Citation

Material Information

Title:
Sequencing of 16s, 18s, and 28s Genes to Clarify Fontigens Phylogeny
Creator:
Huck, Chelsea
Conference:
MSU Denver Undergraduate Research Conference
Place of Publication:
Denver, CO
Publisher:
Metropolitan State University of Denver
Publication Date:

Subjects

Genre:
Conference Papers ( sobekcm )

Notes

Acquisition:
Collected for Auraria Institutional Repository by the Self-Submittal tool. Submitted by Matthew Mariner.
General Note:
Faculty mentor: Hsiu Ping Liu
General Note:
Major: Biology

Record Information

Source Institution:
Auraria Institutional Repository
Holding Location:
Auraria Library
Rights Management:
All applicable rights reserved by the source institution and holding location.

Downloads

This item is only available as the following downloads:


Full Text

PAGE 1

Sequencing of 16S, 18S, and 28S Genes to Clarify Family Status of Fontigens Chelsea Huck chuck2@msudenver.edu Department of Biology, Metropolitan State University of Denver Abstract Fontigens is a genus of tiny freshwater snails currently classified under the family hydrobiidae. Previous studies have shown that the genus occupies a wide variety of habitats and may be prevalent across the United States, but the phylogenetic relationships of the genus are unclear. Three genes will be used to study the family status of Fontigens . The mitochondrial 16S gene, which codes for ribosomal RNA, is relatively variable among species and genus level. The 18S and 28S nuclear ribosomal RNA genes are more conserved and are suitable for family level phylogenetic analyses. Existing primers and the design of new primers for improved gene amplification will be used to amplify and sequence these genes from the six currently recognized species. Analysis of phylogenetic data from this study and available data from the hydrobiidae family will be used to clarify the family status of this genus. This has implications for the conservation of the genus, as well as the ecosystems to which they belong. Results 16S gene was successfully amplified using existing primers. 18S gene was successfully amplified (Fig 3). Varying DNA template concentration and annealing temperature were used to amplify 28S gene. Multiple bands were obtained for samples at annealing temperatures between 45 ° C and 60 ° C. At 62.5 ° C a single band is present at around 500 bp. At 65 ° C no amplified product is present (Fig 4). Conclusions and Future Research Successfully amplified DNA fragments of 16S, 18S and 28S genes will be sequenced. Sequenced samples will be aligned and analyzed using Sequencher. These sequences will then be compared to other Hydrobiidae sequences for these genes in GenBank using Nucleotide BLAST. A phylogeny will be constructed to determine relatedness. The 28S product amplified at an annealing temperature of 62.5 ° C will be sequenced and analyzed. If messy sequences are obtained, the amplification of this gene will be addressed through the redesign of original primers. Once successful amplification has been achieved, gene sequences from all six species will be obtained and compared to others of the Hydrobiidae family to evaluate the phylogenetic relationship of this genus at the family level. This updated phylogenetic analysis will lead to an improved understanding of the evolution of this important fauna and will influence the evaluation of the conservation status of these invertebrates and their ecosystems. Materials and Methods Introduction Invertebrates, particularly snails, are primary consumers in their habitats and often occupy narrow niches, making them vulnerable to (Johnson et al. 2013; Hershler et al. 2014). Unfortunately, these species are often poorly studied, making assessment of their status difficult (Johnson et al. 2013). Snails of the genus Fontigens are one group which there is limited information (Taylor et al. 2013). Individuals in this genus are very small, with shells typically less than 5mm tall (Fig 1; Hershler et al. 1990). They live in freshwater including caves and small streams and springs throughout the Eastern United States and into Canada (Fig 2; Hershler et al. 1990; Brown et al. 2008). Some species are endemic to small geographic areas and concern for the survival of populations has been noted (Taylor et al. 2013). There are currently 9 described species of Fontigens that are classified in the family Hydrobiidae, and their family status is unclear (Hershler et al. 1990). This study will sequence three Fontigens genes: the mitochondrial 16S gene which codes for ribosomal RNA and is variable between species and genus level, and the 18S and 28S nuclear ribosomal RNA genes which are appropriate for family level phylogenetic analyses. This data will then be compared with existing phylogenetic data from the hydrobiidae family to clarify the family status of Fontigens. Fig 2. Map of Fontigens range. (Hershler et al. 1990; Taylor et al. 2013) Fig 1. Fontigens antroecetes (Taylor et al. 2013) Fig 3. Gel showing amplification of the 18S gene on both undiluted (UD) and diluted (1:20) template. Biorad 100 bp size standard (SS) was used. Fig 4. Gel showing amplification of 28S gene at temperature gradient between 45 ° C and 65 ° C for both diluted and undiluted template. Biorad 100 bp size standard (SS) was used. Specimens collected from several sites in the eastern United States representing 6 species of Fontigens (Table 1). DNA extracted using CTAB protocol (Bucklin, 1992). Polymerase Chain Reactions (PCRs) were used to amplify 16S, 18S and 28S using existing primers (Table 2). Redesign original primers for genes that cannot be amplified using existing primers. Phylogenetic analysis with existing hydrobiidae data. Table 1. Sample collection sites Acknowledgments Thank you to Dr. Hsiu Ping Liu for providing samples, instruction in lab technique and assistance in analysis of data. Thanks to the Metropolitan State University Department of Biology for use of their equipment and laboratory facilities. References Bucklin A (1992) Use of formalin preserved samples for molecular analysis. Newsletter of Crustacean Molecular Techniques, 2, 3. Brown KM, Lang B, Perez KE. 2008. The conservation ecology of North American pleurocerid and hydrobiid gastropods. J North Am Benthol Soc. 27(2):484 495. Dayrat B, Tillier A, Lecointre G, Tillier S. 2001. New clades of euthyneuran gastropods (Mollusca) from 28S rRNA sequences. Mol Phylogenet Evol . 19(2):225 235. Hershler R, Holsinger JR, Hubricht L. 1990. A Revision of the North American Freshwater Snail Genus Fontigens ( Prosobranchia : Hydrobiidae). Smithson Contrib to Zool.(509):1 49. Hershler R, Liu HP, Howard J. 2014. Springsnails: A new conservation focus in western North America. Bioscience. 64(8):693 700. Holland PW, Hacker AM, Williams NA. 1991. A molecular analysis of the phylogenetic affinities of Saccoglossus cambrensis Brambell & Cole ( Hemichordata ). Philos Trans R Soc Lond B Biol Sci. 332(1264):185 189. Johnson PD, Bogan AE, Brown KM, Burkhead NM, Cordeiro JR, Garner JT, Hartfield PD, Lepitzki DAW, Mackie GL, Pip E, et al. 2013. Conservation Status of Freshwater Gastropods of Canada and the United States. Fisheries. 38(6):247 282. Mendlová M, Pariselle A, M, A. 2010. Molecular phylogeny of monogeneans parasitizing African freshwater Cichlidae inferred from LSU rDNA sequences. Palumbi SR (1996) Nucleic acids II: The polymerase chain reaction. In: Hillis DM, Moritz C, Mable BK (eds) Molecular systematics. Sin au er Associates, Inc, pp. 205 247 Parasitol Res. 107(6):1405 1413. Taylor SJ, Weck R, Douglas MR, Tiemann J, Phillips CA. 2013. Baseline monitoring and molecular characterization of the state endangered Enigmatic Cavesnail , Fontigens antroecetes ( Hubrict 1940). Final Report to: Illinois Endangered Species Protection Board, Springfield, IL. Gene Primer Name Sequence 16S 16Sar 16Sbr CGCCTGTTTATCAAAAACAT ( Palumbi et al. 1996) CCGGTYTGAACTCAGATCAYGT ( Palumbi et al. 1996) 18S 18S5 18SA GCCAGTAGCATATGCTTGTCTC (Holland et al. 1991) AGACTTGCCTCCAATGGATCC (Holland et al. 1991) 28S C1 D2 ACCCGCTGAATTTAAGCAT ( Dayrat et al. 2001) TGGTCCGTGTTTCAAGAC ( Mendlová et al. 2010) Table 2. Primers Species Location of Collection F. tartarea Organ Cave, Greenbrier Co., WV F. bottimeri Wetzels Spring, Washington, D.C. F. bottimeri Ogden's Cave, 2.3 mi NW of Middletown, VA F. morrisoni Spring, 1.2 km SW of Mustoe, US220, VA F. nickliniana Blowing Springs, 10 km W of Warm Springs, by VA 39, VA F. nickliniana Spring by Stoney Creek, Lantz Mills, Swover Creek Rd, VA F. nickliniana Fleenor Spring, 11 km N of Bristol, 633 Dettor Rd, VA F. orolibas Hawsbill Spring, Shenandoah National Park, Skyline Drive mile 46, VA F. orolibas Spring, Humpback Rock Visitor Center, Blue Ridge Parkway mile 6, VA F. orolibas Hugh Young Cave, VA F. antroecetes Stemler Cave, MO