LBHEE;)?OP>ADON)DRR / LHAF>L)>RR>QLN=)LMBN)Q>EE)L;T>)BN)E> NN)>?EBFML>?B?F)LMH?)Q>EEN) GBLM)H)NT>QBRBQ)NBF?HEB?F)THLMGH;)HQLBSHLBD?<)$CTH?@B?F)P ^ ( / N>U)LD)PDA>)Q>EE)L;T>N)H?@) LM>?)"H?DNLAB?F)LD)QDS>A)PDA>)F>?>N)GBEE)M>ET)?HAADG)@DG?)GMBQM)FADOTN)DR)F>?>N)HA>) :>B?F)P ^ ( ) DA)P ^ ( P) P>LM;EHL>@<)(@@BLBD?HEE;=)BL)GDOE@):>):> ?>RBQBHE)LD)FADG)>HQM)DR)LM>) Q>EE)L;T>N)GBLMDOL)2!+)RDA)Kc)@H;N)HN)TA>SBDONE;)@>NQAB:>@)\X>??BR>A)$F>ENLD?=)4MB>E)EH:])LD)

PAGE 84

75 N>>)BR)LM>A>)BN)H)QMH?F>)B?)TEOABTDL>?Q;)DA)@BRR>A>?LBHLBD?)F>?>)>CTA>NNBD?<)2!+)HTT>HAN)LD) :>)QD?RDO?@B?F)NDP>)DR)LM>)A>NOELN)B?)5&)H ?@)3.-)P$%,N=)>NT>QBHEE;)B?)A>EHLBD?)LD) @BRR>A>?LBHLBD?)H?@)TEOABTDL>?Q;)F>?>N)GMBQM)HA>)DR)FA>HL)B?L>A>NL<) ) +OLOA>)@BA>QLBD?N)GBEE)HEND)B?QEO@>)@>L>APB?B?F)BR)P ^ ()H?@)P ^ ( P ) GDAW)B?)QD?Q>AL)LD) QD?LADE)TEOABTDL>?Q;)H?@)@BRR>A>?LBHLBD?<)!L)BN)TDNNB:E>)LMHL)P ^ ( ) PHAWN)LAH?NQABTLN)RDA) @>FAH@HLBD?)GMBE>)P ^ ( P ) PHAWN)LAH?NQABTLN)RDA)H)ED?F>A) MHER / EBR> ) NOQM)LMHL)@BRR>A>?LBHLBD?) BN)QHA>ROEE;)LBP>@<)5>)GBEE)HEND)N>HAQM)RDA)H?;)DLM>A)P>LM;EHLBD?N)LMHL)PBFML)HEND):>) HQLB?F)B?)LMBN)GH;<) ) 9>QHON>)DOA)NLO@B>N)HA>)TABPHABE;)Q HAAB>@)DOL)B?)PDON>)>P:A;D?BQ)NL>P)Q>EEN=)BL)GBEE) :>)BPTDALH?L)PDSB?F)RDAGHA@)LD)ON>)DLM>A)Q>EE)L;T>N)RADP)@BRR>A>?L)NT>QB>N<)5>)GH?L)LD) @>L>APB?>)BR)LM>)P>QMH?BNP)BN)LM>)NHP>)B?)MOPH?N)DA)DLM>A)NT>QB>N<)*OPH?)+&-)BN)Vbp) QD?N>AS>@)GBLM)PBQ>=):OL)LMHL)@D>N) ?DL)?>Q>NNHABE;)P>H?)LM>)P>QMH?BNP)BN)LM>)NHP><)) &M>A>)BN)DS>AGM>EPB?F)>SB@>?Q>)LMHL)'NW / 0)B?MB:BLBD?)DA)W?DQW / @DG?)TADPDL>N) TEOABTDL>?Q;):OL)HNN>NNB?F)LM>)>RR>QLN)B?)?D? / NL>P)Q>EEN)BN)BPTDALH?L)HN)G>EE<)+OLOA>) >CT>ABP>?LN)GBEE):>)BPT>AHLBS>)LD)PDS>)RADP)H ?)>TBF>?>LBQ)M;TDLM>NBN)LD)@BN>HN>) @BHF?DNLBQN)H?@)LA>HLP>?L<) ) " "

PAGE 85

76 '.2.'.*(.% " " (:>AE>=)*>APH??=)(?@A>HN)9HO>A=)X€AF)%LHTT>AL=)(?@A>HN).BNT>AL=)H?@)1DER).>PE>A<)Kffb<) qj / ,HL>?B?)!N)H)&HAF>L)RDA)LM>)8:BUOBLB? / 4ADL>HNDP>)4HLMGH;P:DZlK^>?)7<=)X>??BR>A)$F>ENLD?=)%AH S;H).HLLOEH=)2>BFM),<)m>B@?>A=)(?LMD?;) 3e!TTDEBLD=)9AH@E>;)5<)3D:E>=)H?@),MABNLDTM>A)X<)4MB>E<)IJKc<)q'>?>)$CTA>NNBD?) 4ADRBEB?F)B?)7DON>)$P:A;D?BQ)%L>P),>EEN)1>S>HEN)'E;QDF>?)%;?LMHN>).B?HN> / 0 / 3>T>?@>?L)&HAF>LN)DR)4MDNTMHLB@;EB?DNBLDE)0 / .B?HN>)H?@)5?Ll9 / ,H L>?B?)%BF?HEB?F) 4HLMGH;N?@D>?)7<=)X>??BR>A)$F>ENLD?=)YBHDZO?)1>?=)1HB:HLHW)3HN=)H?@),MABNLDTM>A)X<) 4MB>E<)IJKa<)q()%BPTE>)H?@)$RRBQB>?L)7>LMD@)RDA)&AH?NR>QLB?F)7DON>)$P:A;D?BQ) %L>P),>EEN)8NB?F)4DE;>LM;E>?BPB?>CQA@AD)X<=)9>?DBL)7DEB?B>=)XB?WHB)5H?F=).O?)dO=)XBHZB?F)mMH?F=)2B?FZB>)2B=)3D??H)7<) 9DOE>;=)>L)HE<)IJKc<)q7^()1"()7D@BRBQHLBD?),D?LADEN),>EE)+HL>)&AH?NBLBD?)B?) 7HPPHEBH?)$P:A;D?BQ)%L>P),>EEN'+;$<+33 ) Ka)\^]<)$EN>SB>A)!? Q<[)bJb  Kf<) @DB[KJPOA>E=)$E>D?DA><)IJKa<)q'E;QDF>?)%;?LMHN>).B?HN> / 0)\'%.0][)1>FOEHLBD?=)(QLBD?N=)H?@) 3BN>HN>NAH?< ) ) ,H@>=)XDM?)+)&A>HLP>?LN)DR)4N;QMDLBQ)$CQBL>P>?LS>AN=)*H?N=)H?@)1D>E)"ONN><)IJKI<)q5?Ll9 / ,HL>?B?)%BF?HEB?F)H?@)3BN>HN>EE=)+)(??)1H?=)3HSB@),DC=) %MOHBEBH?F)2B?=)1D:>AL)9HAA>LLD=)4HLABQW)3)*NO=)YO>:B?F) 5O=)5>?;H?)XBH?F=)H?@)2OQBH?D)()7HAAHRRB?B<)IJK0<)q7OELBTE>C)'>?DP>) $?FB?>>AB?F)8NB?F),1!%41l#,HN)%;NL>PN6"+#6+ ) 00f)\^KIK][)VKf  I0<) @DB[KJ?Q>C< ) ) ,ADNN=)3)(=)3HABD)1<)(E> NNB=)4MBEBT),DM>?=)7BAZH?H)(?@Z>EWDSBQM=)H?@)9ABH?)(<)*>PPB?FN<) Kffa<)q!?MB:BLBD?)DR)'E;QDF>?)%;?LMHN>).B?HN> / 0):;)!?NOEB?)7>@BHL>@):;)4ADL>B?) .B?HN>)9?=)H?@)+)7Q,DAPBQW<)IJJJ<)q3BRR>A> ?LBHE)1>FOEHLBD?)DR)'E;QDF>?) %;?LMHN>).B?HN>)0:>LH):;)!?NOEB?)H?@)5?L)%BF?HEB?F
PAGE 86

77 <,+;"5'(8 ) Iba)\cI][)0Icba  VK<)@DB[KJ=)9<)5<=)%HLBNM)4HL>E=)'>DRRA>;)(<)5DD@=)2BNH).<).DQW>ABL_=)H?@)XHP>N)1<)5DD@F>LL<) IJJb< ) q+O?QLBD?HE)1>@O?@H?Q;)DR)'%. / 0()H?@)'%. / 09)B?)5?Ll9 / ,HL>?B?)%BF?HEB?F) %MDG?):;)8NB?F)H?)(EE>EBQ)%>AB>N)DR)$P:A;D?BQ)%L>P),>EE)2B?>NSQ>E=)9<)5<=)H?@)XHP>N)1<)5DD@F>LL<)IJJ0<)q'%. / 0[ ) &ABQWN)DR)LM>)&AH@>)RDA)H)7OELB / &HNWB?F).B?HN>6"+#6+ ) KK^)\b][)KKba  V^<)@DB[KJ?:>AF=).HA>?),>NHAWHN=)>L)HE<)IJKI<) q&DTDEDF;)DR)LM>)*OPH?) H?@)7DON>)P^()1"()7>LM;EDP>N)1>S>HE>@):;)P^( / %>U)4O:EBNMB?F)'ADOT[)IJK  ^<)@DB[KJKKKKI< ) ) 3O:B?=)3D?HE@)&<=)H?@)1D:>AL)*<)&H;EDA<)Kfba<)q&M>)7>LM;EHLBD?)%LHL>)DR)4DE;)( / ,D?LHB?B?F / 7>NN>?F>A)1"()R ADP),OELOA>@)*HPNL>A),>EENLL=)H?@)'<)9<)7BEEN<)IJJJ<) q4MDNTMDA;EHLBD?)H?@)!?HQLBSHLBD?)DR)'E;QDF>?)%;?LMHN>).B?HN>)0):;)4ADL>B?).B?HN> ) (6"+#6+5 ) fb)\II][)KKf^J  ^a<) @DB[KJENB>)X=)$F>ENLD? =)X>??BR>A)"=)%>@BS;=)2HOAH)X=)7BLQM>EE=)7HLLM>G).=)'HABP>EEH=) %H?ZH?H=).D_EDGNWB=)*H??H=)3‚(E>NNH?@AD=)(?F>ED=)*H?N>?=).BAW),=)9HEN:HOFM=) X>A>P;)2=)4MB>E=),MABNLDTM>A)X<)IJKV<)x'E;QDF>?)%;?LMHN>).B?N> / 0)\'NW / 0])(QLBSBL;) 1>FOEHL>N)P1"()7>LM;EHLBD?)#BH),D?L ADEEB?F)+&-)4ADL>B?)%LH:BEBL;)B?)7DON>) $P:A;D?BQ)%L>P),>EEN<)%O:PBLL>@<) ) ) +BDE=),)X=)()7)7HMA>?MDE_=)6)5H?F=)1)5)1D>NW>=)H?@)4)X)1DHQM<)KfVb<)q+DAPHLBD?)DR) 4ADL>B?).B?HN>)1>QDF?BLBD?)%BL>N):;),DSHE>?L)7D@BRBQHLBD?)DR)LM>)%O:NLAHL><) 7DE>QOEHA)7>QMH?BNP)RDA) LM>)%;?>AFBNLBQ)(QLBD?)DR),HN>B?).B?HN>)!!)H?@)'E;QDF>?) %;?LMHN>).B?HN>)0@lIVIJff0< ) ) +DAQ>=)&MDPHN=)H?@)XHP>N)1<)5DD@F>LL<)IJJf<)q8?BUO>)H?@)-S>AEHTTB?F)+O?QLBD?N)D R) '%. / 0)!NDRDAPN)B?),>EE)3BRR>A>?LBHLBD?)H?@)4ADEBR>AHLBD?)H?@),HA@BDSHNQOEHA) 3>S>EDTP>?L=)%=)H?@)4),DM>?<)IJJK<)q'%.0)&HW>N),>?LA>)%LHF>)7DA>)LMH?)IJ)6>HAN)HRL>A)!LN) 3BNQDS>A;
PAGE 87

78 +O=)6>=)3H?)3DPB?BNNB?B=)'B@>D?)1>QMHSB=)H?@),MOH?)*><)IJKc<)q'>?>)$CTA>NNBD?) 1>FOEHLBD?)7>@BHL>@)LMADOFM)1>S>ANB:E>)P ^ ()1"()7>LM;EHLBD?OEH=)%MH;=)(:>@)(ERHLHM)7H?NDOA=)"BL_H?).DE=)#>AH)*>ANMWDSBL_=)$;HE)4>>A=)"DRHA)7DA=) 6HBA)%)7H?DA=)>L)HE<)IJKa<)qP^()P1"()7>LM;EHLBD?)+HQBEBLHL>N)1>NDEOLBD?)DR)"H ƒ S>) 4EOABTDL>?Q;)LDGHA@)3BRR>A>?LBHLBD?6"+#6+ ) 0cb)\^IIa][)KJJI  ^<) @DB[KJ< KKI^lNQB>?Q>N=),HADE)(<=)H?@)1BQMHA@)%<)XDT><)IJJK<)q&M>)7OELBRHQ>L>@)1DE>N)DR)'E;QDF>?) %;?LMHN>).B?HN>)0j)B?),>EEOEHA)%BF?HEB?F=)%MH=)6B)2O=)YBH)2BO=)YB?)*OH?F=)$SH?)&<).>E E>A=),MHD)"H?)dBH?=)H?@)XBH?)mMH?F<)IJKa<) q5?L0H[)+O?QLBD?N)H?@)!PTEBQHLBD?N)B?),H?Q>A)+O=)YO)mMHD=)dB?F)3HB=)'OH?UO?)mM>?F=)6B?F)6H?F=),M>?FUB)6B=)>L)HE<) IJKK<)q "^ / 7>LM;EH@>?DNB?>)B?)"OQE>HA)1"()!N)H)7HZDA)%O:NLAHL>)DR)LM>)-:>NBL; / (NNDQBHL>@)+&-P:BD<^Vb< ) ) XD=)*<=)%<)7D?@HE=)3<)&H?=)$<)"HFHLH=)%<)&HWB_HGH=)(<).<)%MHAPH=)d<)*DO=)>L)HE<)IJKI<) q%PHEE)7DE>QOE> / !?@OQ>@),;LDNDEBQ)(QLBSHLBD?)DR)4ADL>B?).B?HN>)(WL)1>NQO>N) !NQM>PBH / $EBQBL>@)">OAD?HE)3>HLM6"+#6+5 ) KJf)\I^][)KJaVK  V^<)@DB[KJ=)%M>?F@D?F=)$?@HEWHQM>G)(<)(E>PO=),EHO@BH)7>AL>?N=)$PBE;),D?? ) 'H?LPH?=)XDM?)X<) +HW=)(E@D)7>E>=)9MHFGHLLB>)*HABTHE=)>L)HE<)IJKa<)q()7HZDABL;)DR)P^()1>NB@O>N)(A>)B?) LM>)2HNL)$CD?N=)(EEDGB?F)LM>)4DL>?LBHE)RDA)0g)8&1)1>FOEHLBD?B?=)4)%=)H?@)3)()7>ELD?< ) Kff^<)q()7DE>QOEHA)7>QMH?BNP)RDA)LM>)$RR>QL)DR)2BLMBOP)D?) 3>S>EDTP>?L6"+#6+5$&A$',+$I#"'+*$ >')'+5$&A$B;+("6) ) f0)\K^][)Vcaa  af<)@DB[KJE=)(=),)1>B?MHA@=)5)7).HSH?HOFM=)')(T>EE=)7)()$NQ D:>@D=)H?@)2)&)5BEEBHPN<)Kff^<) q7>P:AH?>)2DQHEB_HLBD?)DR)4MDNTMHLB@;EB?DNBLDE)0 / .B?HN>)!N)%ORRBQB>?L)LD)(QLBSHL>) 7OELBTE>)%BF?HE / &AH?N@OQB?F).B?HN>)4HLMGH;N@Q>?LAHEA>?@>A?L A>_~A>?@>AL;T>„H:NLAHQL< ) ) .DQW>ABL_=)2BNH=)9AH@E>;)3D:E>=)%HLBNM)4HL>E=)H?@)XHP>N)1)5DD@F>LL<)IJJ^<)q'E;QDF>?)

PAGE 88

79 %;?LMHN>).B?HN> / 0 // H?)-S>ASB>G)DR)H?)DS>A / (QMB>SB?F)4ADL>B?).B?HN>@lKbKJJabV< ) ) .DAB?>W=)#EH@BPBA=)"BQW)9HAW>A=)4HLABQ>)X)7DAB?=)3BQW)SH?)5BQM>?=)1D>E)@>)5>F>A=) .>??>LM)5).B?_E>A=)9>AL)#DF>ENL>B?=)H?@)*H?N),E>S>AN<)Kffb<)q,D?NLBLOLBS>) &AH?NQABTLBD?HE)(QLBSHLBD?):;)H)j / ,HL>?B? / &QR),DPTE>C)B?) (4,~ELkNOT~FLk…l…~ELklNOT~FLk),DED?),HAQB?DP H6"+#6+ ) Iba)\a0Jb][)KbVc)24 / KbVb<)MLLT[llNQB>?Q>?Q>PHF?LlIbala0JblKbVc@)"DA@M>BP=)H?@)#HE>A;)(<)4DNT>EDS<)IJJb<) q4MDNTMDB?DNBLB@>)0 / .B?HN>)!?MB:BLDA)26IfcJJI):OL)"DL)%>AOP)5BLM@AHGH E) %OTTA>NN>N)4ADEBR>AHLBD?)DR)7OAB?>)$P:A;D?BQ)%L>P),>EENEE:B=)3HEB)*H?=)YBHD)5H?F=)6>)+O=)2BH?F)mMH?F=)'OBRH?F)XBH=)>L)HE<) IJKc<)q()7$&&20 / 7$&& 2Kc),DPTE>C)7>@BHL>N)7HPPHEBH?)"OQE>HA)1"()"^ / (@>?DNB?>)7>LM;EHLBD?P:BDEE=),MABN).B?L?>A=)%M>?F)3B?F=)H?@)4>L>A)'<)%QMOEL_<)IJJa<)q() %PHEE / 7DE>QOE>)(FD?BNL)DR)LM >)5?L)%BF?HEB?F)4HLMGH;BWD)&HPHB=)H?@)YB)*><)IJKJ<)q5?Llj / ,HL>?B?)%BF?HEB?F[) ,DPTD?>?LN=)7>QMH?BNPN=)H?@)3BN>HN>NSQ>EA=)XH?=)YBHD:B?F)2OD=)(E>CH?@A>)9EH?ZDB>=)YB?RO)XBHD=)(?;H)#<)'AD_MBW=)3>>THW)4<) 4HLBE=)9HNLBH?)2B?@>A=)>L)HE<)IJKb<)q1>S>ANB:E>)7>LM;EHLBD?)DR)P^(P)B?)LM>)ag),HT) ,D?LADEN)P1"()%LH:BEBL;)4O:EBNMB?F)'ADOT[)0bK  ba<) @DB[KJIKJII< ) ) 7Q7H?ON=)$@GHA@)X=).>B)%HWHPDLD=)2HOAH)X)(APBL=)2>HM)1D?HE@ND?=)"HLHEBH)%MTBAD=) 1D@DERD)7HAUO>_=)H?@)3HABD)1)(E>NNB<)IJJa<)q1DE>)&MHL)4MDNTMDA;EHLBD?)DR)'%.0) 4EH;N)B?)!?NOEB?)H?@)5?L)%BF?HEE B?F)3>RB?>@):;).?DQWB?)(?HE;NBNP:DZ;>A=).HL>)3<=)6DF>NM)%HE>LDA>=)4HOE)mOP:D=)-EBSB>A)$E>P>?LD=),MABNLDTM>A)$<)7HND?=) H?@)%HPB>)1<)XHRRA>;<)IJKI<)q,DPTA>M>?NBS>)(?HE;NBN)DR)P1"()7>LM;EHLBD?) 1>S>HEN) $?ABQMP>?L)B?)0g)8&1N)H?@)?>HA)%LDT),D@D?NEE?=)%)-LNOWH=)%).H@DLH=)>L)HE<)IJKI<)q() %PHEE)7DE>QOE>)&MHL)4ADPDL>N),HA@BHQ)3BRR>A>?LBHLBD?)DR)*O PH?)4EOABTDL>?L)%L>P)

PAGE 89

80 ,>EEN)O?@>A)3>RB?>@=),;LDWB?> / ) H?@)Y>?D / +A>>),D?@BLBD?NEA>TEA>T)X<=)(?@A>G)9<)%THAWN=)#EH@BPBA).DAB?>W=)"BQW)9HAW>A=)*H?N),E>S>AN=)9 >AL) #DF>ENL>B?=)H?@).>??>LM)5<).B?_E>A<)Kffb<)q(QLBSHLBD?)DR)j / ,HL>?B? / &QR)%BF?HEB?F)B?) ,DED?),H?Q>A):;)7OLHLBD?N)B?)j / ,HL>?B?)DA)(4,6"+#6+ ) Iba)\a0Jb][)KbVb  fJ<) @DB[KJ?Q>QM?DEDFB>N<)IJKb<)q?,DO?L>A{)(?HE;NBN)%;NL >P)9ADQMOA>Nlf0KalJV0^l^ac0l91†?,DO?L>A%;NL >PN†8%"%†47KJf0†IJKb-QLKVPH=)H?@)+ABL_)7)1DLLPH?<)KfVV<)q(?)B?)#BLAD)%;NL>P)RDA)(QQOAHL>) 7>LM;EHLBD?)DR)!?L>A?HE)(@>?DNB?>)1>NB@O>N)B?)7>NN>?F>A)1"( 6"+#6+ ) IcI) \cVVI][)KKaf  ^I<)@DB[KJ?Q><0KVbacK< ) ) "F=)%>A)%O>=)&DWHP>M)7HMPDO@B=)$NLM>A)3H?>?:>AF=)!?‡N)9>ZHDOB=)5BP)@>)2HO=)*>?@ABW) ,<).DANGHF>?=)7B>W>)%QMOLL>=)H?@)*H?N),E>S>AN<)IJJf<)q4MDNTMHLB@;EB?DNBLDE)0 / .B?HN>)%BF?HEB?F)3D>N)"DL)(QLBSHL> ) LM>)5?L),HNQH@>AAB)&<=)$ABQ)X<)1>EEB?F>A=)(PABLH)7OWM>AZ>>=)%MO;B?F)YB>=)2HOA>?)%L>TM>?N=),OALBN)(<) &MDA?>=).GH?FMD).BP=)>L)HE<)IJKK<)q3BNQDS>AB?F)%PHEE)7DE>QOE>N)&MHL)4ADPDL>) ,HA@BDP;DQ;L>)'>?>AHLBD?):;)7D@OEHLB?F)5?L)%BF?HEB?FP:BDE=)1D>E=)H?@)*H?N),E>S>AN<)IJKb<)q5?Llj / ,HL>?B?)%BF?HEB?F=)3BN>HN>=)H?@)$P>AFB?F) &M>AHT>OLBQ)7D@HEBLB>NEEN)()&MDPND?<)IJJb<)q"H?DF)H?@)&AH?NQABTLB D?HE)">LGDAWN)B?) $P:A;D?BQ)%L>P),>EE)4EOABTDL>?Q;N) RDA)9BDEDFBQHE)%QB>?Q>N=),MB?>N>)(QH@>P;)DR)%QB>?Q>N[)cI  cf<) MLLT[ll@C<@DBE=),MABNLDTM>A)X=)H?@)4>L>A)%).E>B?<)IJJK<)q7DE>Q OEHA)&HAF>LN)DR)2BLMBOP)(QLBD?=)(?LMD?;)4<=)2>BFM),<)m>B@?>A=)(NME>;)7<)(E:A>QML=)(?LMD?;)3e!TTDEBLD=)%BFAB@) $QWHA@L=)3HSB@)$<)">GNDP=)XDH??H)'AD@>?=)>L)HE<)IJKJ<)q4MDNTMHLB@;EB?DNBLDE)0 / .B?HN>)\4!0.])% BF?HEB?F)SBH)'E;QDF>?)%;?LMHN>).B?HN> / 0)\'NW / 0])1>FOEHL>N)3"() 7>LM;EHLBD?)DR)!PTAB?L>@)2DQBE=)()1=)H?@),)1).HM?<)IJJK<)q!?NOEB?)%BF?HEEB?F)H?@)LM>)1>FOEHLBD?)DR)'EOQ DN>)H?@)

PAGE 90

81 2BTB@)7>LH:DEBNP_ / 1BTDEE=)6DEH?@H=)*>HLM>A).<)9D?>=)&DP)-G>?=)(?H)7)#)'O>@>N=)$ENH)(:AH?QM>N=) 9>?ZHPB?).OPTRPO>EE>A=)1OLM)#<)%TABFFN=)3DPB?FDN)*>?ABUO>=)H?@)7>EH?B>)X<) 5>EMHP<)IJK0<)q'E;QDF >?)%;?LMHN>).B?HN> / 0)!?MB:BLBD?)$?MH?Q>N)&AH?NEHLBD?)DR) 4EOABTDL>?Q; / (NNDQBHL>@)&AH?NQABTLBD?)+HQLDAN)LD),D?LAB:OL>)LD)7HB?L>?H?Q>)DR) 7DON>)$P:A;D?BQ)%L>P),>EE)%>ER / 1>?>GHE$0C) V)\c]<) @DB[KJ?L)1O>E=)H?@)XHP>N)1<)5DD@F>LL<)Kff^<)q2BLMBOP)!?MB:BLN)'E;QDF>?) %;?LMHN>).B?HN> / 0)(QLBSBL;)H?@)7BPBQN)5B?FE>NN)%BF?HEEB?F)B?)!?LHQL),>EENEPH?=)#B?Q>?L)+<=)1H@D NEHG)3D:ADGDENWB=)X>H?)2DOBN)4EDOMB?>Q=)2OBN),<)+O>?L>HE:H=) 4>FF;)4<)#DAGHE@=)!GD?H)'OPT>A=)3HSB@)3<)%H:HLB?B=)H?@)$@GHA@)7<)3>)1D:>ALBN<) IJKJ<)q5?L)%BF?HEB?F)1>UOBA>N)%>UO>NLAHLBD?)DR)'E;QDF>?)%;?LMHN>).B?HN>)0)B?NB@>) 7OELBS>NBQOEHA)$?@DNDP>NEEAA;=)%L‡TMH?>=)YO>_M>?)6H?F=)7B?)5>B),M>?=)+AH?QBN)#HQM>ADL=)H?@)1HETM)9OLL;H?<) IJJ^<)q7OELBRHQ>L>@)!?L>AHQLBD?):>LG>>?)LM>)(?@ADF>?)H?@)5?L)%BF?HEB?F) 4HLMGH;N)H?@)LM>)!PTEBQHLBD?)RDA)4ADNLHL>),H?Q>A?F=)6OH?)YO>=)m>;OH?)'OH?=)3>EB?)mMH?F=)mMO)2BO=)mMDO)'D?F=)>L)HE<) IJK^<)q%LAOQLOAHE)9HNBN)DR)"^ / (@>?DNB?>)7>LM;EHLBD?):;)LM>)7$&&20  7$&&2Kc) ,DPTE>CK VIfV< ) ) 5H?F=)YBHD=)mMBW>)2O=)(@ABH?)'DP>_=)'HA;),<)*D?=)6H?H?)6O>=)3HEB)*H?=)6>)+O=)>L)HE<) IJK0<)q"^ / 7>LM;EH@>?DNB?> / 3>T>?@>?L)1>FOEHLBD?)DR)7>NN>?F>A)1"()%LH:BEBL;KIb0J< ) ) 5H?F=)YBHD=)9DCOH?)%BP>?)mMHD=)!H?)(<)1DO?@L A>>=)mMBW>)2O=)3HEB)*H?=)*D?FMOB)7H=) YBHDQM>?F)5>?F=).HB),M>?=)*HBEB?F)%MB=)H?@),MOH?)*><)IJKaH<)q" ^ / 7>LM;EH@>?DNB?>) 7D@OEHL>N)7>NN>?F>A)1"()&AH?NEHLBD?)$RRBQB>?Q;EELM;EH@>?DNB?>)7D@OEHL>N)7>NN>?F>A ) 1"()&AH?NEHLBD?) $RRBQB>?Q;CON< ) ) 5H?F=)6H?F=)6O>)2B=)XOEBH)!)&DLM=)7HLLM>G)3)4>LADNWB=)mMHDE>B)mMH?F=)H?@)XB?F),A;NLHE) mMHD<)IJKc<)q"^ / 7>LM;EH@>?DNB?>)7D@BRBQHLBD?)3>NLH:BEB_>N)3>S>EDTP>?LHE) 1>FOEHLDAN)B?)$P:A;D?BQ)%L>P),>EEN)4O:EBNMB?F) 'ADOT[)KfK  fV<) @DB[KJ
PAGE 91

82 5>B=),MH)7>A=)(EH?)'>ANMDGBL_=)H?@)9>A?HA@)7DNN<)Kfba<)q7>LM;EHL>@)"OQE>DLB@>N) 9EDQW)ag)&>APB?ON)DR)*>2H),>EE)7>NN>?F>A)1"(APB?HE)H?@)!?L>A?HE)7>LM;EHL>@)"OQE> DLB@>)%>UO>?Q>N)B?)*>EH),>EE) P1"(B=),MH)7>A=)H?@)9>A?HA@)7DNN<)Kfbb<)q"OQE>DLB@>)%>UO>?Q>N)HL)LM>)"^ / 7>LM;EH@>?DNB?>)%BL>N)DR)*>2H),>EE)7>NN>?F>A)1B:D?OQE>BQ)(QB@LL=)X)1<)KffJ<)q7DE>QOEHA),ED?B?F)H?@)$CTA>NNBD?)DR)'E;QDF>?)%;?LMHN>).B?HN> / 0lRHQLDA)(?F=)*>)*OH?F=)XDN>)'HAQBH)(:A>O=)H?@)YB)*><)IJJf<)q!?MB:BLBD?)DR)' %.0) 4MDNTMDA;EHLBD?)DR)j / ,HL>?B?)SBH)4MDNTMDA;EHL>@)444%4Y%)7DLBRN)DR)5?L) ,DA>Q>TLDA)214^$0C) c)\0]<)@DB[KJ?F=)YB?=).>BWD)&HPHB=)9AH@E>;)5<)3D:E>=)%MBLHD)2B=)*>)*OH?F=)1H;PD?@)*H:HN=)*>B@B) -WHPOAH=)XHP>N)5DD@F>LL=)H?@) YB)*><)IJJa<)q()3OHE / .B?HN>)7>QMH?BNP)RDA)5?L) ,DA>Q>TLDA)4MDNTMDA;EHLBD?)H?@)(QLBSHLBD?A?F=)'OH?UO?=)XDM?)(A?>)3HME=)6HP>B)"BO=)4>L>A)+>@DAQNHW=),MO?)7B?)*OH?F=),MHAE>N) X<)2B=),HLMAB?>)9<)#‰F:Š=)>L)HE<)IJK0<)q(2.9*a)!N)H)7HPPHEBH?)1"()3>P>LM;EHN>) &MHL)!PTHQLN)1"()7>LH:DEBNP)H?@)7DON>)+>ALBEBL;E
PAGE 92

83 #66.*/3a"#W"%._8.*(.% " 3/&"0 O ^9<;b"%>cF>?;>C " 4KBG ! 4@0$E"',$,&;&3&78$'&$:cF>?;>CS"VG
PAGE 93

84 #HH>?KDY"&B^9>"7W"*B?@CS"B;;>CCDGCS"B?K"C>cF>?;> " Q'*#" @BG=>@ " #;;>CC O DcF>?;> " (2.9*a ) "7†K bIfc0< c ) (,,((&,,&''(&''&,((''((,&(',(,((&''&&,&'(,,&,&&&&',& (('(',(&',,&'&&&',&'''&&',&,,&'&&('',(&(&'&'&'&' ) (4, ) "7†J Jbc^I< 0 ) ,,(&''''&,(&&,,,(('(('((,(&&&'&(((&''((',('('('('& (,&'''&(&,&('(('(',&&'((((('((('(&,(&&(,&,,&&',&'( ) 9,2f2 ) "7†J 0JIa^< I ) ,,,'&&&,,,('',((,, ('(&',((('''&',,,''(&&&''(''&(&' ,('('&(&',,,(&''(('&(,,,(&'((&',,(&',('('(,,&'&((' ) 974c ) "7†J Jbaac< I ) ('(,,,&('&,((,&,&'&&((&&,&('&(&,,,&(('',,&'&&'&'&,,, ,(,&'((,&'('&',,(&&&,,(&'&&'&(,,&''(&'('&(&'(,(( ) ,9YK ) "7†J Jb^II< 0 ) (&(&'&''&''((((('&&,&&'(&,'','('&&'& ,((''',((''&'' ((&(&,&&,&((('&''(('''&&&,&,('(&'(''(,((,(,&&'''(' ) ,9Yc ) "7†J Jb^Ia< I ) ,((''''(,((''',&&'&,(&&&(,&'&'&&,,&&&'(&'&,,,(&'(', (&&'&'',&&(&&&('&,,,,(('&('',,(',&,&,&'&'(,(,(''& ) ,9Yb ) "7†K ccVKK< 0 ) ,&''(,(,,,(,',&,,,,&,(('&'(('&&(,,'&'(,&'(,(&,(,,', ,((,&,,'&,(,,'&,(,,&&,,','('',&,((',,',,'(''',&&, ) ,,"30 ) "7†J Jb^0I< I ) ',,(&'(&''&,('('(((&(,(((,(''&((((&,,(,(,(,,(',(&&& ,&&&&'('&,,,&,&&,&'&,,'''',&,,((,,&&,&,('&&',,((( ) ,3cc ) "7†J JfVaK< I ) &,',&&&'''&'&'&,, &&,',',',&,,,&,,,&,&&(''&,(,&,(,&,&& &,(((',,&''((&(((((,,(,(',,((,&&,,'((',''&,&,(& ) ,3YI ) "7†J Jb^b0< 0 ) ,&'&'&&'&(((&',,('(',,((,,&''(,&&,,&'&,,,&&,,,&,'&,& &&'',&'(('(('(,,''((&&'&&&',&',&'&&,'('&,(,&'(&, ) 3"3K ) "7†K b00V0< I ) &',&(&,,&&('&,((&&,,,(',&&'',(,,('(',&&(,&(&'((&,&&& '&&&&&(&&&''('((,&'',&'((,,((('(',,,&&,,&,,,(,,( ) $-7$% ) "7†J KJK0^< I ) (,&'((((''&,'&&,((''&',&''(&&'(&&,(&&&(&'''(((,'('( ((&'&&,('(((((',('',&(&'(('((,'('&',,,''&',&(&&(( ) $%119 ) "7†J KKf0c< 0 ) '''&&&'''&&'(,(' '(&'&,,&((('(&'((',''&&,(&&,&''((( (&''(,(,',,(,&&&,(&'(,(('&,,&,,'',&&&(,,&',&,&'(&, )

PAGE 94

85 +&) "7†J KKf0^< I ) ,,&(,((,'&'(,&&&',&(((,&&,(&''(&,,&,('(('(&',,,&(,&& '((('(''(',,,&(&&&,'',(&''''(('(&'',''&'(',&'',( ) '(43* ) "7†J JKJJK 0J0
PAGE 95

86 2!+ ) "7†J JVaJK< I ) (,(&,&&&,(,,&''((',(&&'(,&&,,(,,'(',(&('&(''&('&'&' &,&''(,,('('((((('''(&'''',(&&&&',('&&&(&,,('('(' ) 2!+1 ) "7†J JKKK0 0V^
PAGE 96

87 " " " " " " " " " " " 142c ) "7†J IcIKI< c ) (&&,,('('(',(('&('('(,,',(&(&&&,((&(((&,(((,(&'&''& '(,(((,,,&&'&'&'(,&,&&(((&&'&''(&'&&&,,((',,,,&&' ) %-1&K ) "7†J KffbI< I ) ,,&(',,&&&&,&,&&''',('&'&('&('&(&''','(',,(,,,&,(', &,&&&&(&&'',,'''',&(&(((,,(&'',&''',(&((,&(&&,,'( ) %-YKb ) "7†J KKccK< c ) (,&'(',&,,&(''''(''&''(,,',(,''((&&,'((,('&(&,&',, ,&&&'&'&(&((',,,'('(&'''&,&&,,,&(,,('''(,(,'(,&',' ) & ) "7†J Jf0Jf< I ) &,,&,'&,&&,&''&&,&,,'(&'&(&'(('''',&',&(,('&,(,('(, (&&&,&'(,(',,('&(&'(,(,'',,,(((',,&,,&,(&(',,&,'& ) &5!%&K ) "7†J KK^aV< I ) ((&''(,('&,&('('(,&,&''(',&''(&((,&(((((&(((&,&(&(& '(,((('(&&&&,(&''(((&&('(('(',('('(,,(((&&,(,(('( ) #$'+9 ) "7†J KK^fb< I ) '',&'',&'&,&,,, ,&,(,&(&'((((,,,,(((,&&,&(,,((&((,''' (&&&'''&&,&'&&(&'(&((,&'&'(,(,(,(,(,(,(,&,(,(,&, ) 5"&^ ) "7†J JfaI^< 0 ) ,&('(''',,(''(&(&''(('((('&&''&,,&''&('('&&(',(&&& ,('&,&'('&,&(&,(&&,,(,,&'&&(,,(('',(&'(,''('&'(''' )

PAGE 97

88 #66.*/3a"$W"1#&.'3#-%"#*/"1.&5+/% " (>99F9BG"1>KDFQC " L-MNOP@$;+*") ) QD?NBNLN)DR)37$7=)KJp)9'%=)Kp)4>?BQBEEB?)%LA>TLDP;QB?=)H?@)Kp)2 / 'EOLHPB?>< ) <&;:3+'+$-><$.+*") ) QD?NBNLN)DR)37$7=)Kap)+9%=)Kp)4>? / %LA>T=)Kp)2 / 'EOLHPB?>=)Kp) %D@BOP)4;AOSHL>=)Kp)"D? / >NN>?LBHE)(PB?D)(QB@N<)I / P>AQHTLD>LMH?DE)\j / P>])H?@)2!+) G>A>)H@@>@)RA>NM)>HQM)LBP>)\KO2)DR)aaP7)j / P>)T>A)KP2)DR)P>@BH)H?@)KO2)$%'1-)2!+) T>A)KP2)P>@BH]<) ) .cFB@DN„) ) \PHNN)DR)3"()B?)?F])C)\KJJJ)TFl?F]†††††††)))))))))))))))))))) ) ) ) ) ) \v)DR)N>?N>)NLAH?@):T])C)\^aJ)3HELD?N] ) $UOHLBD?)I[ ) ) 0D^CQ^9:"(9CTA>NNBD?)S>QLDA)DR)B?L>A>NL=)T,('$"=)GHN)EB?>HAB_>@)ONB?F)I) w2)DR) $QD1K)A>NLABQLBD?)>?_;P>)\&M>APD+BNM>A)+HNL)3BF>NL]=)IO2)$QD1K)9ORR>A=)I)wF)DR) QBAQOEHA)T,('$"=)H?@)Kc)w2)@* I J=)LD)PHW>)LM>)RB?HE)A>HQLBD?)SDEOP>)IJ)w2<)&M>) @BF>NL)A>HQLBD?)GHN)B?QO:HL>@)HL)0bz,)RDA)Ka)PB?OL>N< )

PAGE 98

89 I< ! ae)TMDNTMHL>)FADOTN)D?)T,('$")G>A>)A>PD S>@)LD)TA>S>?L)TEHNPB@)A>QBAQOEHAB_HLBD?<) K)w2)DR)H?LHAQLBQ)TMDNTMHLHN>)\"$9])GHN)H@@>@)LD)LM>)@BF>NL)A>HQLBD?<)%HPTE>N)G>A>) B?QO:HL>@)HL)0bz,)RDA)Ka)PB?OL>N< ) 0< ! &M>)>RR>QLBS>?>NN)DR)LM>)@BF>NL)A>HQLBD?)GHN)QD?RBAP>@):;)AO??B?F)LM>)@BF>NL>@) TAD@OQL)D?)H)Kp)HF HADN>)Kp)>LMB@BOP):ADPB@>)F>E<)&M>)QBAQOEHA)TEHNPB@)GHN)H@@>@) HN)H)QD?LADE<) ) c< ! (RL>A)SHEB@HLBD?)DR)NOQQ>NNROE)@BF>NLBD?=)LM>)A>PHB?B?F)EB?>HA)TEHNPB@)GHN)TOABRB>@) ONB?F)LM>)d!(UOBQW)'>E)$CLAHQLBD?).BL)RADP)d!('$"< ) a< ! &M>)N;?LM>NB_>@)F9EDQW)F>?>)RAHFP>?LN)\!3&=) N>UO>?Q>N)QD?LHB?>@)B?)(TT>?@BC)(]) G>A>)A>NONT>?@>@)HQQDA@B?F)LD)!3&)TADLDQDE<) ) H< ! &M>)LO:>)GHN)Q>?LABROF>@)RDA)a)N>QD?@N)HL)0JJJ)F<) ) :< ! %L>ABE>)&$):ORR>A)\T*)b@)LD)H)QD?Q>?LAHLBD?)DR)KJ?Flw2<) ) Q< ! %DEOLBD?)GHN)MDPDF>?B_>@):;)SDAL>CB?F)H?@)B?QO:HL>@)HL)a J z ,)RDA)IJ)PB?OL>N<) ) @< ! %HPTE>)GHN)TEHQ>@)D?)BQ>)RDA)BPP>@BHL>)ON><)\$S>?LOHEE;)NLDA>@)HL) / IJz,]< ) ^< ! aJ)?F)DR)EB?>HA)TEHNPB@)H?@)H)0 / RDE@)PDEHA)B?QA>HN>)DR)3"()RAHFP>?LN)QD?LHB?B?F)Ka) :T)DS>AEHTN)G>A>)QDP:B?>@)RDA)LM>)HNN>P:E;)HED?F)GBLM)KJ)w2)'B:ND?)(NN>P:E;) 7H NL>A)7BC)H?@)7BEEB / d)* I J)LD)H)LDLHE)SDEOP>)DR)IJ)w2<)3"()RAHFP>?LN)G>A>) QD?S>AL>@)B?LD)TPDE>N)ONB?F)$UOHLBD?)K<) ) b< ! %HPTE>N)G>A>)B?QO:HL>@)HL)aJz,)RDA)Ka)PB?OL>N<)(RL>A)B?QO:HLBD?=)NHPTE>N)G>A>) BPP>@BHL>E;)TEHQ>@)D?)BQ>)DA)NLDA>@)HL) / IJz,< ) V< ! -?>%MDL)QM>PBQHEE;) QDPT>L>?L)$<)QDEB)Q>EEN)\B?QEO@>@)B?)'B:ND?)(NN>P:E;).BL])G>A>) LAH?NRDAP>@)GBLM)I)w2)DR)HNN>P:E;)A>HQLBD?)\LAH?NRDAPHLBD?)TADLDQDE):>EDG]<)

PAGE 99

90 -S>A?BFML)QOELOA>N)G>A>)PH@>)RADP)QDED?B>N)D?)29)u)Kp)HPTBQBEEB?)TEHL>N<)4EHNPB@N) G>A>)TOABRB>@)SBH)LM>)'>?>X$&)4EHNP B@)7B?BTA>T).BL)\&M>APD)%QB>?LBRBQ])DA)m;TT;) 4EHNPB@)7B?BTA>T).BL)\m;PD])HQQDA@B?F)LD)TADLDQDE<) ) f< ! &D)QD?RBAP)LMHL)RAHFP>?LN)G>A>)NOQQ>NNROEE;)QED?>@)B?LD)T,('$"=)A>NLABQLBD?)@BF>NLN) \&M>APD+BNM>A)+HNL)3BF>NL)A>NLABQLBD?)>?_;P>N])G>A>)T>ARDAP>@=)H?@)TAD@OQLN ) G>A>) AO?)DOL)D?)H)Kp)HFHADN>)Kp)>LMB@BOP):ADPB@>)F>E< ) &GB?CV)SBHE)DR)aJ)w2)-?>%MDL)QM>PBQHEE;)QDPT>L>?L)Q>EEN)G>A>)LMHG>@)D?)BQ><)&GD) PBQADEBL>AN)DR)3"()TEHNPB@)GHN ) H@@>@)H?@)PBC>@):;)F>?LE;)TBT>LLB?F)OT)H?@)@DG?<),>EEN) G>A>)B?QO:HL>@)D?)BQ>)RDA)0J)PB?OL>N<),>EEN)G>A>)M>HL)NMDQW>@)B?)H)GHL>A):HLM)HL)cIz,) RDA)>CHQLE;)ca)N>QD?@N<),>EEN)G>A>)A>LOA?>@)LD)BQ>)RDA)LGD)PB?OL>N)LD)A>QDS>A<)1DDP) L>PT>AHLOA>)%-,)P>@BH)GHN)H@@> @)\caJ)w2])H?@)LM>)LO:>)GHN)B?QO:HL>@)NMHWB?F)RDA)H?) MDOA)HL)0bz,<) 8T)LD)IJJ)w2)DR)LM>)LAH?NRDAPHLBD?)GHN)TEHL>@)D?)H?)29 / H?LB:BDLBQ)HFHA) TEHL>=)NTA>H@)GBLM)FEHNN):>H@N=)H?@)B?QO:HL>@)DS>A?BFML)HL)0bz,<)-S>A?BFML)29)QOELOA>N) G>A>)PH@>)RADP)QDED?B>N)LM>)RDE EDGB?F)@H;<) ) 5.)I\E&"1BQQB9DB?"(>99"&GB?CV>;@DEEN)G>A>)TEHL>@)HL)KEEN)T>A)G>EE)B?)^ / G>EE)TEHL>N)B?)P>@BH)LMHL)BN)aJp) *$.If0&)P>@BH[)aJp)-TLB7$7)A>@OQ>@)N>AOP)P>@BH)\(TT>?@BC)9]<) ) 2. ! 3H;)I[)7>@BH)GHN)?DL)QMH?F>@)B?)^ / G>EE)TEHL>N<)IA>NL)u)IJJ)?F)T7HC / '+4)RDA)SBNOHEB_HLBD?])GHN)H@@>@)LD)KJJ)w2)-TLB / 7$7)T>A) LAH?NR>QLBD?<)"D)3"()GHN)H@@>@)LD)O?LAH?NR>QL>@)QD?LADE)G>EE<)!?)H)N>THAHL>)LO:>=)a) w2)DR) 4$!)GHN)H@@>@)LD)fa)w2)-TLB / 7$7)T>A)LAH?NR>QLBD?<)&O:>N)G>A>)LHTT>@)LD)PBC)

PAGE 100

91 H?@)B?QO:HL>@)HL)ADDP)L>PT>AHLOA>)RDA)a)PB?OL>N<)KJJ)w2)4$![-TLB / 7$7)GHN) LAH?NR>AA>@)LD)3"([-TLB / 7$7)LO:>N<)&O:>N)G>A>)LHTT>@)LD)PBC=)Q>?LABROF>@)HL) EDG>NL)NT>>@)RDA)QDEE>QLBD?=)H?@ ) B?QO:HL>@)HL)ADDP)L>PT>AHLOA>)RDA)IJ)PB?OL>N<) 7BCLOA>)GHN)H@@>@)LD)Q>EEN)@ADT / GBN><),>EEN)G>A>)B?QO:HL>@)HL)0bz,)GBLM)ap),I ) DS>A?BFML<) ) 3. ! 3H;)0[)&D)@>L>APB?>)BR)LAH?NR>QLBD?)GHN)NOQQ>NNROE=)TA>N>?Q>)DR)FA>>?)REODA>NQ>?Q>) RADP)T7HC / '+4)GHN)D:N>AS>@)ONB?F)RE ODA>NQ>?Q>)PBQADNQDT;< ) Q.%("&GB?CV>;@D)$%,N)G>A>)GHNM>@=)LA;TNB?B_>@=)H?@)A>NONT>?@>@)B?)-TLB / 7$7<)KJ)w2)DR) A>NONT>?NBD?)GHN)H@@>@)LD)KJ)w2)LA;TH?):EO>)@;><)&M>)LDLHE)?OP:>A)DR)$%,N)GHN) QDO?L>@)ONB?F)LM>),>EE),DO?L>NN)\!?SBLADF>?]< ) 2. ! K)C)KJ ^ ) Q>EEN)G>A>)HEBUODL>@)B?LD)I)P2)PBQADQ>?LABROF>)LO:>N=)D?>)T>A)G>EE)RDA)H)NBC / G>EE)TEHL><)&O:>N)G>A>)Q>?LABROF>@)RDA)I)PB?OL>N)HL)KaJJATP<)%OT>A?HLH?L)GHN) HNTBAHL>@< ) 3. ! ,>EE)T>EE>LN)G>A>)A>NONT>?@>@)B?)0JJ)w2)-TLB / 7$7< ) 4. ! I)wF)DR)LDLHE)3"()GHN)H@@>@)LD)LM>)A>NO NT>?@>@)Q>EEN)\IJJ)?F)T7HC / '+4)H?@)KVJJ) ?F)TEHNPB@\N])DR)B?L>A>NL]<)"D)3"()GHN)H@@>@)LD)O?LAH?NR>QL>@)QD?LADE)Q>EEN<),>EEN) G>A>)PBC>@):;)QHA>ROE)TBT>LLB?F<) ) 5. ! KJJ)w2)DR)4$!)GHN)H@@>@)LD)LM>)A>NONT>?@>@)Q>EEN<),>EEN)G>A>)PBC>@):;)TBT>LLB?F<) ) 6. ! ,>EEN)G>A>)B?QO:H L>@)RDA)0J / ^J)PB?OL>N)HL)ADDP)L>PT>AHLOA><)7BCLOA>)GHN)PBC>@):;) TBT>LLB?F)>S>A;)KJ)PB?OL>N<) )

PAGE 101

92 7. ! &M>)LAH?NR>QLBD?)A>HQLBD?)GHN)TEHL>@)@ADT / GBN>)D?)RA>NME;)TA>THA>@)Ip)F>EHLB? / QDHL>@)^ / G>EE)TEHL>N)GBLM)IP2)GHAP)H?@)QDPTE>L>)$%,)P>@BH)\(TT>?@BC)9]< ) 8. ! &AH?NR>QLBD?) GHN)B?QO:HL>@)DS>A?BFML)HL)0b z ,)H?@)ap),I ) H?@)SBNOHEB_>@)LM>)?>CL) @H;)ONB?F)LM>)REODA>NQ>?Q>)PBQADNQDT>)LD)QD?RBAP)'+4)>CTA>NNBD?<)) ) '*#"3C<9B@D)Q>EEN=)aJJO2)&1!_DE)GHN)H@@>@)T>A)G>EE)DR)H)^ / G>EE)TEHL>)H?@)Q>EEN)G>A>) TEHQ>@)B?)H)QE>H?)LO:>)H?@)D ?)@A;)BQ>)BPP>@BHL>E;)\KP2)DR)&1!_DE)GHN)H@@>@)T>A)KJQP) TEHL>]<),>EEN)B?)&1!_DE)G>A>)NLDA>@)HL) / VJz,)BR)?>Q>NNHA;):>RDA>)1"()BNDEHLBD?<)1"()GHN) BNDEHL>@)ONB?F)m;PD)3BA>QL / _DE)1"()PB?BTA>T)WBL)B?)H?)1"( / D?E;)MDD@)RDEEDGB?F)WBL) TADLDQDE<)(EE)BNDEHL>@)1"()GHN ) UOH?LBRB>@)ONB?F)"H?D@ADT)IJJJ)\&M>APD%QB>?LBRBQ]<) ) ;/*#"%:?@A>CDC ) Q3"()GHN)N;?LM>NB_>@)RADP)KOF / ) I‹F)1"()GBLM)LM>)*BFM),HTHQBL;)Q3"()1>S>AN>) &AH?NQABTLBD?).BL)\(TTEB>@)9BDN;NL>PN])RDEEDGB?F)LM>)PH?ORHQLOA>AeN)TADLDQDE<)&M>) HPDO?L)DR)B?TOL)1"()ON>@)GHN)W> TL)QD?NLH?L)RDA)>HQM)N>L)DR)1"()NHPTE>N<) ) c6('"B?K"#?B9:CDC " ) &D)UOH?LBR;)F>?>)>CTA>NNBD?=)LMA>>):BDEDFBQHE)A>TEBQHL>N)G>A>)QA>HL>@)RDA)>HQM) Q>EE)DA)LA>HLP>?L)L;T><)Q3"()GHN)N;?LM>NB_>@)RADP)LDLHE)1"()HN)NLHL>@)H:DS><)(EE)Q3"() NHPTE>N)G>A>)@BEOL>@)LD)VA)PBC)RDA)>HQM)TAD:>)GHN) PH@>):;)QDP:B?B?F)4ABP>&BP>{)'>?>)$CTA>NNBD?)7HNL>A)7BC=)IJC)TAD:>)\!3&]=)H?@) 3$4,)* I J<)$?DOFM)PHNL>A)PBC)GHN)PH@>)RDA)>HQM)TAD:>)RDA)HEE)G>EEN)HL)D?Q><)&M>?=) Kf<0VO2)DR)PHNL>A)PBC)GHN)H@@>@)LD)>HQM)@>NBF ?HL>@)G>EE=)a<^0)w2)DR)@BEOL>@)Q3"()GHN) H@@>@)LD)TEHL>)B?)LABTEBQHL>N)LD)MHS>)LMA>>)L>QM?BQHE)A>TEBQHL>N)DR)>HQM)NHPTE><)$HQM)G>EE)

PAGE 102

93 GHN)TBT>LL>@)OT)H?@)@DG?)LD)PBC)LM>)Q3"()H?@)PHNL>A)PBC<)-TLBQHE)RBEP)GHN)TEHQ>@)D?) LM>)TEHL><)4EHL>N)G>A>)NTO?)@DG?)HL)I=JJJ ) 147)LD)>?NOA>)HEE)QDPTD?>?LN)G>A>) QDP:B?>@)HL)LM>):DLLDP)DR)LM>)TEHL>=)H?@)LM>?)TEHQ>@)B?)%L>T-?>)U4,1)7HQMB?>) \(TTEB>@)9BDN;NL>PN]<)3HLH)GHN)QDEE>QL>@):;)AO??B?F)LM>),DPTHAHLBS>), & ) \}}, & ]) TADFAHP=)GMBQM)RDEEDG>@)LM>)Q;QEB?F)THAHP>L>AN[) ) &BP> ) &>PT>AHLOA> ) ,;QE>N ) I)PB?OL>N ) aJz, ) K ) KJ)PB?OL>N ) faz, ) K ) Ka)N>QD?@N ) faz, ) 0J ) K)PB?OL> ) ^Jz, ) %LHLBNLBQHE)H?HE;NBN)GHN)T>ARDAP>@)D?)LM>)A>NOELN)B?)7BQADNDRL)$CQ>E<)'>?>)DR) B?L>A>NL)SHEO>N)G>A>)?DAPHEB_>@)LD)LM>)>?@DF>?DON)QD?LADE)\>)GHN) @>L>APB?>@)ONB?F)$UOHLBD?)I)\(TT>?@BC)9]<) ) 6G<@>D?"3C<9B@DEE)P>@BH)GHN)A>PDS>@)GBLM)SHQ OOP)H?@)Q>EEN)G>A>)GHNM>@)GBLM)aJJOE)KC)49%< ) I< ! ,>EEN)G>A>)E;N>@)GBLM)0aJOE)!4)E;NBN):ORR>A)GBLM)Kp"4 / cJ)H?@)%BFPH)4ADL>HN>) !?MB:BLDA),DQWLHBE)HL)K[KJJJ)ONB?F)AO::>A)TDEBQ>PH?<)%DEOLBD?)GHN)TEHQ>@)B?)H)QE>H?) LO:>)D?)BQ><) ) 0< ! 2;NHL>N)G>A>)B?QO:HL>@)D?)BQ>)RDA)0J) PB?OL>N=)SDAL>CB?F)LMDADOFME;)>S>A;)KJ) PB?OL>N<) ) c< ! 2;NHL>N)G>A>)Q>?LABROF>@)HL)Kc=JJJ)147)RDA)Ka)PB?OL>N)HL)c z ,)LD)T>EE>L)Q>EEOEHA) @>:ABN<) )

PAGE 103

94 a< ! %OT>A?HLH?L)GHN)LAH?NR>AA>@)LD)H)RA>NM)PBQADQ>?LABROF>)LO:>=)ON>@)BPP>@BHL>E;=)DA) NLDA>@)HL) / IJ z ,<) ) ,>C@>G?"$9<@@D?=" " K< ! 4ADL>B?)GHN)PBC>@)GBLM)IC)LABN / LABQB?>)NHPTE>):ORR>A)H?@):DBE>@)RDA)a)PB?OL>N<) &MBN)GHN)EDH@>@)HED?FNB@>)H)QDPP>AQBHE)EH@@>A)\4ADP>FH])B?LD)H)MDP>PH@>)F>E) QDPTABN>@)DR)H)bTHAHLB?F)F>E)GBLM)H)cp)NLHQWB?F)F>E)D?)LDT<)&MBN)GHN)AO?) DOL)GBLM)LM>)HTTADTABH L>)H?D@>)H?@)&ABN / LABQB?>)%3%):ORR>AN=)NLHALB?F)HL)0J#)LM>?) AHPTB?F)LD)Kba#)HRL>A)THNNHF>)LMADOFM)LM>)NLHQWB?F)F>E<) ) I< ! 9EDL)GHN)LAH?NR>AA>@)HL)c z ,)RDA)ca / ^J)PB?OL>N)HL)KJJ#)H?@)LM>?):EDQW>@)GBLM)LM>) HTTADTABHL>)NDEOLBD?)RDA)Ku)MDOA)GBLM)F>?LE>)ADQWB?F<) ) 0< ! &M>) TABPHA;)H?LB:D@;)GHN)H@@>@)HL)LM>)PH?ORHQLOA>AeN)NOFF>NL>@)QD?Q>?LAHLBD?) H?@)B?QO:HL>@)HL)c z ,)RDA)LM>)NOFF>NL>@)LBP><)7>P:AH?>)GHN)GHNM>@)GBLM)&9%&) \KC)RDA)Ka)PB?OL>N)H?@)IC)RDA)a)PB?OL>N]<)%>QD?@HA;)H?LB:D@;)GHN)H@@>@)RDA)0J) PB?OL>N)HL)LM>)NOFF>NL>@)QD?Q> ?LAHLBD?<)%T>QBRBQN)HA>)EBNL>@):>EDG=):;)H?LB:D@;<) ) c< ! 7>P:AH?>)GHN)GHNM>@)0C)RDA)a)PB?OL>N)GBLM)&9%&)H?@)LM>?)$,2)BPHFB?F) A>HF>?LN)\(P>ANMHP)$,2])G>A>)H@@>@)RDA)I / a)PB?OL>N<) ) a< ! 7>P:AH?>)GHN):EDLL>@)@A;)H?@)BPHF>@)D?),M>PB3DQ)Y1%u)\9BD1H@]<) ) • ! +DA)+&-)G>NL>A?N=): EDQWB?F)GHN)@D?>)B?)0p)PBEWl&9%&<)4ABPHA;)+&-)H?LB:D@;) \4MDNTMD%DEOLBD?N)1>R>A>?Q>v[)afb / +&-])GHN)H@@>@)LD)LM>)P>P:AH?>)HL) K[KJJJ)B?)Kp)PBEWl&9%&)H?@)B?QO:HL>@)DS>A?BFML)HL)c z ,)GBLM)F>?LE>)ADQWB?F<) (?LB / PDON>)N>QD?@HA;)H?LB:D@;)\'$)*>HELMQHA>)1>R>A>?Q>)v[) "(f0K#])GHN)

PAGE 104

95 H@@>@)HL)K[IJ=JJJ)B?)KJP2)DR)Kp)PBEWl&9%&)RDA)0J)PB?OL>N)HL)ADDP) L>PT>AHLOA>)GMBE>)ADQWB?F<) ) • ! +DA)+2(')G>NL>A?N=)P>P:AH?>)GHN):EDQW>@)B?)0p)PBEWl&9%&)RDA)H)PB?BPOP) DR)K)MDOA)HL)ADDP)L>PT>AHLOA>)GMBE>)ADQWB?F<)4ABPHA;)+2(')H?LB:D@;)\%BFPH) 1>R>A>? Q>)v[)+0K^a])GHN)H@@>@)HL)K[KJJJ)B?)KJP2)0p)PBEWl&9%&<)%>QD?@HA;) H?LB:D@;)GHN)H?LB / PDON>)HL)K[IJ=JJJ)B?)KJ)P2)0p)PBEWl&9%&< ) • ! +DA)i / LO:OEB?)G>NL>A?N=)P>P:AH?>)GHN):EDQW>@)B?)cp)9%(l&9%&)RDA)K)MDOA)HL) ADDP)L>PT>AHLOA>)GMBE>)ADQWB?F<)4ABPHA;)i / LO:OEB?)H?LB:D@; ) \,>EE)%BF?HEB?F) 1>R>A>?Q>v[)(KKKI^])GHN)H@@>@)HL)K[KJJJ)B?)KJP2)DR)cp)9%(l&9%&<) %>QD?@HA;)H?LB:D@;)RDA)PDON>)GHN)H@@>@)HL)K[IJ=JJJ)B?)KJP2)DR)cp) 9%(l&9%&<) ) • ! +DA)'NW / 0ilj)G>NL>A?N=)P>P:AH?>)GHN):EDQW>@)B?)ap)9%(l&9%&)RDA)K)MDOA)HL) ADDP)L>PT>AHLOA>)GMBE>)ADQ WB?F<)4ABPHA;)'NW / 0ilj)H?LB:D@;)\,HE:BDQM>P) 1>R>A>?Q>)v[)0^V^^I])GHN)H@@>@)LD)P>P:AH?>)HL)K[KJJJ)B?)KJP2)ap) 9%(l&9%&<)%>QD?@HA;)H?LB:D@;)RDA)PDON>)GHN)H@@>@)HL)K[IJ=JJJ)B?)KJP2)ap) 9%(l&9%&<) ) • ! +DA)TMDNTMDA;EHL>@)'NW / 0ilj)G>NL>A?N=)P>P:AH?>)GHN):EDQW>@)B?)ap) 9%(l&9%&)RDA)K)MDOA)HL)ADDP)L>PT>AHLOA>)GMBE>)ADQWB?F<)4ABPHA;)'NW / 0ilj) H?LB:D@;)\ ,>EE)%BF?HEB?F)1>R>A>?Q>)vf00K ])GHN)H@@>@)LD)P>P:AH?>)HL)K[KJJJ) B?)KJP2)ap)9%(l&9%&<)%>QD?@HA;)H?LB:D@;)RDA) AH::BL ) GHN)H@@>@)HL)K[IJ=JJJ) B?)KJP2)ap)9%(l&9%&<)) ) " "

PAGE 105

96 #;@D?B@Q>?@ " ,>EEN)G>A>)LAH?NR>QL>@)HN)?>Q>NNHA;)H?@)HEEDG>@)LD)FADG)K)@H;<)&M>)Q>EEN)G>A>) LM>?)LA>HL>@)GBLM)HQLB?DP;QB? / 3)\ (ERH)(>NHA / ) &M>APD+BNM>A ])LD)NLDT)LAH?NQABTLBD?<)&D)@D) ND=)a)‹FlP2)DR)HQLB?DP;QB? / 3)GHN)H@@>@)LD)QOELOA>)P>@BH<)&M>)RBANL)LBP> / TDB?L)GHN)HRL>A) IJ)PB?OL>N)DR)LA>HLP>?L)\HEE)Q>EEN)NMDOE@):>)>CTDN>@)LD)HQLB?DP;QB? / 3)RDA)HQQOAHL>) A>NOELN]<)-LM>A)LBP>)TDB?LN)G>A>)HL)0J)PB?OL>N=)K)MDOA =)I)MDOAN=)H?@)c)MDOAN<),>EEN)G>A>) QDEE>QL>@)B?)&ABmDE)H?@)NLDA>@)HL) / VJz,)O?LBE)HEE)Q>EEN)G>A>)A>H@;)LD)MHS>)1"()>CLAHQL>@<) +A>>_B?F)LM>)Q>EEN)NLDTN)HEE)TADQ>NN>N)A>EHL>@)LD)LAH?NQABTLBD?)DA)@>FAH@HLBD?<)1"() >CLAHQLBD?)GBEE)TADQ>>@)HN)NLHL>@)H:DS><) ) 6('"P 6<9:Q>GBC>"(ABD?"'>B;@DHQM)A>HQLBD?=)LM>)RDEEDGB?F)QDPTD?>?LN)G>A>)PBC>@)LDF>LM>A[)IC)4,1) 7HNL>A)7BC)\&M>APD)%QB>?LBRBQ]=)IJJ)?F)RDAGHA@)TABP>A=)IJJ)?F)A>S>AN>)TABP>A=)OT)LD)K) ‹F)L>PTEHL>)3"(=)H?@)?OQE>HN> / RA>>)GHL>A)LD)Ia)‹2<)&MBN)GHN)SDAL>C>@)H ?@)NTO?)@DG?) :>RDA>)TEHQB?F)B?)LM>APDQ;QE>A)HL)D?>)DR)LM>)RDEEDGB?F)QD?@BLBD?N)DOLEB?>@)B?)(TT>?@BC) &H:E>N)K)H?@)I<) ) %@>H " &>QH>GB@FG> " &DQ> " *FQ^>G" C " !?BLBHE)3>?HLOAHLBD? ) fcz, ) KJ)PB?OL>N)\F3"(] ) 0)PB?OL>N)\TEHNPB@] ) K ) 3>?HLOAHLBD? ) fcz, ) K)PB?OL> ) 0J ) (??>HEB?F ) aaz,)\HEL>A>@) RDA)>HQM)N>L)DR) TABP>AN] ) K)PB?OL> ) $CL>?NBD? ) bIz, ) K)PB?OL> ) +B?HE)$CL>?NBD? ) bIz, ) b)PB?OL>N ) K ) #HH>?KDY"&B^9>"7 Q$ '>?>AHE)4,1),;QEB?F),D?@BLBD?N )

PAGE 106

97 ) ) %@>H " &>QH>GB@FG> " &DQ> " *FQ^>G" C " !?BLBHE)3>?HLOAHLBD? ) faz, ) 0)PB?OL>N ) K ) 3>?HLOAHLBD? ) faz, ) 0J)N>QD?@N ) 0a ) (??>HEB?F ) aaz,)\HEL>A>@)RDA) >HQM)N>L)DR)TABP>AN] ) 0J)N>QD?@N ) $CL>?NBD? ) bIz, ) K)PB?OL> ) +B?HE)$CL>?NBD? ) bIz, ) a)PB?OL>N ) K ) #HH>?KDY"&B^9>"I [),1!%41 / NT>QBRBQ)4,1)Q;QEB?F)THAHP>L>AN ) -F;DV>GBC>"#CCB: " " ,>EEN)G>A>)LAH?NR>QL>@)HN)?>>@>@<)&M>)9BDLBOP)+BA>RE;)H?@)1>?BEEH)3OHE)2OQBR>AHN>) (NNH;).BL)GHN)ON>@)LD)BNDEHL>)TADL>B?)H?@)AO?)LM>)HNNH;<)&M>)NHPTE>N)G>A>)A>H@)D?)H?) $?NTBA>)I0JJ)4EHL>)1>H@>A)\%DRLGHA>)#>ANBD?)cAN)G>A>)QA>HL>@)GBLM)",9! ) 4ABP>A)9EHNL)ONB?F)N>UO>?Q>N)RADP)'>?9H?W)H?@)8%,%) \8?BS>ANBL;)DR),HEBRDA?BH / ) %H?LH),AO_])'>?DP>)9ADGN>A<)&M>N>)G>A>)QM>QW>@)RDA)>RRBQHQ;) H?@)NT>QBRBQBL;)SBH)4,1)GBLM)5&)F3"()RADP)LM>)Q>EE)L;T>)DR)B?L>A>NL<)QA1"()N>UO>?Q>N) G>A>)QA>HL>@)B?)7HQ#>QLDA)\S>ANB D?)Kc?L)LD)!3&)RDA)N;?LM>NBN)\N>UO>?Q>N)B?) (TT>?@BC)(]< ) ) 7DON>)>P:A;D?BQ)NL>P)Q>EEN)G>A>)TEHL>@)LD)bJp)QD?REO>?Q;)D?)3H;)K<)&M>)?>CL) @H;=)-TLB7$7=)KJ)‹7)LAHQA1"(=)KJ)‹7)QA1"(=)a)‹F)T,(' / &0 / MQHN>'+4 / T(=)H?@)Ka)‹F) 3MHAPHR>QL)3OD)G>A>)PBC>@)LDF>LM >A)H?@)B?QO:HL>@)IJ)PB?OL>N)HL)ADDP)L>PT>AHLOA><) &MBN)GHN)QDP:B?>@)GBLM)H?LB:BDLBQ)RA>>)$%,)P>@BH=)TEHQ>@)D?)Q>EEN=)H?@)B?QO:HL>@)Ic) MDOAN<),>EEN)G>A>)THNNHF>@)LD)H)KJ)QP)TEHL>)LM>)RDEEDGB?F)@H;)H?@)HEEDG>@)LD)FADG)O?LBE) QDED?B>N)QDOE@):>)QMDN>?<) )

PAGE 107

98 0>?Y@GB;@DCLAHQL>@)GBLM)LM>)m;PD)dOBQW / F3"()7B?BTA>T).BL)\(.()m;PD)dOBQW / 3"()7B?BTA>T).BL]=)RDEEDGB?F)PH?ORHQLOA>AeN)TADLDQDE< ) &Z"#CCB: " '>?DPBQ)3"()GHN)ON>@)B?)4,1)LHAF>LB?F)LM>),1!%41 / LHAF>L>@)A>FBD?<)!?)LMBN)&b) HNNH;=)IJJ)?F)4,1)TAD @OQLN)G>A>)PBC>@)GBLM)KJC)"$9ORR>AI)\"$9])H?@)?OQE>HN> / RA>>) GHL>A)LD)H)LDLHE)SDEOP>)DR)Kf)‹2<)&M>)4,1)TAD@OQLN)G>A>)A> / H??>HE>@)HL)LM>)RDEEDGB?F) LM>APDQ;QE>A)QD?@BLBD?N[) ) %@>H " &>QH>GB@FG> " 'BQH"'B@> " &DQ> " !?BLBHE)3>?HLOAHLBD? ) faz, ) ) a)PB?OL>N ) (??>HEB?F ) faz, / ) Vaz, ) / Iz,lN>QD?@ ) ) Vaz, / ) Iaz, ) / JQD?@ ) ) *DE@ ) cz, ) ) *DE@ ) ) -?>)PBQADEBL>A)DR)&b)>?_;P>)\"$9])GHN)H@@>@)LD)LM>)A>HQLBD?)H?@)B?QO:HL>@)RDA)Ka) PB?OL>N)HL)0bz,<)&MBN)GHN)AO?)DOL)D?)H)Ip)HFHADN>)Kp)>LMB@BOP):ADPB@>)F>E)LD)QM>QW)RDA) LM>)HTT>HAH?Q>)DR)0):H?@N=)B?@BQHLB?F)LMHL),1!%41)GDAW>@<) ) 4DGFC"6GEE N)G>A>)TEHL>@)HL)c)C)KJ ^ ) T>A)KJ)QP)TEHL>)GBLM)Kc)P2)P>@BH)D?)3H;)K<) &M>)?>CL)@H;=)P>@BH)GHN)QMH?F>@)c)MDOAN):>RDA>)LAH?NR>QLBD?<)%DEOLBD?)()GHN)TA>THA>@) B?)LM>)MDD@)HN)DOLEB?>@)B?)(TT>?@BC)&H:E>)0< ) #HH>?KDY"&B^9>"EW"%<9F@DB=>?@ " #Q?>)\TLABT_ / +&-] ) IK)wF ) %L>ABE>)5HL>A ) 8T)LD)KJaJ)w2 ) ) 4HQWHFB?F)TEHNPB@)\TN4(YI] ) IK)wF ) $?S>EDT>)S>QLDA)\T73I<'] ) KJ
PAGE 108

99 ) &M>)LAH?NF>?>)\TLABT_ / +&-])H?@)NL>ABE>)GHL>A)G>A>)QDP:B?>@)H?@)LM>?)LM>)EHNL)LMA>>) BL>PN)G>A>)H@@>@)@ADTGBN>)B?LD)LM>)NDEOLBD?)GMBE>)D?)LM>)SDAL>C<)&M>)>?LBA>)PBCLOA>) GHN)SDAL>C>@)ca)N>QD?@N)H?@)LM>?)KJaJ)w2)*9%%)\*H?WeN)9HEH?Q>@)%HEL)%DEOLBD?=) &M>APD+BNM>A])GHN)H@@>@)@ADTGBN> =)D?>)@ADT)>S>A;)0J)N>QD?@N=)GMBE>)LM>)NDEOLBD?)GHN) D?)LM>)SDAL>C<)&MBN)GHN)SDAL>C>@)RDA)H?)H@@BLBD?HE)ca)N>QD?@N)H?@)B?QO:HL>@)0J)PB?OL>N) HL)ADDP)L>PT>AHLOA><)&M>)NDEOLBD?)GHN)H@@>@)@ADTGBN>)LD)LM>)*$.If0&)TEHL>N<)4EHL>N) G>A>)B?QO:HL>@)HL)0bz,)GBLM)ap),I ) RDA)KI / Kc)MDOAN<) ) &M>)?>CL)@H;)P>@BH)GHN)A>PDS>@=)Q>EEN)G>A>)GHNM>@)GBLM)KC)49%=)H?@)KJ)P2) P>@BH)GHN)H@@>@<)3DC)GHN)H@@>@)LD)LM>)P>@BH<),>EEN)G>A>)B?QO:HL>@)B?)LM>)NHP>) QD?@BLBD?N)RDA)D?>)@H;<)&M>)P>@BH)GHN)LM>?)A>PDS>@)H?@)ON>@)LD)LAH?N@OQ>)5&)P$%,N<) &M> ) P$%,N)G>A>)TEHL>@)HL)a)C)KJ a ) Q>EENlP2<)&>?)PBEEBEBL>AN)DR)LM>)SBAHE)P>@BH=)V)wFlP2) TDE;:A>?>)\M>C@BP>LMB?>):ADPB@>]=)H?@)JA>)H@@>@)LD)LM>)Q>EEN)D?)H) F>EHLB?B_>@)TEHL><)&M>;)G>A>)B?QO:HL>@)KI)MDOAN)HL)0bz,)GBLM)ap),I<) ) ,>EEN)G>A>)GHNM>@) GBLM)K C)49%=)FBS>?)ROEE)$%,)P>@BH)GBLM)J@)DS>A?BFML<)&M>)?>CL) @H;=)LM>)$%,)P>@BH)GHN)QMH?F>@)H?@)JA>)H@@>@<) &MBN)TADQ>@OA>)GHN)RDEEDG>@)@HBE;)O?LBE)QDED?B>N)QDOE@):>)QMDN>?<),DED?B>N)G>A>)TEHL>@) B?)H)F>EHLB? B_>@)f^)G>EE)TEHL>)H?@)HEEDG>@)LD)>CTH?@<),>EEN)G>A>)THNNHF>@)LD)H)Ic / G>EE) TEHL>)HN)?>>@>@<) ) ,?@EB";K"Q>KDB " 2 / Q>EEN)H?@)5?L0H)Q>EEN)G>A>)LMHG>@)H?@)HEEDG>@)LD)FADG)LD)QD?REO>?Q;)D?)KJ) QP)TEHL>N<)+A>NM=)NLH?@HA@)$%,)P>@BH)GHN)H@@>@)LD)LM>)TEHL>N)H? @)LM>;)G>A>)B?QO:HL>@)

PAGE 109

100 HL)0bz,)GBLM)ap),I) RDA)RDOA)@H;N<)7>@BH)GHN)QDEE>QL>@)RADP)>HQM)Q>EE)L;T><)7>@BH)GHN) RBEL>A>@)GBLM)I ) w7) NL>ABE>)RBEL>A ) H?@)RAD_>?)HL) / IJz,<)&A>HLP>?L)P>@BH)GHN)PH@>):;) PBCB?F)aJp)QDPTE>L>)QD?@BLBD?>@)P>@BH)\,7=)RADP)G?L0H)Q>EEN])GBLM ) aJp)QDPTE>L>)$%,) P>@BH<)+DA)LM>)QD?LADE=)2 / Q>EE)P>@BH=)aJp)2 / Q>EE)P>@BH)GHN)QDP:B?>@)GBLM)aJp)QDPTE>L>) $%,)P>@BH<)&M>N>)G>A>)H@@>@)LD)5&)P$%,N)H?@)B?QO:HL>@)^)MDOAN<)4ADL>B?)GHN) QDEE>QL>@)RADP)HEE)Q>EEN<) ) %QB99"1<9>;F9>"1GC " " 7DON>)$%,N)DA)*$.If0&)Q> EEN)G>A>)TEHL>@)B?)ROEE)$%,)P>@BH)H?@)HEEDG>@)LD) H@M>A>)DS>A?BFML<)&M>)?>CL)@H;=)Q>EEN)G>A>)LA>HL>@):;)H@@B?F)LM>)NPHEE)PDE>QOE>)@BA>QLE;) LD)LM>)P>@BH<).6 / JIKKK)GHN)FBS>?)B?)@DN>N)DR)K)w7=)KJ)w7=)DA)IJ)w7<),HA@BD?DF>? / K) GHN)FBS>?)B?)@DN>N)DR)KJ)w7=)Ka)w7=) DA)IJ)w7<)(7974)GHN)FBS>?)B?)@DN>N)DR)J)GHN)ON>@)LD)OTA>FOEHL>) 5?L ) NBF?HEB?F)HL)KJP7<)%, / bf) GHN)FBS>?)B?)@DN>N)DR)c)wFlP2=)^)wFlP2=)DA)V)wFlP2<)KJ / 3$9,)GHN)FBS>?)B?)@DN>N)DR)I? ) B?)@DN>N)DR)IJ)w7=)cJ)w7=)DA)^J)w7<)&M>N>) HPDO?LN)G>A>)QMDN>?):HN>@)D?)LM>)EBL>AHLOA><) ) ) ,>EEN)G>A>)LA>HL>@)GBLM)26 / Ifc=JJI=)KJ / 3$9,=)H?@)(7974)RDA)Ic)MDOAN<),>EEN) GBLM)%, / bf)G>A>)LA>HL>@)RDA)0J)PB?OL>N<).6 / JIKKK)H?@),HA@BD?DF>? / K)G>A>)E>RL)D?)Q>EEN) Ic / cV ) MDOAN<)(EE)@DG?NLA>HP)TADLDQDEN)HA>)RDO?@)TA>SBDONE;)B?)7HL>ABHEN)H?@)7>LMD@N<) ) *B?EEN)G>A>)LAH?NR>QL>@)RDEEDGB?F)4$!)LAH?NR>QLBD?)TADLDQDE<)1"()GHN)BNDEHL>@)GBLM) m;PD)3BA>QL / _DE)1"()PB?BTA>T)WBL)HN)NT>QBRB>@)TA>SBDONE;<)KJJ)?F)DA)IJJ)?F)1"()G> A>) ON>@)RDA)"H?DNLAB?F<)%HPTE>N)QD?Q>?LAHLBD?)GHN)QD?RBAP>@)GBLM)dO:BL)HL)8?BS>ANBL;)DR)

PAGE 110

101 (AB_D?H)'>?>LBQN),DA><)&MHL)QDA>)RHQBEBL;)AH?)LM>)"H?DNLAB?F)4EHL>N=)ONB?F)TAD:>N)EBNL>@)B?) (TT>?@BC)(<)3HLH)GHN)H?HE;_>@)GBLM)?%DES>A|)NDRLGHA>=)GMBQM)RBANL)?DAPHEB_>@ ) HEE) QDO?LN)LD)TDNBLBS>)H?@)?>FHLBS>)QD?LADEN)HN)G>EE)HN)LM>)RDOA)MDON>W>>TB?F)F>?>N<)"D) UOHEBL;)QD?LADE)REHFN)G>A>)RDO?@<) ) '>?K>GD?="C " " +BFOA>N)G>A>)TAD@OQ>@)B?)1%LO@BD)ONB?F)FFTEDLI)TADFAHP<)&BP>)QDOAN>)A>NOELN) G>A>)RBL)GBLM)H)EB?>HA) PD@>E<)&AH?NR>QL>@)H?@) / 2!+)A>NOELN)G>A>)HS>AHF>@):;)NHPTE><)(EE) @HLH)TDB?LN)HA>)NMDG?)RDA)>HQM)NHPTE>)B?)LM>)FAHTM<)) ) ) )